ID: 1170324814

View in Genome Browser
Species Human (GRCh38)
Location 20:15145177-15145199
Sequence CTGTATTCACAGATGACATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170324813_1170324814 8 Left 1170324813 20:15145146-15145168 CCATATGTGCAACAAGGAAATTC 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1170324814 20:15145177-15145199 CTGTATTCACAGATGACATTTGG 0: 1
1: 0
2: 2
3: 17
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170324814 Original CRISPR CTGTATTCACAGATGACATT TGG Intronic
902433864 1:16384491-16384513 CTGTATTCCCAAGTGAAATTGGG + Intronic
907695206 1:56718592-56718614 CTTTATTGACAAATGTCATTTGG + Intergenic
907751607 1:57268724-57268746 CTGTATTCACTCATAAAATTGGG - Intronic
909335139 1:74464658-74464680 CTGTGTACACAGATGAGACTGGG - Intronic
909935334 1:81544523-81544545 GAGAAGTCACAGATGACATTAGG - Intronic
910029972 1:82707809-82707831 CTGTACTCAAATAGGACATTGGG - Intergenic
911273594 1:95833368-95833390 TTGTATTCACAGTAGAGATTAGG - Intergenic
913067030 1:115265502-115265524 CTCATTTTACAGATGACATTGGG - Intergenic
916998211 1:170324994-170325016 CAGTGTTCACATATGAAATTTGG + Intergenic
919602828 1:199643476-199643498 CTTTACTCACAGATGACATAAGG + Intergenic
923283521 1:232467726-232467748 CTGGAGTGCCAGATGACATTTGG - Intronic
924319659 1:242836240-242836262 CTTTATTCACAGGTGATAGTTGG + Intergenic
1064517131 10:16163176-16163198 TTATATTCACAGATTACTTTGGG + Intergenic
1064545448 10:16445732-16445754 ATGTTTTCAGAGAAGACATTGGG - Intronic
1064723020 10:18249121-18249143 CTATTTTCTCAGATGAAATTAGG - Intronic
1064791780 10:18964825-18964847 TTATATGCACAGAAGACATTTGG + Intergenic
1065095863 10:22280109-22280131 CTCTATTCAAAGTAGACATTAGG - Intergenic
1065620536 10:27576502-27576524 CTATATTCCCACATGACTTTAGG + Intergenic
1066640916 10:37553332-37553354 CTGCATTAACAGATGACTCTAGG + Intergenic
1067391667 10:45868902-45868924 CTGTATTTAAAGAGTACATTGGG - Intergenic
1067403015 10:45994760-45994782 CTGTATTTAAAGAGTACATTGGG + Intronic
1067871623 10:49967240-49967262 CTGTATTTAAAGAGTACATTGGG + Intronic
1068566538 10:58581966-58581988 GTATATGCACAGATGACCTTGGG - Intronic
1069080947 10:64087758-64087780 TTGTATTCACAGAGGATGTTGGG + Intergenic
1070299730 10:75194436-75194458 CTGTATGAACAGAGGACAGTGGG - Intergenic
1072362416 10:94672897-94672919 CTGTATTCACACATAACAAAAGG - Intergenic
1074796905 10:116955864-116955886 CTGTCTGCACACATTACATTAGG + Intronic
1076024209 10:127099250-127099272 CTGTCCTCACAGAGGACATTGGG - Intronic
1079724838 11:23867966-23867988 CTGTGTTCAGAGATGACGGTAGG - Intergenic
1080359207 11:31493479-31493501 CTGTAATTCAAGATGACATTTGG + Intronic
1080731124 11:34954363-34954385 CTGTGTACACAGATGAGATTAGG + Intronic
1080784753 11:35464578-35464600 CTCTACTCACAGGGGACATTTGG - Intronic
1083062117 11:59884802-59884824 CTCTATTTAAAGATGACATGAGG - Intergenic
1087984614 11:104662154-104662176 CTGAAATCACAGATGTCATATGG - Intergenic
1090101475 11:123801780-123801802 CTGTATTCAAAGAAGAAATTAGG - Intergenic
1090983188 11:131741437-131741459 CTGTTTTCTCAGATTACCTTTGG + Intronic
1092467688 12:8748089-8748111 CTGTATACTTAGATGACAGTAGG + Intronic
