ID: 1170329370

View in Genome Browser
Species Human (GRCh38)
Location 20:15191422-15191444
Sequence TCACTATAACTGCAGTCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 116}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170329370_1170329376 -1 Left 1170329370 20:15191422-15191444 CCTCTTGACTGCAGTTATAGTGA 0: 1
1: 0
2: 0
3: 3
4: 116
Right 1170329376 20:15191444-15191466 AAGAGGTGGGCCAAAGGGTGTGG 0: 1
1: 1
2: 1
3: 20
4: 282
1170329370_1170329379 6 Left 1170329370 20:15191422-15191444 CCTCTTGACTGCAGTTATAGTGA 0: 1
1: 0
2: 0
3: 3
4: 116
Right 1170329379 20:15191451-15191473 GGGCCAAAGGGTGTGGCGTGGGG 0: 1
1: 0
2: 1
3: 16
4: 182
1170329370_1170329374 -7 Left 1170329370 20:15191422-15191444 CCTCTTGACTGCAGTTATAGTGA 0: 1
1: 0
2: 0
3: 3
4: 116
Right 1170329374 20:15191438-15191460 ATAGTGAAGAGGTGGGCCAAAGG 0: 1
1: 0
2: 1
3: 17
4: 236
1170329370_1170329378 5 Left 1170329370 20:15191422-15191444 CCTCTTGACTGCAGTTATAGTGA 0: 1
1: 0
2: 0
3: 3
4: 116
Right 1170329378 20:15191450-15191472 TGGGCCAAAGGGTGTGGCGTGGG 0: 1
1: 0
2: 2
3: 9
4: 130
1170329370_1170329375 -6 Left 1170329370 20:15191422-15191444 CCTCTTGACTGCAGTTATAGTGA 0: 1
1: 0
2: 0
3: 3
4: 116
Right 1170329375 20:15191439-15191461 TAGTGAAGAGGTGGGCCAAAGGG 0: 1
1: 0
2: 2
3: 10
4: 242
1170329370_1170329377 4 Left 1170329370 20:15191422-15191444 CCTCTTGACTGCAGTTATAGTGA 0: 1
1: 0
2: 0
3: 3
4: 116
Right 1170329377 20:15191449-15191471 GTGGGCCAAAGGGTGTGGCGTGG 0: 1
1: 0
2: 0
3: 7
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170329370 Original CRISPR TCACTATAACTGCAGTCAAG AGG (reversed) Intronic
904854588 1:33488383-33488405 TGAGTACAACTGCAGTCCAGAGG - Intronic
912088089 1:106035169-106035191 TCACTATAACTATTGCCAAGTGG + Intergenic
918881893 1:190134928-190134950 TCACTAAACCTGTAGTAAAGAGG - Intronic
923933222 1:238727100-238727122 CCACTAAAACTGCAAACAAGGGG + Intergenic
1079315250 11:19402510-19402532 ACACTATAAGTGCAATGAAGGGG - Intronic
1080924454 11:36741681-36741703 TCATTTTAAATGCATTCAAGAGG - Intergenic
1081171407 11:39874170-39874192 TCAATATAAAGCCAGTCAAGTGG - Intergenic
1085963833 11:81496930-81496952 TCATAATACTTGCAGTCAAGGGG - Intergenic
1087183554 11:95162111-95162133 TCACTCTAACTTCAGGCAACAGG - Intergenic
1089934582 11:122350649-122350671 TGACTAAAAGGGCAGTCAAGTGG - Intergenic
1090272438 11:125397678-125397700 TCATTAGAACTGAAGTCATGGGG + Intronic
1092675274 12:10910587-10910609 TCACTGAAACTGCAGATAAGCGG + Intronic
1093191822 12:16083547-16083569 TCACTCAATCTGCACTCAAGAGG + Intergenic
1093374652 12:18409977-18409999 TCACTAGAACAGCACTAAAGGGG + Intronic
1097339828 12:58424997-58425019 TCACAATAACTGCATTCAGTAGG - Intergenic
1097980773 12:65736068-65736090 TCACTATGACTGCAGCTTAGAGG + Intergenic
1099126104 12:78760149-78760171 TCACTATATCCACAGTTAAGGGG + Intergenic
1099619592 12:84984398-84984420 TCACTTAAGCTGCAGTCCAGTGG + Intergenic
1099680706 12:85824233-85824255 TCACTATAATTGCATTCAGTAGG - Intronic
1101261853 12:103040670-103040692 TGACAATAACTGAAGACAAGGGG + Intergenic
1101394714 12:104336063-104336085 TCACTTTTACTGCAGACAAAAGG + Intronic
1101555354 12:105803530-105803552 TCAATACAACTGCAGTGCAGTGG - Intergenic
1104451488 12:128872330-128872352 TCCCTATAAATGCAGTGCAGAGG + Intronic
1107806748 13:44160533-44160555 TCAAAATAGCTGCAGTAAAGTGG + Intronic
