ID: 1170329578

View in Genome Browser
Species Human (GRCh38)
Location 20:15193752-15193774
Sequence CTGTGAGAGTAGGAGAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 364}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170329578_1170329586 10 Left 1170329578 20:15193752-15193774 CCTTCATTCTCCTACTCTCACAG 0: 1
1: 0
2: 2
3: 38
4: 364
Right 1170329586 20:15193785-15193807 GTGGTTATGTACAAAGGAGCGGG 0: 1
1: 0
2: 0
3: 10
4: 127
1170329578_1170329584 4 Left 1170329578 20:15193752-15193774 CCTTCATTCTCCTACTCTCACAG 0: 1
1: 0
2: 2
3: 38
4: 364
Right 1170329584 20:15193779-15193801 CTCTTGGTGGTTATGTACAAAGG 0: 1
1: 0
2: 1
3: 27
4: 488
1170329578_1170329585 9 Left 1170329578 20:15193752-15193774 CCTTCATTCTCCTACTCTCACAG 0: 1
1: 0
2: 2
3: 38
4: 364
Right 1170329585 20:15193784-15193806 GGTGGTTATGTACAAAGGAGCGG 0: 1
1: 0
2: 1
3: 14
4: 155
1170329578_1170329587 30 Left 1170329578 20:15193752-15193774 CCTTCATTCTCCTACTCTCACAG 0: 1
1: 0
2: 2
3: 38
4: 364
Right 1170329587 20:15193805-15193827 GGGTGAGAAAATCTCCAACCTGG 0: 1
1: 0
2: 0
3: 14
4: 120
1170329578_1170329581 -9 Left 1170329578 20:15193752-15193774 CCTTCATTCTCCTACTCTCACAG 0: 1
1: 0
2: 2
3: 38
4: 364
Right 1170329581 20:15193766-15193788 CTCTCACAGCCCTCTCTTGGTGG 0: 1
1: 0
2: 0
3: 15
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170329578 Original CRISPR CTGTGAGAGTAGGAGAATGA AGG (reversed) Intronic
900703983 1:4067308-4067330 GTGTGAGAGTGAGTGAATGAGGG - Intergenic
902036913 1:13464575-13464597 GTGTGAGAGCAGGAGAGGGAGGG - Intergenic
902264439 1:15251918-15251940 CTGTTAGAGAGGGAGAAGGAAGG - Intronic
902343197 1:15798038-15798060 CTCTGCGAGGAGGAGGATGAAGG - Intergenic
902343597 1:15800143-15800165 CTCTGCGAGGAGGAGGATGAAGG + Intergenic
902870494 1:19311322-19311344 CTGGGAGAGTAGGAGTGTTAGGG - Intronic
902987022 1:20161092-20161114 CTGTGTGAGGAGGAGATGGAGGG + Intergenic
904205021 1:28848676-28848698 CTGTGAGAGGTGGGGAAGGAAGG + Intronic
904233774 1:29099979-29100001 CTTTGAGACTAGGATAATCAGGG + Intronic
905036303 1:34920129-34920151 CTGTGAGAGGAGTAGAGAGAAGG - Intronic
905121044 1:35682153-35682175 CTTTGAGAGTCTGAGAAGGAAGG + Intergenic
905371719 1:37486031-37486053 CTGTGAAAGGAGGAGAGGGAGGG + Intergenic
905389957 1:37629950-37629972 CTGTCAGGGAAGGAGAAAGAAGG + Intronic
906237434 1:44220422-44220444 CTGTGCGAGTCTGAGACTGAGGG + Intronic
906464991 1:46070374-46070396 CTGTGGTAATAGGAGCATGAAGG + Intronic
907119089 1:51992806-51992828 TTGTGAGAGAAAGAGAGTGAGGG - Intergenic
907332991 1:53683493-53683515 CTGTGAAATGGGGAGAATGAGGG + Intronic
907637668 1:56152533-56152555 AGTTGAGAGTAGGAGAATGGAGG + Intergenic
907695144 1:56717928-56717950 ATGAGAGAGGAGGAGAATTAGGG - Intergenic
908525659 1:64985256-64985278 CTGAGAGAGCTGGAGCATGATGG + Intergenic
909179388 1:72402361-72402383 CTGTGAGAGCTGGAAAATAATGG - Intergenic
910770575 1:90827150-90827172 CTGTGAAAGTTGGAGTTTGAGGG + Intergenic
911004318 1:93202347-93202369 CTCTCAGAGTAGCAGACTGAGGG - Intronic
911634772 1:100222744-100222766 CAGTGAAAGGAGGAGAAAGAGGG - Intronic
912652495 1:111451787-111451809 CCAGGAGAGTAAGAGAATGAAGG + Intronic
912753319 1:112303490-112303512 GTGCGGGAGCAGGAGAATGATGG - Intergenic
914680493 1:149935398-149935420 CTGCCAGGGTAGGAAAATGAGGG - Intronic
914768542 1:150661929-150661951 CTTTGAGAAAAGGAGAAAGAAGG + Intronic
915518899 1:156430042-156430064 CAGTGACAGTAGGAAGATGAAGG + Intronic
915728599 1:158036847-158036869 CTGGGAGAGCAGATGAATGAGGG + Intronic
916076693 1:161204283-161204305 CTGAGGGATTAGGAGAATGAGGG - Intronic
916326426 1:163565008-163565030 CTTTGAGAATGGGAGAATGAGGG + Intergenic
916476764 1:165177058-165177080 TTGTAAGAGTAGGAGAACTAAGG + Intergenic