1092593270 12:9971388-9971410 CTGAAGCCACAGATGAGATTTGG + Intronic
1094551278 12:31454212-31454234 CTGGATTCAAAGATTACATCAGG - Intronic
1099593860 12:84631624-84631646 CTATACTCACAGCTGAGATTGGG + Intergenic
1100931507 12:99615124-99615146 GTGTTTACACAGATGACATTAGG + Intronic
1102118205 12:110419641-110419663 CTGTATTCCTAGGGGACATTGGG + Intergenic
1102387325 12:112520502-112520524 CAATATTCACAGATTGCATTAGG + Intergenic
1107375009 13:39794845-39794867 ATATATTTACAGTTGACATTGGG + Intergenic
1107829871 13:44364946-44364968 TTGTATTTCCAGATGACATGAGG + Intergenic
1108464240 13:50698304-50698326 CTGTCTGCACAAATGACCTTGGG + Intronic
1109075498 13:57829540-57829562 CTGCATTCTAAGACGACATTTGG - Intergenic
1111415300 13:87933705-87933727 TTTTATCCACAGATGACTTTGGG + Intergenic
1111521781 13:89413961-89413983 GTGAATTCACAGTTGAAATTGGG - Intergenic
1113026955 13:105950761-105950783 CAGTATTCAAATCTGACATTTGG - Intergenic
1114170112 14:20263852-20263874 ATCTATTCTCAGAAGACATTTGG - Intronic
1114204059 14:20551611-20551633 CGATATTCTTAGATGACATTAGG - Intergenic
1115411556 14:33081137-33081159 CTCTATTATCAGATGATATTGGG + Intronic
1116530733 14:45969818-45969840 CTTTATTCTCAGATAACATTTGG - Intergenic
1117215901 14:53551352-53551374 CTCTATTCTCAGATTCCATTTGG + Intergenic
1118789972 14:69081714-69081736 ATGGATTGACAGAGGACATTTGG - Intronic
1120774358 14:88417072-88417094 CTTTATTAACTGAAGACATTGGG + Intronic
1123219418 14:106842420-106842442 CTGCAGGCACAGATTACATTTGG - Intergenic
1125375128 15:39020686-39020708 TTGAATTCACAGGCGACATTCGG - Intergenic
1125468611 15:39980447-39980469 TTGTATTCACAATTGACATCTGG - Intronic
1126636025 15:50780587-50780609 CTGAATTCAAAGGTGACTTTTGG + Intergenic
1127064095 15:55219111-55219133 CTTTATTCACAGAGGATAGTTGG - Intronic
1128396624 15:67232599-67232621 CTGAACTCAAAGATGACATCTGG - Intronic
1128443235 15:67732990-67733012 CTGTACTCACACCTTACATTTGG + Intronic
1135742142 16:24985069-24985091 CTGTGTCCCCAGAGGACATTTGG + Intronic
1137320751 16:47379364-47379386 CTGTTTTCTCAGATCACTTTTGG - Intronic
1139218439 16:65153208-65153230 CTGAATTAAAAGGTGACATTTGG + Intergenic
1140589497 16:76335044-76335066 CTTTATTCACAGAAGAGAGTTGG + Intronic
1140768188 16:78179320-78179342 ATGGATTAACAGATTACATTTGG + Intronic
1140983130 16:80129905-80129927 TTGTGTTCTCAGATCACATTCGG - Intergenic
1145899286 17:28479557-28479579 CTGTTTTTACAGATGCCTTTGGG - Intronic
1148935981 17:51165149-51165171 CTGTTTTCACAGTTGACATTTGG + Intronic
1155145859 18:23082905-23082927 TTGGATTCGCAGATGACTTTGGG + Intergenic
1156853875 18:41759439-41759461 TGGTATGCACAGATGACAGTTGG - Intergenic
1165833833 19:38743065-38743087 ATGTCTTCACAGATGAACTTCGG + Exonic
1166127727 19:40725685-40725707 CTGTATTCATGGGTGACCTTGGG + Intronic
925693155 2:6546424-6546446 GTGGATTCACAGAAGACATATGG - Intergenic
925774957 2:7325880-7325902 CTGGTTTCACAGATAAAATTTGG + Intergenic
925824359 2:7832917-7832939 CTTTATTAACATTTGACATTTGG - Intergenic
926995521 2:18731071-18731093 CTGAATTCAAAGATGAAATGTGG + Intergenic
928282994 2:29965054-29965076 CAGTCTTTACAGATGACATCTGG + Intergenic
928367375 2:30713206-30713228 CAGTACGGACAGATGACATTTGG + Intergenic