1108743959 13:53370476-53370498 TCATTATAACTGCAAGCAAATGG + Intergenic
1109274233 13:60286317-60286339 TCACTCTAACTGCTGTTAGGGGG - Intergenic
1110178454 13:72586007-72586029 TCACTATCACTGCTATCATGAGG + Intergenic
1111156484 13:84334388-84334410 TCATTATAACTGGAGTGAGGAGG - Intergenic
1116651395 14:47597346-47597368 TCAGTAAAACTGAAGTCAATTGG + Intronic
1120572860 14:86143462-86143484 TCACTGTGACTGCAGTGAATTGG + Intergenic
1121378416 14:93435790-93435812 TCATTGTAACTGCATTGAAGAGG - Intronic
1123003431 14:105309257-105309279 TCAGGATAACCACAGTCAAGAGG + Exonic
1125154033 15:36565816-36565838 TCACTCTCATTGCAGTCTAGTGG - Intergenic
1131046553 15:89320082-89320104 TGACTATAAATGCAGGGAAGGGG - Intronic
1131504744 15:93007125-93007147 TCTCTACAACTGCTTTCAAGAGG - Intronic
1133395919 16:5447480-5447502 TCACTGCAACTGAATTCAAGTGG + Intergenic
1134348098 16:13410261-13410283 TCTCTATAATTGCAGTGATGAGG + Intergenic
1134843177 16:17417756-17417778 TCACTTTCACTGCATTCAATTGG - Intronic
1140552891 16:75886681-75886703 TCATTCTAAATGCAGTGAAGAGG - Intergenic
1144774350 17:17777585-17777607 TCCCCATGACTGCAGTCATGGGG - Intronic
1147467857 17:40625595-40625617 TCAATTTAACTGCAGGCAATAGG + Exonic
1151070134 17:71200177-71200199 TCATTTGAGCTGCAGTCAAGAGG + Intergenic
1159692112 18:71501491-71501513 TCTCTCAAAATGCAGTCAAGAGG - Intergenic
1167452481 19:49580269-49580291 TCACTATAAACTCAGTCAAGTGG - Intronic
1167811393 19:51834721-51834743 TCACTCAAGCTGCAGTGAAGTGG + Intergenic
931202192 2:60108612-60108634 CCACTATCAATGCAGTAAAGTGG - Intergenic
932461520 2:71884927-71884949 TCACTATGAATGCCCTCAAGGGG + Intergenic
939183756 2:138835434-138835456 TAACCATCACTGCAATCAAGGGG + Intergenic
943051093 2:182914123-182914145 TAACTATAACTTCATTTAAGGGG - Intronic
943086608 2:183319257-183319279 TCACTAAAACTTCAGTCCTGTGG - Intergenic
943115434 2:183664124-183664146 TCATAATAACTGAAGTCATGGGG - Intergenic
945306051 2:208259908-208259930 TTACTAAAAGTGCATTCAAGAGG - Intronic
946240274 2:218349679-218349701 TCACGCTAACTGCTGTTAAGGGG + Intergenic
946284782 2:218694681-218694703 ACACTAGGACTGCATTCAAGGGG + Intronic
1170329370 20:15191422-15191444 TCACTATAACTGCAGTCAAGAGG - Intronic
1172457599 20:35090239-35090261 TCACTATAGCTCCAGGCAGGGGG + Intronic
1172970358 20:38868810-38868832 TGACCAGCACTGCAGTCAAGAGG + Intronic
1181558106 22:23683740-23683762 CCACTGTGACTGCAGTCCAGTGG + Intergenic
1181949178 22:26541787-26541809 GCCCTATAACTGCAAACAAGAGG + Intronic
1184041725 22:41947933-41947955 TCACTGTAAAAGCAGTCAATTGG - Intergenic
952932067 3:38368239-38368261 TCACCATCACTGTAGTCAATAGG - Exonic
955696377 3:61641392-61641414 TCACTATTCCTGCAGTCCACAGG - Intronic
955800418 3:62680600-62680622 CCACTATCACAGCAGTCCAGGGG - Intronic
956231818 3:67025904-67025926 TCACTGTCACTGCAGTGCAGTGG + Intergenic
958831477 3:99095639-99095661 TCATTGTAATTGCAGTCTAGTGG + Intergenic
961958085 3:130824889-130824911 TCATTATGATTCCAGTCAAGGGG - Intergenic
967794649 3:193586660-193586682 TCTCTATTTCTGCAGTCAATTGG - Intronic
974192513 4:58524748-58524770 TCACTATAACTGCATTTCACTGG + Intergenic
980499790 4:133634114-133634136 TCACTATGATTGCAGTTAACAGG + Intergenic
980939424 4:139259480-139259502 TTCATATAACTGCAGTCATGTGG + Intergenic
984273363 4:177575475-177575497 TCATGAATACTGCAGTCAAGGGG - Intergenic
984967436 4:185152103-185152125 TCACTGCAACTGAAGTCAAGAGG + Intergenic