917880492 1:179330661-179330683 CTGTGAGGCTAGAAGCATGATGG + Intronic
918450981 1:184658199-184658221 CTGTGAGAAAATCAGAATGATGG - Intergenic
919667607 1:200307086-200307108 CTGTGAAAGTATGAGAAGCATGG - Intergenic
920288064 1:204895947-204895969 CTGTAAGAGGTTGAGAATGAAGG + Intronic
920766671 1:208840192-208840214 CTGTGTGAGGAGGAGAATTTGGG + Intergenic
921134822 1:212250624-212250646 CTGTGAGACAAAGAGAAAGATGG - Intergenic
921430748 1:215063007-215063029 CTGTGAGAGAAGGAAAAACAGGG + Intronic
924802311 1:247336359-247336381 ATGTGAGAGCAGGAGGAAGAGGG + Intergenic
1064309406 10:14198613-14198635 CTGTGATAAGAGGACAATGAGGG - Intronic
1065509830 10:26467223-26467245 CTTTGAGAATAGAAGTATGAGGG + Intronic
1067242091 10:44505863-44505885 CTGTGAGATGAGGAGACTGATGG + Intergenic
1068326013 10:55487488-55487510 CTATGAGAGGTAGAGAATGAAGG - Intronic
1072715746 10:97751353-97751375 CTATGACAGAAGGAGAAGGATGG - Intronic
1073173552 10:101534533-101534555 CTGGGAGAGTGGGAGAAGGAAGG - Intronic
1075598008 10:123746474-123746496 CAGAGAGAGAAGGAGAAGGAGGG - Exonic
1075640193 10:124059144-124059166 CTTTGAGATGAAGAGAATGAGGG - Intronic
1075788628 10:125067686-125067708 CTTTGAGAGAAAGAGAATGAGGG - Intronic
1075996531 10:126881065-126881087 CTATAAGAAAAGGAGAATGAAGG + Intergenic
1076742403 10:132493227-132493249 CTGTGTGAGATGGAGACTGAGGG - Intergenic
1078344154 11:10529207-10529229 CTGTCAGTGTAGGTGTATGAAGG + Intronic
1078542250 11:12221930-12221952 CTGTAAGAGTCAGATAATGATGG - Intronic
1080250432 11:30227517-30227539 CTGTGAGATTAGGATTATGGGGG - Intergenic
1080256405 11:30295507-30295529 CTGTGATGGTGGGAGAGTGAGGG - Intergenic
1080350179 11:31375407-31375429 CTGTTAGATAAGGAGAATGAGGG + Intronic
1080688402 11:34534880-34534902 ATCTGAGAGAAGGAGAGTGATGG + Intergenic
1080970415 11:37268152-37268174 TTGTCACAGTAGGAGAATAAGGG - Intergenic
1082894461 11:58175386-58175408 AAGAGAGAGTGGGAGAATGATGG - Intronic
1084506290 11:69570386-69570408 CTCTGAGAGCAGGAGATAGATGG - Intergenic
1085655944 11:78315100-78315122 TTGAGAGAGTAAGAGAAGGAAGG + Intronic
1087434143 11:98091206-98091228 CTGTGTGTGTAGGGGGATGAAGG + Intergenic
1088961240 11:114667557-114667579 ATGTGAGAGTAGGTCAAAGATGG + Intergenic
1089254048 11:117184702-117184724 CTGTGATAGGAGGGGAAAGAAGG + Intronic
1089279958 11:117366996-117367018 CTGTGAAAGGAGGAGACAGAAGG + Intronic
1089884515 11:121806811-121806833 CTATGACAGAAGGACAATGATGG + Intergenic
1090642631 11:128742223-128742245 CTATGAGATTAGGAGAATTGTGG - Intronic
1091099233 11:132854876-132854898 CTGTGAGGCTAGAAGAAAGATGG - Intronic
1091933407 12:4415419-4415441 CTGTAAGGGTGGGAGAATGAGGG + Intergenic
1091983235 12:4883590-4883612 GTGTGAGAGTGGGAGAGTCAGGG + Intergenic
1092040178 12:5377262-5377284 CTGTGAGAGTGGGAGAGAGATGG + Intergenic
1092056532 12:5512369-5512391 CGGTGCGGGTAGGAGAATGAGGG + Intronic
1092217861 12:6695242-6695264 CTGAGAGACTGGGAGAAGGAAGG + Intronic
1094729778 12:33161573-33161595 CTGTGGGAGAGGGAGCATGAGGG + Intergenic
1095780942 12:46058967-46058989 CTGTGGGATTACGGGAATGAGGG - Intergenic
1096581005 12:52585214-52585236 GTGAGACAGTGGGAGAATGAAGG + Intergenic
1096670713 12:53196821-53196843 CTGGGAGAGGAGAGGAATGAAGG + Intronic
1097009450 12:55941766-55941788 CTTTGAGAGCAGGACAAAGATGG - Intronic
1097232018 12:57518609-57518631 GTGTGAGAGAAGAGGAATGAAGG - Intronic
1097866174 12:64560847-64560869 CTGTGAGAGACGGGGAAGGAAGG + Intergenic
1098289606 12:68945335-68945357 CTGTGAGACTAGAAGCAAGATGG + Intronic
1098482595 12:70983284-70983306 ATTGGTGAGTAGGAGAATGAGGG + Intergenic
1098804978 12:75012085-75012107 TTGTTAGACTAGGAAAATGATGG - Intergenic
1100450707 12:94703120-94703142 CTGATAGAGTAGGAGAAGAAAGG - Intergenic
1101157505 12:101941657-101941679 CTGTTAGAGGAGGAAACTGAGGG + Intronic
