ID: 1170324353

View in Genome Browser
Species Human (GRCh38)
Location 20:15139830-15139852
Sequence GCATGTCACCACCAGGTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170324353_1170324360 27 Left 1170324353 20:15139830-15139852 CCAGTTACCTGGTGGTGACATGC 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1170324360 20:15139880-15139902 AGCTGACCTTCTGGTGACCAGGG 0: 1
1: 0
2: 0
3: 17
4: 146
1170324353_1170324357 0 Left 1170324353 20:15139830-15139852 CCAGTTACCTGGTGGTGACATGC 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1170324357 20:15139853-15139875 ACAAGTGGCATATAGAGACTGGG 0: 1
1: 0
2: 0
3: 11
4: 156
1170324353_1170324358 18 Left 1170324353 20:15139830-15139852 CCAGTTACCTGGTGGTGACATGC 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1170324358 20:15139871-15139893 CTGGGTTGCAGCTGACCTTCTGG 0: 1
1: 0
2: 0
3: 23
4: 192
1170324353_1170324356 -1 Left 1170324353 20:15139830-15139852 CCAGTTACCTGGTGGTGACATGC 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1170324356 20:15139852-15139874 CACAAGTGGCATATAGAGACTGG 0: 1
1: 0
2: 0
3: 10
4: 124
1170324353_1170324359 26 Left 1170324353 20:15139830-15139852 CCAGTTACCTGGTGGTGACATGC 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1170324359 20:15139879-15139901 CAGCTGACCTTCTGGTGACCAGG 0: 1
1: 0
2: 0
3: 11
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170324353 Original CRISPR GCATGTCACCACCAGGTAAC TGG (reversed) Intronic
902451936 1:16501687-16501709 GCCAGTCACCACCTGGTGACAGG - Intergenic
902501019 1:16911977-16911999 GCCAGTCACCACCTGGTGACAGG + Intronic
903489900 1:23720418-23720440 GCCTGTAACCACCAGGAAACAGG - Intergenic
905847662 1:41246081-41246103 GCCTGTCACTAGCCGGTAACTGG + Intergenic
906456721 1:46003615-46003637 GCATGCCACCACCCTGTAGCAGG + Intronic
916013157 1:160725050-160725072 GAATGTAACCACCAGCTACCTGG + Intergenic
922952418 1:229570108-229570130 GCATGCCACCACGGGGTTACAGG + Intergenic
1067513476 10:46915170-46915192 GCATCTTACCACCAGGAAAGTGG + Intronic
1067648776 10:48136672-48136694 GCATCTTACCACCAGGAAAGTGG - Intergenic
1068059427 10:52048961-52048983 GCATAAGACCTCCAGGTAACGGG + Intronic
1075584795 10:123649886-123649908 GCAGGGCACCACCATGTGACAGG + Intergenic
1078898545 11:15620291-15620313 GCATGTACCCAACAGGTAATAGG + Intergenic
1083688055 11:64389125-64389147 GTAAGTCTCCACCAGGCAACAGG - Intergenic
1085126200 11:74004327-74004349 GCTTGTCACCACAATGTACCTGG + Intronic
1087798926 11:102483147-102483169 GCATATCATCAACAGGTAAAAGG + Intronic
1089354233 11:117839552-117839574 GCATGCCAACACCAGGAAATGGG - Intronic
1092052134 12:5479466-5479488 GCCTGTGATCACCAGGTAAGTGG - Intronic
1095599833 12:44002005-44002027 ACATGGCACCACCTGTTAACAGG + Intronic
1097673828 12:62574750-62574772 GCAAGTCAGGACCAGGTCACAGG - Intronic
1100618402 12:96249358-96249380 GCGCGTCACCACCAGCTCACAGG - Intronic
1101521080 12:105483023-105483045 GCATGTCACAAACAGGGATCAGG - Intergenic