987542409 5:19272693-19272715 ACAATATAACTGCAGACAAATGG - Intergenic
990890807 5:60647553-60647575 TCTCTATTACTGCAGTCAGTGGG + Intronic
991720395 5:69489882-69489904 TGACTTTACCTGCAGTCAAATGG - Intergenic
993058005 5:83004673-83004695 TCACTACAAAAGCAGTCAAAAGG + Intergenic
994849762 5:105039042-105039064 TCACGAGAACAGCACTCAAGGGG - Intergenic
998842625 5:146271866-146271888 TCACTACAAATGCACTTAAGTGG - Intronic
1001335992 5:170797080-170797102 TCCCTATGCCTGCTGTCAAGTGG + Intronic
1002701065 5:181125202-181125224 CCACCATAACTGCAGAGAAGAGG + Exonic
1006209181 6:32378703-32378725 TTTCTATACCTGGAGTCAAGGGG + Intergenic
1007833192 6:44654534-44654556 TGACTATAACTTCATTGAAGAGG - Intergenic
1013849522 6:114497227-114497249 ACAAAATAACTGCATTCAAGGGG + Intergenic
1016519935 6:144935906-144935928 TCAAGATAATTGCAGTCAGGGGG + Intergenic
1018460835 6:163996891-163996913 TCACTATGGCTGCAGTAATGCGG - Intergenic
1022778296 7:33551230-33551252 TAACTATAGCGGCAGTCAACTGG - Intronic
1022792972 7:33707080-33707102 TCAATTTAGCTGCAGTCAACAGG - Intergenic
1023782386 7:43669173-43669195 TCACCATAACTGCTCTTAAGGGG - Intronic
1027938688 7:84643264-84643286 AAACTATAACTGCAGTAAAGCGG - Intergenic
1028350812 7:89845207-89845229 TCACAATAGCTTCAGTGAAGGGG - Intergenic
1029555794 7:101268204-101268226 TAACTTTATCTGCAGTCACGTGG + Intergenic
1031360184 7:120840026-120840048 TCACTTTAACTGCAGAAACGAGG - Exonic
1033495215 7:141887240-141887262 TCACTGTCACTGCATACAAGAGG - Intergenic
1034782461 7:153893123-153893145 TCAATAAAACTGTAGTGAAGAGG + Intronic
1035544072 8:466046-466068 TCACTGTAGCTACAGTGAAGTGG - Intronic
1035624148 8:1059187-1059209 TCCCTATAAGTGAAGCCAAGAGG - Intergenic
1036524722 8:9524442-9524464 ACAGTATAACTGCAGTGAATGGG + Intergenic
1036716633 8:11130861-11130883 TTACCATTGCTGCAGTCAAGTGG - Intronic
1038427401 8:27472878-27472900 TCACTGTCACCACAGTCAAGAGG - Intronic
1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG + Exonic
1043526110 8:81098151-81098173 AAACTATAACTGCAGGCCAGTGG - Intronic
1046927753 8:119810919-119810941 TCATTATAAATGCAATCAACTGG + Intronic
1047574856 8:126141790-126141812 TGACTACAACTGAAATCAAGAGG + Intergenic
1047751560 8:127884871-127884893 TGGGTATTACTGCAGTCAAGTGG - Intergenic
1050419801 9:5451639-5451661 ACACTCTAACTGCTGTCATGTGG - Intronic
1051219850 9:14836839-14836861 TCACACTAACTGCAGTTAGGGGG - Intronic
1053556053 9:39138221-39138243 TAACTGTAACTGCTGTAAAGAGG + Intronic
1053820174 9:41958475-41958497 TAACTGTAACTGCTGTAAAGAGG + Intronic
1054110448 9:61102174-61102196 TAACTGTAACTGCTGTAAAGAGG + Intergenic
1054610409 9:67228951-67228973 TAACTGTAACTGCTGTAAAGAGG - Intergenic
1056526380 9:87446666-87446688 AAATTAAAACTGCAGTCAAGTGG + Intergenic
1059877422 9:118650593-118650615 TGAGAATAACTGCAGTAAAGGGG + Intergenic
1059962006 9:119574704-119574726 TCACTTGAAATGCATTCAAGTGG + Intergenic
1186934812 X:14436841-14436863 GCACTCTAACTGAAGTGAAGTGG + Intergenic
1194452898 X:94066645-94066667 TCACTTTAATTTCAATCAAGTGG - Intergenic
1197444263 X:126529469-126529491 TAACTTTAACTGCATTCAAAAGG - Intergenic
1197497841 X:127207731-127207753 TCACTATAAAAGCAGACAACTGG + Intergenic
1198334338 X:135652106-135652128 GTACTATAACTGGAGTCAATGGG + Intergenic
1199045054 X:143160167-143160189 TCACCATCACTGCAATCCAGAGG - Intergenic
1201320441 Y:12692972-12692994 TCAAAATAACTTCATTCAAGTGG - Intergenic