1102457071 12:113077486-113077508 GTGTGGGAGTGGGAGAACGACGG + Exonic
1102526533 12:113516020-113516042 CTGTGGGAGAAAGAGAATAAAGG + Intergenic
1102628271 12:114254045-114254067 CTTTGAAAGAAGGAGAATGTGGG - Intergenic
1103619233 12:122176120-122176142 CTGTGACGGTTGGAGAGTGACGG + Intronic
1104163751 12:126206050-126206072 CTGTGAGAGAAGGGGTATGATGG + Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106612967 13:31301031-31301053 CTGTGAGACTAGAAGCAAGATGG + Intronic
1108256683 13:48618062-48618084 CACTAAGAGAAGGAGAATGAAGG + Intergenic
1109233951 13:59792784-59792806 CTGAAAAAGTAGGAGAATGAAGG - Intronic
1109239882 13:59872859-59872881 CTATGAGAGCAGGAAGATGAAGG + Intronic
1110308040 13:74013222-74013244 CTCTGACACTTGGAGAATGATGG - Intronic
1110515011 13:76400439-76400461 CTGTGAGAGTATTAGAAGGTGGG + Intergenic
1112161847 13:96876478-96876500 TTGTGAGAATGGGAGATTGAGGG + Intergenic
1112488751 13:99843139-99843161 CTGTGAGAGTTGGAGCCTCATGG + Intronic
1113098875 13:106695742-106695764 CTGTGAGAGAAGGACAGGGAGGG + Intergenic
1113781768 13:112981284-112981306 TTGTGGGAGCAGGAGAATGCAGG + Intronic
1113922570 13:113921823-113921845 CTGAGAGAGTAGCACAATGTAGG - Intergenic
1114042015 14:18687807-18687829 TTATGAGAGGAGGAGAAAGACGG + Intergenic
1114217773 14:20669768-20669790 CTGTGAGATTAGGACAAGCAAGG - Intergenic
1115203193 14:30874893-30874915 CTGGGAGAGAGGGAGAATGCGGG - Intronic
1116057654 14:39884052-39884074 AAGTCAGAGTAGAAGAATGAGGG - Intergenic
1117210005 14:53486785-53486807 CTTTGGTAGTAGGATAATGACGG - Intergenic
1117909588 14:60624308-60624330 CTGGGAGAGGTGGAGAAAGAGGG - Intergenic
1120446771 14:84607927-84607949 CTCAGAGAATGGGAGAATGAGGG + Intergenic
1121488640 14:94341912-94341934 AGGTGAGGGTATGAGAATGAAGG + Intergenic
1122834992 14:104426406-104426428 CAGAGAGAGTTGGAGAGTGAGGG - Intergenic
1123167664 14:106342121-106342143 GTGTGAGAGAGAGAGAATGAGGG + Intergenic
1123185582 14:106513518-106513540 CTGTCAGAGAAGGAGAACGTAGG - Intergenic
1123435578 15:20251677-20251699 CTGTGACAGTGACAGAATGAGGG - Intergenic
1124870980 15:33542285-33542307 CTGTGTGAGTAGGATATTGATGG + Intronic
1125646812 15:41279471-41279493 CTTTGGGAGAAGGGGAATGAGGG - Exonic
1125968064 15:43890139-43890161 CTGTGTGTGTATGAGATTGATGG - Intronic
1126419342 15:48455103-48455125 CTCTTAGAATAGGAAAATGAAGG - Intronic
1126733681 15:51710311-51710333 ATGAAAGAGGAGGAGAATGACGG + Intronic
1127269870 15:57390796-57390818 CTGTGGGAGGAGCAGAAGGATGG + Intronic
1128004680 15:64227865-64227887 CATTGAGAGTAAGAGAATGTAGG - Intronic
1129496117 15:75982777-75982799 CTGAAAGAGTAGGAGAATTCTGG + Intronic
1129768154 15:78183084-78183106 ATGTGACTGTAGGAGAAAGAGGG + Intronic
1132817520 16:1839287-1839309 CTGTGAGACTACAGGAATGAAGG + Exonic
1132871355 16:2117093-2117115 CTGTGAGGGTGGGAGGATGGAGG - Intronic
1133153754 16:3857096-3857118 CTCTGAGAGTGGCAGGATGATGG - Intronic
1134521172 16:14919801-14919823 CTGTGAGGGTGGGAGGATGGAGG + Intronic
1134550399 16:15136171-15136193 CTGTGAGGGTGGGAGGATGGAGG - Intronic
1134708848 16:16318452-16318474 CTGTGAGGGTGGGAGGATGGAGG + Intergenic
1134716059 16:16358486-16358508 CTGTGAGGGTGGGAGGATGGAGG + Intergenic
1134950757 16:18350193-18350215 CTGTGAGGGTGGGAGGATGGAGG - Intergenic
1134958697 16:18393673-18393695 CTGTGAGGGTGGGAGGATGGAGG - Intergenic
1135464473 16:22673403-22673425 CTGTGAGAGTTGGACCATTATGG + Intergenic
1136381497 16:29898151-29898173 GTGTGGGAGTGGGAGTATGAGGG - Intronic
1137984611 16:53097403-53097425 CTGTGAAAGAAAGAGAAAGAAGG - Intronic
1143471067 17:7176325-7176347 GTGTGAGAGTGTGAGAATGAGGG - Intronic
1143471073 17:7176424-7176446 GTGTGAGAGTGTGAGAATGACGG - Intronic
1143818247 17:9537386-9537408 CTGTGACTGGAGAAGAATGAGGG - Intronic