1102966097 12:117127426-117127448 GCATGTCAGTAGCATGTAACAGG + Intergenic
1103611446 12:122126620-122126642 GCAGGCCACGACCAGGTCACAGG + Intronic
1106922237 13:34575947-34575969 GCATGTCATCTCCAGGGAACAGG + Intergenic
1107483079 13:40801347-40801369 GCATTTCCCCAACAGGTAAGAGG - Intronic
1110158664 13:72350086-72350108 TCATGTCACCATCTGGCAACTGG + Intergenic
1110993751 13:82077040-82077062 GCAGGTCACCACGAGGTACATGG + Intergenic
1111196157 13:84876482-84876504 GAATGTCAGCTCCAGGCAACAGG - Intergenic
1111379347 13:87426309-87426331 CCATGTCACCATCAAGAAACAGG - Intergenic
1114532109 14:23402795-23402817 GCATGTCTGCACCAGGCAAGGGG + Exonic
1129120766 15:73395022-73395044 TCATGTCACCATCAGGCACCTGG + Intergenic
1140258131 16:73354525-73354547 GCATGTTACCTGCAGGTAACAGG - Intergenic
1141146193 16:81531778-81531800 CCATGTCACCACCAGGAAGGGGG + Intronic
1163365183 19:16872027-16872049 GAATGTCAACACAAGGAAACTGG + Intronic
1163367298 19:16882724-16882746 CCATGTCACCTCCAGACAACAGG + Intergenic
1166157890 19:40928533-40928555 GCATGTTTTCACCAGGTAAAAGG - Intergenic
1168583106 19:57571620-57571642 CCAAGTCACCACCTAGTAACTGG - Exonic
929591861 2:43152916-43152938 GCCTGTGGCCCCCAGGTAACCGG - Intergenic
932714730 2:74092977-74092999 GCCTATCAGAACCAGGTAACGGG + Exonic
937040452 2:118816528-118816550 CCATGCCACCCACAGGTAACAGG - Intergenic
940656729 2:156496075-156496097 GCATTTCAGAACCAGTTAACAGG + Exonic
941034625 2:160554794-160554816 GCATCACCCCACCAGGTAAAGGG - Intergenic
947113801 2:226747856-226747878 GCTTGTCACAACCAGGAAAGGGG + Intronic
1170324353 20:15139830-15139852 GCATGTCACCACCAGGTAACTGG - Intronic
1173307372 20:41863137-41863159 GCATGTTCCCACCAGGAATCAGG - Intergenic
1174169529 20:48607335-48607357 CCATGTCCCCACCAGGTGGCTGG + Intergenic
1175656704 20:60777027-60777049 GCATGCAACCACCTGGTATCTGG - Intergenic
1176201771 20:63864149-63864171 GCGCGTAACCACCAGGCAACTGG - Intergenic
1177191829 21:17860730-17860752 GCATGACATCTCCAGGTAGCAGG + Intergenic
1179377517 21:40864066-40864088 GCATTCCATCACCAGGTCACTGG - Intergenic
1181385075 22:22538760-22538782 GCAGGGCACCACCAGGATACTGG + Intergenic
1181928751 22:26381782-26381804 GACTGTCACCACCATGTCACCGG - Intronic
1184610072 22:45597726-45597748 CAATGTCATCACCAGGTAGCAGG + Intronic
1185325381 22:50223061-50223083 GCTTCTCACCAGCAGGCAACTGG + Intronic
954944460 3:54407689-54407711 ACATGTGACCACCAAATAACTGG - Intronic
956626792 3:71274441-71274463 GCTCGTCACCACCAGGAAAGGGG + Intronic
958635658 3:96741535-96741557 GCATGTAACTACCAGGTCAAAGG - Intergenic
961566534 3:127767796-127767818 ACATGTCTTCAGCAGGTAACTGG + Intronic
964726301 3:159817733-159817755 GAATTTCACCAGAAGGTAACAGG - Intronic
964890243 3:161526072-161526094 TCATGTCATCATCAGATAACAGG + Intergenic
965838587 3:172878442-172878464 TCATGACACCACCTGGTAAAAGG - Intergenic
967925350 3:194641445-194641467 GAATGTAACCACCGGGTGACAGG - Exonic