929132584 2:38592726-38592748 CTGTATTTACAAATGCCATCAGG + Intronic
930351382 2:50259958-50259980 CTGCATGTACAGATGAAATTGGG + Intronic
933371958 2:81425726-81425748 CTGTGATTTCAGATGACATTTGG + Intergenic
933434523 2:82229863-82229885 CTGAATACAAAGATAACATTGGG - Intergenic
934495301 2:94790783-94790805 CTGTTTAAACAGCTGACATTTGG + Intergenic
935443056 2:103124162-103124184 CTTTATTTAAAGGTGACATTAGG + Intergenic
936149652 2:110008259-110008281 CTGTCTTCACAGCAGACACTGGG - Intergenic
936195026 2:110363110-110363132 CTGTCTTCACAGCAGACACTGGG + Intergenic
937205079 2:120231169-120231191 GTGTTTTCACAGATGCCTTTAGG + Intergenic
938938220 2:136146304-136146326 CTGAGTTCACAGATAACAATGGG + Intergenic
941936467 2:170985273-170985295 CTATATTCAGAGATAAAATTTGG - Intergenic
942290175 2:174461493-174461515 CTGTAATCACAAGTGATATTGGG + Intronic
943718485 2:191178299-191178321 CTGTATGAACAGAAGACATGGGG + Intergenic
943848162 2:192678432-192678454 TTGTAATTACAGATTACATTAGG - Intergenic
944371451 2:198988115-198988137 CTCTATTCACTGGTGCCATTTGG + Intergenic
944952999 2:204774552-204774574 CTGTATTTATGGATAACATTAGG + Intronic
947374869 2:229485392-229485414 GGGTGTTCACAGATTACATTTGG + Intronic
1170324814 20:15145177-15145199 CTGTATTCACAGATGACATTTGG + Intronic
1170632623 20:18078536-18078558 CTGTATTGAAACATCACATTAGG + Intergenic
1173426372 20:42946955-42946977 TTGTACCCTCAGATGACATTTGG - Intronic
1177407034 21:20683229-20683251 CTGTCTTCATTAATGACATTAGG + Intergenic
1179362504 21:40725399-40725421 CTATCTTCCCAGAGGACATTGGG + Intronic
1179612653 21:42562681-42562703 CTGTGTTCACACATGACATGGGG - Intronic
1180583102 22:16860106-16860128 CTGTCTTCACAGCAGACACTGGG + Intergenic
1183222798 22:36527914-36527936 CTTCCTTCAGAGATGACATTTGG + Intronic
950067297 3:10123259-10123281 CTGTTTTCACAGATGGAATGTGG + Intronic
950519451 3:13487974-13487996 CTGTGATCACAGGTGACATGTGG + Intronic
951414187 3:22402969-22402991 CTGTATTCACCAATCAAATTTGG + Intergenic
951892039 3:27576536-27576558 CTGAATTCAGAGATAACATCTGG - Intergenic
953470252 3:43160141-43160163 CTGTCTTCCCAGATTATATTCGG - Intergenic
954272963 3:49523832-49523854 CTGATTTTACAGATGACACTGGG + Intronic
956075841 3:65504531-65504553 CTGTACACAAAGAAGACATTGGG + Intronic
956175215 3:66466408-66466430 CATTCATCACAGATGACATTTGG + Intronic
957514009 3:81227793-81227815 TTATAATTACAGATGACATTTGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960144486 3:114186248-114186270 CTGTAATCCCAGCTGAGATTGGG - Intronic
960379834 3:116946386-116946408 CTGTATACCCACATGACTTTGGG - Intronic
962445836 3:135463827-135463849 CTGCATCCACACATGACATAAGG - Intergenic
966335981 3:178868800-178868822 CTGCATTCAAATAAGACATTTGG + Intergenic
966685222 3:182685940-182685962 CTGTATTCACAGAAAAGATTTGG + Intergenic
969406025 4:6992333-6992355 GTGTATTCACAGATGATATTGGG + Intronic
970943243 4:21660515-21660537 AGGTAGTCACAGATGACAGTTGG + Intronic
971209941 4:24606475-24606497 ATTTATTCATATATGACATTTGG - Intergenic
972097803 4:35370134-35370156 CTGTGTTCTCACATGACATAAGG + Intergenic
973643306 4:52924867-52924889 CTGCATTCACAGATGAGATGTGG - Intronic