1144527664 17:16004178-16004200 CTGTGAGAGAAAGAGAATGAAGG - Intronic
1144643474 17:16952584-16952606 CTGAGAGACCAGGAGAGTGAGGG + Intronic
1146498381 17:33343284-33343306 CTCTGAGTGTAGAAGAATAAAGG - Intronic
1146623610 17:34419395-34419417 CTGAGAGGGTAGGAGGAGGAAGG + Intergenic
1146672708 17:34752769-34752791 GGGTGAGAGGAGGAGAGTGAAGG - Intergenic
1147848071 17:43419279-43419301 TGGTGAGGGTAGGAGACTGAGGG + Intergenic
1149581395 17:57752834-57752856 CAGTGAGAATAGGAGCAGGATGG + Intergenic
1149626266 17:58083090-58083112 CTGAGAGAGGAGGAGAGGGAAGG - Intergenic
1149805109 17:59609942-59609964 CTGTGAGAGCAGTAGTATCAAGG + Intergenic
1151257109 17:72886441-72886463 CTCTGAGAGAAGGAGAAAGGAGG - Intronic
1152796735 17:82311278-82311300 CTGAGAAAGTACGAGAAAGAAGG + Intergenic
1153073258 18:1131526-1131548 CTGTGTGTGTAGGAGGATGGAGG + Intergenic
1154485062 18:14866613-14866635 CTGTTAGAGTAGTAGAAAGATGG + Intergenic
1155323580 18:24643741-24643763 CTGTGAGATGATGATAATGATGG + Intergenic
1155423503 18:25681417-25681439 GTGTGAGAGTAGGACAATTAAGG - Intergenic
1157014182 18:43690111-43690133 CAGTGAGAGTGAGAGAAAGAAGG - Intergenic
1157166750 18:45364421-45364443 CTGTGAGAGTAGAAGAGAAAAGG + Intronic
1157284037 18:46364993-46365015 CTGTGACAGGAGAAGAGTGAGGG + Intronic
1159595415 18:70378345-70378367 CAGTGGGGGTTGGAGAATGAAGG - Intergenic
1161484848 19:4529924-4529946 CAGTGAGAGTTGTAGAAGGAGGG + Intronic
1163199318 19:15752719-15752741 CTGTCAGAGAAGCAGAAAGAAGG - Intergenic
1164682851 19:30147211-30147233 CTATGAGAGGAAGAGAAAGATGG + Intergenic
1164892312 19:31834758-31834780 CAGAGAGAGTGGGGGAATGATGG + Intergenic
1164969319 19:32517576-32517598 CTGGGAGTGTAGGAAAAGGAGGG - Intergenic
1165543956 19:36517764-36517786 CTGTTAGAGTCCGAGAATGCTGG + Intronic
1166566742 19:43770169-43770191 TTGTGGGAGTGGGAGAAGGATGG - Intronic
925190714 2:1881137-1881159 CTGTGAGAGGAGGAGGAGGCAGG + Intronic
927403178 2:22737680-22737702 CTGGGAGAGGAAGAGACTGAAGG - Intergenic
927768281 2:25833927-25833949 CTCTGAAATTAGGAGAAGGAAGG - Intronic
928902548 2:36335954-36335976 CTGTAAGAATAGAAGGATGAGGG + Intergenic
928931194 2:36626103-36626125 CTGTGAGACTAGAAGCAAGATGG + Intronic
929582876 2:43094514-43094536 CTGTGTGAGTGGGAGAGAGAAGG - Intergenic
929583078 2:43096504-43096526 CTGTGTGAGTGGGAGAGAGAAGG - Intergenic
929789359 2:45012207-45012229 ATGGGGGAGGAGGAGAATGAGGG - Intergenic
929948031 2:46384958-46384980 GTGTGTGAGAAGGAGAAGGAGGG - Exonic
930325763 2:49915161-49915183 ATGTGATACTAGAAGAATGAAGG + Intergenic
930509498 2:52326727-52326749 ATGTGAGCATAGTAGAATGATGG - Intergenic
931010598 2:57908027-57908049 TTATGAGAATATGAGAATGAAGG + Intronic
931550696 2:63442895-63442917 CTGTGAGAGTAAGTAAATGAGGG + Intronic
932751039 2:74371864-74371886 CAGTGAGAAAAGAAGAATGAAGG + Intronic
935094398 2:99930567-99930589 GTGTGAGAGAAAGAGAAAGAGGG - Intronic
935107230 2:100055926-100055948 CTTTCAGAGTCGGAGAAGGAAGG + Intronic
935206851 2:100903732-100903754 CTGTGGGAGTGGGAGGCTGAAGG - Intronic
936071217 2:109372693-109372715 GTGTGAGAGCAGGAGAGTGAAGG - Intronic
938268202 2:129944725-129944747 TTATGAGAGGAGGAGAAAGACGG - Intergenic
938673500 2:133607000-133607022 CTGTGGGAGCTTGAGAATGAAGG + Intergenic
938857435 2:135328331-135328353 TTGTGATAGTTTGAGAATGATGG + Intronic
938906625 2:135842824-135842846 CTGTGAAATTAGGTGAATGAGGG + Intronic
939693929 2:145300136-145300158 CTGTCAGAATAGGAAAATGGGGG + Intergenic
939783470 2:146478242-146478264 CAGGCAGAGAAGGAGAATGAAGG + Intergenic
941624716 2:167818701-167818723 CTGTGTGAGGAGGAGATTCAAGG - Intergenic
941655436 2:168138754-168138776 CTGAGAGAGCAGGACACTGAAGG + Intronic
941960116 2:171245222-171245244 CTGTGAGACTAGAAGCAAGATGG - Intergenic