968509195 4:987935-987957 GCTTGTCACCACCAGGTGGGCGG + Exonic
969594458 4:8141082-8141104 GCAAGTCATCTCCAGGTAGCGGG + Intronic
969842768 4:9894793-9894815 TCATTTCAGCACCAGGTCACTGG - Intronic
970263224 4:14251797-14251819 GCTTGTCACCAGCAGGGAATGGG + Intergenic
971283067 4:25257995-25258017 GCATGTGACAAACAGGTAACAGG - Intronic
971686485 4:29776226-29776248 GCATATCACCACCCTGTAAAAGG + Intergenic
977578288 4:98697950-98697972 TTATGTCACCTCCAGATAACAGG - Intergenic
981782981 4:148445957-148445979 GAGTGTCACTACCAGTTAACCGG + Intergenic
987802150 5:22713000-22713022 GCATGTATACACCAGGAAACTGG + Intronic
988785697 5:34564062-34564084 CCATGACTCCACCAGGTCACTGG + Intergenic
995392261 5:111652520-111652542 TCATGGCACCACCATGTAAAAGG - Intergenic
996808188 5:127481851-127481873 TCATGCTACCTCCAGGTAACAGG + Intergenic
996819378 5:127609219-127609241 GCTTGGCACCTCCAGGAAACAGG + Intergenic
1005278957 6:24250267-24250289 ACATGTCAACACCAGGTTGCAGG + Intronic
1008052750 6:46916475-46916497 GCACATCAGCAGCAGGTAACAGG - Intronic
1008223201 6:48878885-48878907 GAATATCAGCTCCAGGTAACAGG - Intergenic
1010522769 6:76861334-76861356 GCATGTGACCCACAGGTCACGGG - Intergenic
1014718109 6:124888977-124888999 GTATGTCACCATCAGAAAACAGG - Intergenic
1016889911 6:148995609-148995631 ACATGTGACCCACAGGTAACTGG - Intronic
1019058881 6:169241887-169241909 GCATGTCACCACCGAGTACGTGG - Exonic
1019064323 6:169283485-169283507 GCATGGCACATCCAGGCAACAGG + Intergenic
1019364407 7:624891-624913 GAATGGCACCATCAGTTAACAGG + Intronic
1022450024 7:30505418-30505440 GCATGTAACTTCCATGTAACAGG - Intronic
1025093010 7:56078494-56078516 CCGGGTCACCACCAGGTAAGGGG + Intronic
1026156000 7:67826282-67826304 TCAGGTGACCACCAGGTAATGGG + Intergenic
1031474316 7:122204370-122204392 ACCTGCCACCACCAGGTAGCTGG + Intergenic
1035011028 7:155714955-155714977 GCGGGTCACCACCAGGCCACTGG + Intronic
1035271042 7:157720144-157720166 GCATGGCACCACCAGGGACCAGG + Intronic
1035375268 7:158403348-158403370 GCATGTCTCCACCAGGCTGCAGG + Intronic
1036620413 8:10421505-10421527 GCGTGTCACCTCCATGTAATAGG + Intronic
1043295231 8:78653836-78653858 GAATATCAGCTCCAGGTAACAGG - Intergenic
1048458748 8:134602197-134602219 GGATGTCCCCACCAGGTTCCAGG + Exonic
1055564344 9:77553008-77553030 TCATGTCACCATTAGGTAAATGG - Intronic
1059643772 9:116243805-116243827 GCATTTCAGCAACAGGTTACTGG - Intronic
1061204500 9:129155216-129155238 GCACCTCATCTCCAGGTAACTGG + Intergenic
1062348319 9:136125826-136125848 GCATGGCACCAACAGGCTACTGG - Intergenic
1185484331 X:470896-470918 GAACGTCTCCACCAGGTACCCGG + Intergenic
1187773839 X:22732489-22732511 GCATATCACTACTAGGAAACAGG - Intergenic
1195472196 X:105243314-105243336 GCACGTCTTCACAAGGTAACAGG - Intronic
1195838695 X:109148882-109148904 CCATTTCACTACCAGGTATCTGG + Intergenic
1196709973 X:118752614-118752636 GCAGGCTACCACCAAGTAACAGG - Intronic
1197246535 X:124172587-124172609 CCAAGTCACCACCTGGCAACTGG - Intronic