974035609 4:56815409-56815431 CTCTATTCAAAGATGACAGAGGG + Intronic
974562471 4:63539950-63539972 CTGTCTTCACAGCTGTCATTTGG - Intergenic
974977010 4:68904507-68904529 CTGCAGGCACAGATTACATTTGG - Intergenic
975048289 4:69829611-69829633 CTGCAGGCACAGATTACATTTGG - Intronic
975446401 4:74470594-74470616 TTGTTTTCAAACATGACATTGGG + Intergenic
975525484 4:75344196-75344218 CAGTATCCAAAGATGACATTGGG + Intergenic
975989021 4:80237537-80237559 TTTTGTTCACAGAAGACATTTGG + Intergenic
976759182 4:88529944-88529966 CTGTGTTCTCAGATTATATTAGG + Intronic
979553604 4:122019348-122019370 CTGTATTCACAGACTGTATTGGG - Intergenic
979772096 4:124539236-124539258 CTGTATTAACAGAGGACAACTGG + Intergenic
980985710 4:139692350-139692372 CTGTATTCCCAGAAGGAATTGGG - Intronic
981611982 4:146603275-146603297 CTGTGTTCACAGAACACACTTGG + Intergenic
982164939 4:152605611-152605633 ATGGATGCAAAGATGACATTCGG + Intergenic
982243738 4:153327364-153327386 CTGTAATCAGAGATGACAACAGG + Intronic
984664876 4:182415637-182415659 CTGTTTTCATATATGACAGTGGG + Intronic
986847828 5:11776224-11776246 CTGTAGTCACAGAGGACTTCAGG + Intronic
987577459 5:19748717-19748739 CTGAACTCTCAGAAGACATTTGG + Intronic
989703443 5:44298324-44298346 CTGTATCCTCAGATGACAGAAGG - Intergenic
989772496 5:45161433-45161455 CTGTGGTCAGAGATGACAGTGGG + Intergenic
989777823 5:45230495-45230517 GTGTATTCACAAATAACACTTGG + Intergenic
997717666 5:136054069-136054091 CTGTATTCAAAGGTAACATGGGG + Exonic
998402546 5:141855541-141855563 CTCTATCCTCAGATGAAATTGGG + Intronic
999713085 5:154335730-154335752 CTGTACTTTCAGATGAGATTGGG - Intronic
1000495580 5:161979597-161979619 ATTTATTCACATATCACATTGGG + Intergenic
1004561373 6:16754736-16754758 CTGTACGCACAGATCACATGTGG - Intronic
1006382627 6:33708855-33708877 GTGCATTCTCAGGTGACATTAGG + Intronic
1008531113 6:52459931-52459953 CTGTAATCTCAGATTACTTTGGG - Intronic
1009394611 6:63184745-63184767 TTATATTCAAAGATGGCATTAGG - Intergenic
1011170656 6:84501071-84501093 GTGTATTATCAGATGACTTTTGG + Intergenic
1012429596 6:99150731-99150753 CTGTATTCATAAATTGCATTTGG - Intergenic
1013280479 6:108631841-108631863 CAGGATTCACATGTGACATTTGG + Intronic
1013984989 6:116180762-116180784 ATTTATTCACTGATGAAATTGGG - Intronic
1015671119 6:135690959-135690981 ATCTATTGACAGACGACATTAGG + Intergenic
1020464805 7:8465346-8465368 CTCTATGCTCAGGTGACATTGGG + Intronic
1020768772 7:12360102-12360124 CTGTGTTCACAGAACACAGTGGG - Intronic
1024488455 7:49947821-49947843 CTGTGTTCAGAGATGCCATCTGG + Intronic
1025927241 7:65969994-65970016 CTGTTTTCACAGATGGTCTTTGG - Intronic
1026319152 7:69253956-69253978 CTGTATCCACTGCTGTCATTTGG + Intergenic
1026655931 7:72256525-72256547 CTGGATTCACAGATAAGACTTGG + Intronic
1026984966 7:74549027-74549049 CTGTAATCCCAGCTGGCATTTGG + Intronic
1027711371 7:81605641-81605663 CTGTGTTCACAGATCGAATTCGG + Intergenic
1027902869 7:84140518-84140540 CTGTATTCATTGATGGCTTTAGG + Intronic
1027943261 7:84712069-84712091 CTTTATTCACAGATGAAGTGTGG - Intergenic
1029893851 7:103960377-103960399 CTTTATTCACATATCACCTTTGG + Intronic
1030678938 7:112413863-112413885 CTGTATTCACAATTGAAGTTGGG + Intergenic