942766206 2:179460277-179460299 CTGTGAGAATAGAAGCAAGATGG - Intronic
943280377 2:185924475-185924497 CTATGAGAATAAGAAAATGAGGG + Intergenic
943367594 2:186980863-186980885 GGGTGAGAATAGGTGAATGACGG - Intergenic
946000866 2:216481085-216481107 CTGGGAGACTACGAGAATGCAGG + Intronic
1169244843 20:4017045-4017067 CTGAGAGATTAGGAGAAGGAAGG - Intergenic
1169264203 20:4157772-4157794 CCCTGAGAGTCTGAGAATGAGGG - Intronic
1169746968 20:8952507-8952529 CTGGGGGAATAGGATAATGAGGG - Intronic
1169752146 20:9005258-9005280 CAGTGACAAGAGGAGAATGAGGG + Intergenic
1170179765 20:13516915-13516937 CAGTGAGTGTAGGAGGGTGATGG + Intronic
1170329578 20:15193752-15193774 CTGTGAGAGTAGGAGAATGAAGG - Intronic
1170582408 20:17709376-17709398 ATGTGAGAGCAGAGGAATGAAGG + Intronic
1170941160 20:20849008-20849030 CTGTAACACTAGGAGAGTGAGGG + Intergenic
1172423958 20:34842391-34842413 CTGTGAAAGGAGGGGAAGGAAGG + Intergenic
1173141119 20:40483905-40483927 CTCTGAGAGAAGCAGAAAGAAGG - Intergenic
1173187545 20:40852434-40852456 CTTTGAGAATATGAGAATAAGGG + Intergenic
1174372173 20:50098394-50098416 CTGTGTGAGGATGAGAGTGAAGG + Intronic
1175403050 20:58711406-58711428 CTCTGAGAGGAGGAGGCTGAGGG + Intronic
1175472997 20:59246217-59246239 CTGTCAGAGAAGGAGAGTGAAGG - Intronic
1176723813 21:10413941-10413963 CTGTTAGAGTAGTAGAAAGGTGG + Intergenic
1176796267 21:13372862-13372884 CTGTTAGAGTAGTAGAAAGATGG - Intergenic
1177587811 21:23120771-23120793 GTCTGAGAGGAGAAGAATGATGG + Intergenic
1180304960 22:11066682-11066704 CTGTTAGAGTAGTAGAAAGGTGG + Intergenic
1181410257 22:22713439-22713461 TTGTGTGAGTTAGAGAATGAAGG + Intergenic
1181481925 22:23205377-23205399 CCGTGAGAGGAGGAGAAGGAGGG - Intronic
1182517534 22:30867508-30867530 CAGAGAGATCAGGAGAATGAGGG - Intronic
1182918105 22:34054081-34054103 TTGTGAGAGAATGAGAATGAGGG - Intergenic
1183483820 22:38078755-38078777 CTGAGAGTGCAGGAGAGTGAGGG - Intronic
1183596794 22:38817808-38817830 TTGAGAGAGTAGGAGGATGAAGG + Intergenic
1184048187 22:41985289-41985311 CTGTGAGAGGAGGAGGAGGCTGG - Intronic
1184576758 22:45374839-45374861 CTGTGAAAATAGGGGAAGGAAGG - Intronic
1184718390 22:46295050-46295072 CAGTGAAAGTTGGTGAATGAAGG + Intergenic
1184996966 22:48214429-48214451 CCGTGATAGGAGGAGAATGATGG + Intergenic
1185347196 22:50315768-50315790 TTCTGAGAGGAGGAGAGTGAAGG + Exonic
951214190 3:20008244-20008266 CTGAGACCGTAGGAGAAAGATGG - Intronic
952034322 3:29181020-29181042 CTGTGAGAGCAGGAAGGTGAAGG + Intergenic
952900166 3:38106912-38106934 TTGTGAGAGCAGGAGCTTGATGG - Intronic
953075427 3:39565590-39565612 CTGTGACATTAGGAAAAAGATGG - Intergenic
953466989 3:43130579-43130601 CTGCTAGAGCAGAAGAATGAAGG - Intergenic
953871291 3:46629695-46629717 CAGGGAGAGGAGGAGAATGGAGG + Intergenic
954147248 3:48640560-48640582 CTGTGAGAGGAAGAAAATGGGGG + Intronic
954385434 3:50241553-50241575 CTGAGAGACTAGGTGAATCAGGG + Intronic
954472778 3:50712774-50712796 CTGTAACAGTAGGAAAATTAGGG - Intronic
954582509 3:51710710-51710732 GTGGGAGAGTAGGAGGCTGAGGG - Intronic
956214158 3:66831218-66831240 GTGTGAGAGTATAAGAATCAAGG + Intergenic
956225142 3:66949003-66949025 CTGTGAGAGAAGGACAAAAATGG - Intergenic
956454859 3:69410396-69410418 GTGTGTGAGTATGAGTATGAGGG + Intronic
956504662 3:69924884-69924906 TTGTGAGAGTAAGAGAAAAAGGG - Intronic
956652353 3:71516308-71516330 ATCTGAGAGTATGAGAAGGAGGG + Intronic
957317759 3:78589643-78589665 CTGTTTTAGTTGGAGAATGATGG + Intergenic
959802622 3:110512966-110512988 CTGTGAAAGTGGGAAAAGGAGGG - Intergenic
960350378 3:116585734-116585756 CTGGGAGAGGAGGAAAAAGAAGG + Intronic
962754455 3:138457354-138457376 CTGTGTGAGTAGGGGCAGGAAGG + Intronic
963488484 3:145967775-145967797 ATGTAAGAGTAGGAGAAAGAGGG - Intergenic
965156577 3:165066575-165066597 CTGGGAGTGGAGGAGAATGGGGG - Intronic
965200603 3:165653333-165653355 CTGTGAGGGTAGGAGCAAGATGG - Intergenic
966542591 3:181108366-181108388 GTGTGCAAGTATGAGAATGAAGG - Intergenic
967003649 3:185362028-185362050 CTGTGAGAGAAGGAAAGTGGTGG - Intronic
967654892 3:192035293-192035315 CTGAAAGAGAAGCAGAATGAAGG + Intergenic
967830150 3:193911691-193911713 ATGTCAGAGTAGGAAGATGAGGG + Intergenic
968877475 4:3280601-3280623 CTGGGAGAGAAGGAGAATGAGGG + Intergenic
969914543 4:10477124-10477146 CAGTGATAGTTGGGGAATGATGG - Intergenic
970104104 4:12560793-12560815 CAGTGAGAGTGGGAGAAAGTGGG + Intergenic
970153405 4:13115912-13115934 CTGTGGGAGTATCAGAATCATGG - Intergenic
971338815 4:25748931-25748953 CTGAAAGAATAGGAGAGTGATGG + Intronic
971975565 4:33681662-33681684 CTGTGAGGCTAGAAGAAAGATGG + Intergenic
972097448 4:35365264-35365286 CTGAGAGAGAAGGAAAATGGCGG - Intergenic
972172984 4:36369299-36369321 CTTTGAGAGGAGTAGAATGTTGG + Intergenic
972444846 4:39133978-39134000 CTCCGAGAGGATGAGAATGAGGG + Intergenic
973979076 4:56291648-56291670 TGGTGAGAGCAGGAGAAAGAGGG - Intronic
974295141 4:59988474-59988496 CTGTGGGAGTGGGACAAGGAAGG + Intergenic
976347851 4:84025972-84025994 CTGTGAGAGGAGGAGGATACTGG - Intergenic
978165692 4:105603787-105603809 CTGTGGCAGTAGGAAAGTGATGG - Intronic
979413050 4:120402722-120402744 CTGTGAGGGTAGGTAAATAAAGG + Intergenic
979608830 4:122669161-122669183 GTGTGAGAGGAGGAGAGTGGTGG + Intergenic
979875564 4:125886468-125886490 GTGGGAGAGATGGAGAATGATGG + Intergenic
980979643 4:139643258-139643280 GGGTGAGTGTGGGAGAATGAGGG - Intergenic
982359629 4:154505582-154505604 CTAAGAGAGTGGGAAAATGAGGG - Intergenic
982740091 4:159048345-159048367 CCGTGAGAGCAGCACAATGACGG - Intergenic
983674698 4:170279082-170279104 CTTGGAGAGAAGGAAAATGATGG - Intergenic
983871214 4:172826921-172826943 CTGAGAGTGGAGGAGAATGGAGG - Intronic
985299531 4:188473219-188473241 CTGAGAGAGAAAGAGAAAGAGGG - Intergenic
985508762 5:299975-299997 ATGTGAGAGAAGGACAGTGATGG - Intronic
985739362 5:1605941-1605963 ATGTGAGAGAAGGACAGTGATGG + Intergenic
986054800 5:4126124-4126146 GTATGAGAGTAAAAGAATGAAGG + Intergenic
986077796 5:4356245-4356267 GTGTGAGAGTAAGAGAATCACGG + Intergenic
986189810 5:5485020-5485042 CTGCGAGTGTAGGGGAATGGGGG + Intronic
988051629 5:26038511-26038533 CTGTTAGGGTAGGAGAATTCTGG - Intergenic
988882586 5:35519700-35519722 CTGTGAGAGAGGGAGAAACAAGG - Intergenic
989003990 5:36789450-36789472 CTGTGAGAGCTGGAAAATGAAGG - Intergenic
990325545 5:54671880-54671902 CTGTGAGACTAGAAGCAAGATGG - Intergenic
990438576 5:55821207-55821229 ATGTGAGAGTTGGGGAATAATGG + Intergenic
991011234 5:61884955-61884977 TTTTAAGAGTAGGACAATGAGGG - Intergenic
991019579 5:61965870-61965892 CTGTCAGAGGAGTAGGATGAGGG + Intergenic
992058745 5:73020589-73020611 CTTTGGGAGAAGGGGAATGATGG + Intronic
992614122 5:78533460-78533482 CTGTGAGAGTAGGGGATGGGCGG + Intronic
993354755 5:86892235-86892257 TTGTGTGAGAAGGAGAAGGAAGG - Intergenic
993359396 5:86955381-86955403 CTGTGTTTGGAGGAGAATGAGGG + Intergenic
994071077 5:95603105-95603127 CTGTTAGTGTAGTAAAATGAAGG - Intronic
994267130 5:97730981-97731003 CTTTGAGAGTGGTAGGATGATGG + Intergenic
994973963 5:106778822-106778844 CTGTGATGGTAGTAGGATGAAGG + Intergenic
995058077 5:107784077-107784099 CTGTCATACTAAGAGAATGAGGG - Intergenic
996997594 5:129716755-129716777 CTGTGGGAGGAGGAGTATGCAGG - Intronic
997530213 5:134577252-134577274 CTGGGAGAGTAGGACAAGGATGG - Intronic
998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG + Exonic
1000926663 5:167202646-167202668 CTGTGTGACTGGGAGGATGATGG - Intergenic
1001028585 5:168245149-168245171 CTGTGAGGGTGGGAGCAGGAGGG - Intronic
1001067788 5:168552894-168552916 CTGAGAGAGCTGGAGCATGATGG + Exonic