1031024794 7:116668673-116668695 CTGTGCTCAGAAATGACATTAGG + Intergenic
1032255438 7:130293414-130293436 CTGATTTCACAGATGAAATGGGG - Intronic
1033666413 7:143444983-143445005 GTGTATTCTCCGATGACCTTTGG + Intergenic
1034433419 7:151051971-151051993 CTGTCTCCACAGGTGACATTGGG + Exonic
1034524852 7:151651762-151651784 ATGTTGTCACAGATGACATCAGG + Intronic
1034592556 7:152154511-152154533 CTGTATTCACAGATGTCAGCAGG - Intronic
1034924008 7:155106408-155106430 CCGTCTTCACAGAAGACACTGGG - Intergenic
1035427311 7:158788269-158788291 CTGTATTCAAAAATAAAATTAGG - Intronic
1036943567 8:13073418-13073440 CTGTAATCCCAGGTGACACTCGG + Intergenic
1037573160 8:20175928-20175950 CTCTATTCTCAAAGGACATTGGG - Intronic
1038432178 8:27509238-27509260 CTGTATGGATAGATCACATTGGG + Intronic
1041111220 8:54484605-54484627 CTTTATTCACAAATGACATATGG - Intergenic
1042145582 8:65725962-65725984 CTTTATTCACGGATACCATTTGG - Intronic
1042447880 8:68909610-68909632 CACTATTTACTGATGACATTTGG + Intergenic
1043000327 8:74751839-74751861 CTGTATAAACAGATGACTGTAGG + Intronic
1043539554 8:81244134-81244156 CTGTTTTCACAGATCACCTCAGG - Intergenic
1046059484 8:109119530-109119552 CTGTCTTCACATATGACTATTGG - Exonic
1046152752 8:110249749-110249771 CTGCATTCCCAGATGAATTTAGG + Intergenic
1046480728 8:114814044-114814066 ATGGATTCACAGCTGAAATTTGG + Intergenic
1047455893 8:125010933-125010955 CTCTATTCCCAGATCACACTGGG + Intronic
1048225084 8:132577435-132577457 ATGTACTGATAGATGACATTTGG - Intronic
1050689786 9:8213445-8213467 TTGAATTTGCAGATGACATTGGG - Intergenic
1050856685 9:10366192-10366214 CTGTATTTACAGATGGCATAGGG - Intronic
1052294672 9:26883224-26883246 CTGTAATTCCAGATGAGATTTGG - Intronic
1052755943 9:32541294-32541316 GTCTATTTAAAGATGACATTTGG - Exonic
1056034813 9:82593228-82593250 TTTTATTCACAGATCAAATTGGG + Intergenic
1057775230 9:98002489-98002511 CAGTATTTACACATTACATTGGG + Intronic
1061739055 9:132686113-132686135 TTGTTTTTACAGATGAGATTGGG + Intronic
1185731284 X:2463929-2463951 CTGTATGCACTGAAGACGTTCGG + Intronic
1186842721 X:13500777-13500799 GTGATTTCACAGATGACAATAGG - Intergenic
1187230585 X:17418480-17418502 CTGTTTTGACAGATTAGATTTGG - Intronic
1187312249 X:18156353-18156375 CTGGATTCACAGAAAACCTTTGG + Intergenic
1188254677 X:27947073-27947095 CGGTAATCACAGATGCAATTCGG + Intergenic
1194000257 X:88420075-88420097 CTGTAATTAAAGATGAGATTTGG - Intergenic
1194046438 X:89011180-89011202 TTAAATTCACATATGACATTAGG + Intergenic
1195135564 X:101904320-101904342 TTTTATTCACAGACGCCATTTGG - Exonic
1195279189 X:103313526-103313548 CTGAATTTACAGATGAATTTGGG - Intergenic
1196629725 X:117924144-117924166 CTGAATTGACAGATATCATTTGG - Intronic
1197675012 X:129320000-129320022 CTTCATGCACAGATGACATTTGG - Intergenic
1197808502 X:130419594-130419616 TTGACTTCACAGAGGACATTTGG + Intergenic
1198821324 X:140651349-140651371 CTGAAGTCACAGATAACTTTTGG + Intergenic
1199546266 X:149009939-149009961 CTACATTCACATATGGCATTGGG + Intergenic
1199548344 X:149031901-149031923 CAGAATTCACAGATGCCTTTTGG + Intergenic
1200816431 Y:7538014-7538036 CTGTGTTCTCACATGACATAAGG - Intergenic
1200900541 Y:8426930-8426952 CTGTTTTCATATATGACAGTTGG + Intergenic