1001094982 5:168769049-168769071 CTTTGAGACTAAGAGAAGGAAGG + Intronic
1001151199 5:169228711-169228733 CTTTCAGAGCAGGAAAATGAAGG - Intronic
1001414482 5:171535301-171535323 CTGTGGGGGCAGGAGAAGGATGG + Intergenic
1002712501 5:181203933-181203955 CTGGGAGAGTTGGAGCAGGATGG + Intronic
1002988351 6:2213741-2213763 CTATGAGAATAGGAGGACGAAGG + Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003697237 6:8421803-8421825 CCTGGAGAGTAGAAGAATGAAGG + Intronic
1004097369 6:12570809-12570831 GTGTGAGAGCAGGAGGAGGAAGG + Intergenic
1004170250 6:13290270-13290292 CTGGGAGATTAGGGGATTGACGG - Exonic
1004232691 6:13847303-13847325 CTGTGAGATTAGAAGCAAGATGG - Intergenic
1004754425 6:18596548-18596570 TTTTGAGAGAAGGAGAATGTAGG + Intergenic
1005105754 6:22222751-22222773 CTGTGAGGATAGGGGAATGGGGG - Intergenic
1006389432 6:33749805-33749827 CTGTGAAATGAGGGGAATGATGG - Intergenic
1006389802 6:33751675-33751697 CTGTGAAATGAGGGGAATGATGG - Intergenic
1007309598 6:40934896-40934918 CTGGGAGAGTGGGAGCAAGAAGG + Intergenic
1009008178 6:57811854-57811876 TTGTAAGAGAGGGAGAATGATGG - Intergenic
1009836978 6:69013826-69013848 CTCTGAGAGTACAAAAATGAAGG + Intronic
1010372351 6:75125460-75125482 CTTTGAGAATAGGAGGGTGAAGG - Intronic
1011022859 6:82833646-82833668 CTGTGAGACTAGCAGCAAGATGG + Intergenic
1011419489 6:87156063-87156085 TGGAGAGAGTAGGAGAATGGAGG + Intronic
1012416493 6:99019249-99019271 CTGTGAGGGGATGAGAGTGAAGG - Intergenic
1013042341 6:106448276-106448298 CCTTGAGAGGAGGAGAATGATGG - Intergenic
1013205147 6:107938184-107938206 ATGTGGGAGAAGTAGAATGAAGG - Intronic
1013747474 6:113362902-113362924 CAGTGATAGTGGGAGAATGGGGG - Intergenic
1014160736 6:118165302-118165324 CTGTGTGAGTAGGAAAAAGCTGG - Intronic
1014992219 6:128094914-128094936 CTGAGAGAGAGGGAGAAAGAGGG + Intronic
1015464106 6:133528702-133528724 CTGTGTGGTTAGGAGAAGGAGGG - Intronic
1015591805 6:134829591-134829613 CTGTGAGAGGAGGAAAAGAAGGG + Intergenic
1015602083 6:134920425-134920447 CTGTGTGAATAGGGGAATGGAGG + Intronic
1015823667 6:137289788-137289810 CTGTGAGACTGGGAGAGAGAGGG + Intergenic
1016166372 6:140949725-140949747 GTGTGAGAGTAGATGAATAAAGG + Intergenic
1017010960 6:150063724-150063746 CTGAGAGCGAAGGAGAAAGAAGG - Intronic
1017798564 6:157870631-157870653 GTGTGAGAGCAGGAGAGTGTGGG - Intronic
1017798582 6:157870839-157870861 GTGTGAGAGCAGGAGAGTGTGGG - Intronic
1017889474 6:158626865-158626887 GTGTGAGAGTGTGAGAGTGAGGG - Intronic
1017889501 6:158627044-158627066 GTGTGAGGGTGTGAGAATGAGGG - Intronic
1018061623 6:160094083-160094105 CTTTGGGAGAAGGGGAATGATGG - Intronic
1018742572 6:166741789-166741811 CGGTGAGAGCAGAAGAATGCTGG - Intronic
1021025140 7:15657868-15657890 CTGTGATAGTGAGGGAATGAGGG + Intronic
1021420963 7:20444251-20444273 CTGTGAGACTAGAAGCAAGAAGG - Intergenic
1021780754 7:24103400-24103422 GTGTGAGAGTGGTGGAATGATGG + Intergenic
1022454846 7:30549411-30549433 CTGTAAAATGAGGAGAATGATGG + Intronic
1022498732 7:30869295-30869317 CTGATAGAGGAGGAGAAGGATGG + Intronic
1022587473 7:31628212-31628234 CGGTAGGAGTAGGAGATTGAAGG - Intronic
1022993620 7:35731938-35731960 GTCAGAGAGTAGGAGACTGAAGG + Intergenic
1023045996 7:36210633-36210655 CTGGGAGAGCAAGAGAGTGAGGG - Intronic
1023126463 7:36959272-36959294 CTGAGACTGTAGGGGAATGAGGG - Intronic
1023879899 7:44312403-44312425 CTGGGAGGGCAGGAGAAGGAGGG + Intronic
1023889366 7:44381529-44381551 CTGTGATTGTAGCACAATGAGGG + Exonic
1026185648 7:68080843-68080865 CTGTGAGAACAGGAGAACGTGGG + Intergenic
1028494430 7:91448129-91448151 GTGTGGTAGTAGGATAATGAAGG + Intergenic
1030738305 7:113077617-113077639 CTGTGAAAGTGGGAGCAGGAAGG - Intergenic
1031158697 7:118140751-118140773 CTCTGAGAGTGGGAGATTGCTGG + Intergenic
1031325728 7:120394733-120394755 CTGTGAGACTAGAAGTAAGATGG + Intronic
1031737344 7:125383065-125383087 CTGTGAAACTAGTAGAATGTTGG + Intergenic
1033024459 7:137759101-137759123 CTGAGGGAGTAGGAGAGGGAGGG - Intronic
1033330753 7:140415018-140415040 GAGTGAGGGTAGGAGAAAGATGG - Intronic
1033557723 7:142503291-142503313 CTGTGAGGGAAGGAGATTGAAGG - Intergenic
1033560178 7:142523348-142523370 CTGTGAGGGAAGGAGATTGAAGG - Intergenic
1034271770 7:149806566-149806588 CTGTGAGGGTAGGGGCAGGAGGG + Intergenic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1037248167 8:16861035-16861057 CTAGGAGAGTAGGAGAAAGGAGG + Intergenic
1038004085 8:23415559-23415581 GGGTGGGAGTAGGAGAAAGAAGG + Intronic
1038057237 8:23872002-23872024 TTGTGAGAGTAGGAAAATTCAGG - Intergenic
1038243697 8:25833937-25833959 CTGTGAGAATAGGAAAAGGGAGG - Intergenic
1038914803 8:32009239-32009261 CTGTTGGAGTAGGGGAATGATGG - Intronic
1039242331 8:35570609-35570631 CTGGGAGAGTTGGGGACTGAGGG - Intronic
1039399322 8:37255328-37255350 GTGTGAGAGTGGTAGAATGAAGG - Intergenic
1039653300 8:39368336-39368358 CAGTGAGAATTGTAGAATGATGG + Intergenic
1040566316 8:48571077-48571099 CGGTGATAGTAGGAACATGATGG - Intergenic
1041091910 8:54309933-54309955 CTGTGAGGGGAAGAGAAGGAAGG - Intergenic
1042734049 8:71968028-71968050 TTGTGAAAGTAGGAGAGAGAAGG + Intronic
1043946136 8:86254959-86254981 ATGTGAGAGAAGGAGAAAAAGGG + Intronic
1044233103 8:89801464-89801486 CTGTGAGACTAGAAGCAAGAGGG - Intergenic
1044530728 8:93304309-93304331 GGGTGAGAGTTGTAGAATGAAGG - Intergenic
1044844990 8:96371819-96371841 ATCTGAGAGGAAGAGAATGAAGG - Intergenic
1045042866 8:98243506-98243528 TTCAGAGAGTAGGTGAATGAAGG - Intronic
1047796973 8:128267648-128267670 ATGTGTGAGTAACAGAATGAAGG + Intergenic
1047919044 8:129614081-129614103 GAGTGAGGGTAGGAGAATAATGG - Intergenic
1047967284 8:130055601-130055623 CTGTGAAAGTTTGAGACTGATGG + Intronic
1048512793 8:135077891-135077913 CTGTGAGTGTTGGGGAATGGGGG - Intergenic
1048547249 8:135398616-135398638 CGCTGAGAGTGGGAGAAAGAAGG - Intergenic
1048558721 8:135509301-135509323 CTTTGAGAGTCGGACAATGCTGG + Intronic
1048991018 8:139760183-139760205 CTCTGTGAGTAGGGGAAGGAGGG + Intronic
1050317278 9:4415287-4415309 CTGAGATAGTGAGAGAATGAAGG - Intergenic
1051459969 9:17300929-17300951 CTGTAAGAGTTGTAGAATAAAGG - Intronic
1055157381 9:73080586-73080608 CTGTGAGGTTAAAAGAATGAAGG + Intergenic
1056318328 9:85413422-85413444 CTGTGAGTGTATGTGAAAGAAGG + Intergenic
1057047692 9:91898675-91898697 CTGTGAGAGTTGGTGATTTACGG - Intronic
1057069047 9:92080179-92080201 CTGTTAGAGTTGGAGGAGGAAGG - Intronic
1057477963 9:95420676-95420698 CTGTGACAGAAGGAGAGGGAGGG - Intergenic
1057693796 9:97309772-97309794 CTGTGGGAGTGGGGGAATGGGGG - Intronic
1058634526 9:107023564-107023586 CTGTCAGAGTAGGAGAATTTGGG + Intergenic
1061032979 9:128098018-128098040 CTGTGAGGATAGGAGGCTGAGGG - Intronic
1186756987 X:12681953-12681975 CTGGGGGTGGAGGAGAATGAGGG - Intronic
1187007614 X:15247870-15247892 CAGTGAGAGTAGGAGGAAGAAGG + Intronic
1192237025 X:69302499-69302521 CTGTGAGATTGAGAGGATGAGGG - Intergenic
1194605745 X:95975848-95975870 CTGTGAGAGGTGGAGCAAGATGG + Intergenic
1196047874 X:111275031-111275053 GTGTTAGAGTAGGAGACTCAGGG + Intergenic
1196546754 X:116972497-116972519 TTGTCAGAGTAGGAGGAAGAGGG - Intergenic
1197770838 X:130088265-130088287 CTGTGAGTGGAGGAGATGGAGGG + Intronic
1197899522 X:131355043-131355065 CTGGGACATTAGGACAATGATGG + Intronic
1198845654 X:140907613-140907635 ATGTGAGAGTAAGAGTAGGATGG - Intergenic
1198947300 X:142028957-142028979 TTGTCAGAGCAGGAGAGTGAGGG - Intergenic
1200783297 Y:7236353-7236375 ATGAGAGAGAAAGAGAATGACGG - Intergenic
1201696539 Y:16832999-16833021 CTGTGAGCCTAGGAGAAGGGGGG - Intergenic