ID: 1170330223

View in Genome Browser
Species Human (GRCh38)
Location 20:15201285-15201307
Sequence GGTATGTTAGATATCTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170330223_1170330228 27 Left 1170330223 20:15201285-15201307 CCTCCCCAGATATCTAACATACC 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1170330228 20:15201335-15201357 CACATAAGTTTTAACTATTTTGG 0: 1
1: 0
2: 1
3: 27
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170330223 Original CRISPR GGTATGTTAGATATCTGGGG AGG (reversed) Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
908732338 1:67238942-67238964 GGTATGTGAAATAACTAGGGTGG + Intronic
914220840 1:145680663-145680685 GGTAAGTTAGCTCTCTGGGGCGG - Intronic
914473413 1:148003538-148003560 GGTAAGTTAGCTCTCTGGGGCGG - Intergenic
922017359 1:221664154-221664176 GGTATGTTAGTTTCCTAGGGCGG - Intergenic
1068464082 10:57365191-57365213 GGTATGATAGATATTAGGGGAGG - Intergenic
1076426100 10:130368676-130368698 GGTATGATAGTTATCTGAGTGGG + Intergenic
1077889180 11:6406358-6406380 GCTATGTTAGTTATGTGGGGTGG - Intronic
1078761576 11:14255915-14255937 TGCATGTTAGAAACCTGGGGAGG - Intronic
1081784195 11:45734986-45735008 GGGAAGTGAGCTATCTGGGGTGG + Intergenic
1081891277 11:46544630-46544652 GGTATTTTAGATACCTTGGTGGG - Intronic
1085322927 11:75585608-75585630 GGTATGGCAGGTCTCTGGGGTGG - Intergenic
1086371591 11:86160665-86160687 GGTATGTGCCATATCAGGGGAGG - Intergenic
1092698990 12:11205754-11205776 TGTATGTTAGGAAACTGGGGAGG + Intergenic
1093117866 12:15233922-15233944 GCTATATGAGATATCTAGGGTGG + Intronic
1097527694 12:60759015-60759037 TGTATCTTAGATATGTGAGGTGG - Intergenic
1100096291 12:91041731-91041753 GGTGTGTTAGCTTTCTAGGGCGG - Intergenic
1103171306 12:118822513-118822535 GGTATGTTGGAAGTCTGGGTTGG - Intergenic
1108984603 13:56569633-56569655 CATATGTCAGATATTTGGGGTGG + Intergenic
1112429605 13:99339142-99339164 TGTCTATTAGATATCTTGGGGGG - Intronic
1112669886 13:101623422-101623444 TGTATGTTAGATAATTGGGTAGG - Intronic
1116133020 14:40883386-40883408 GGTATGGTAGATTTCTGGCCGGG - Intergenic
1117520536 14:56547060-56547082 GGAATTTTAGTTATCTGGGGGGG + Intronic
1120454121 14:84710021-84710043 GGCATGTGTGATAACTGGGGAGG - Intergenic
1122619960 14:103050459-103050481 GCTATGTTAGGAATTTGGGGAGG - Intronic
1123768055 15:23501267-23501289 GGTATATTTGATATCTGGTGAGG - Intergenic
1125099941 15:35900868-35900890 GGTATTATAGATTTTTGGGGAGG + Intergenic
1126451601 15:48814559-48814581 GGAATCTTAGTTATCTGGGAAGG - Intergenic
1129193216 15:73949637-73949659 GGTATCTTAGGTATCTCAGGTGG - Intronic
1131310803 15:91288120-91288142 GGCAAGTCAGATCTCTGGGGTGG + Intronic
1131653481 15:94428615-94428637 GGTCTGATAGGTGTCTGGGGTGG - Intronic
1132205020 15:99980514-99980536 GGGCTGTTGGATTTCTGGGGAGG + Intronic
1138870056 16:60871820-60871842 TGTAGGTTAGATGTCTGAGGGGG + Intergenic
1148760973 17:49999862-49999884 GGTATGTTAGATTCCAGTGGGGG - Intergenic
1149342413 17:55700371-55700393 GATATCTTAGAGATCTGGGGGGG + Intergenic
1149737533 17:59010062-59010084 GGTATGCTAGGTATGTGTGGTGG - Intronic
1149995456 17:61403926-61403948 GGTGTGTTGGATACCTGTGGAGG + Intronic
1150663471 17:67107428-67107450 GGTGAGTTGAATATCTGGGGTGG + Exonic
1156728588 18:40161299-40161321 GGAATGTTACATTTCTGGGCAGG + Intergenic
1165634408 19:37328459-37328481 GGTGGGTTAGTTATCTTGGGAGG + Intronic
928807054 2:35171489-35171511 TGTGTGTTAAATGTCTGGGGTGG - Intergenic
932952787 2:76313839-76313861 GGTATGTCAGAAATCAGGGTAGG + Intergenic
933144047 2:78829315-78829337 AATATGTTAGATATGTTGGGTGG + Intergenic
935032803 2:99338041-99338063 GGTACGTTAGAGTTATGGGGAGG + Intronic
937825850 2:126368011-126368033 GGTATTTTGGGTATCTGAGGAGG - Intergenic
940661438 2:156549772-156549794 GGTATGCCAGGTATCTGGGAGGG + Exonic
942761173 2:179399912-179399934 GGTGTGTCAGAGGTCTGGGGTGG + Intergenic
945901889 2:215547703-215547725 GTTTTGTTAGACATCTGGAGAGG - Intergenic
1170330223 20:15201285-15201307 GGTATGTTAGATATCTGGGGAGG - Intronic
1172461598 20:35123148-35123170 GGAATGTTAGAACTTTGGGGCGG - Intronic
1172799907 20:37568394-37568416 GGTATTTTAGGTCTCTGGGTAGG + Intergenic
1174987674 20:55473564-55473586 GCAATATTAGAAATCTGGGGAGG + Intergenic
1176197207 20:63842886-63842908 GCTGTGTGGGATATCTGGGGAGG - Intergenic
1178235155 21:30833488-30833510 GGGATGACAGATATCTGGTGAGG - Intergenic
1179312614 21:40210051-40210073 GGTATGTTTGAGTGCTGGGGTGG - Intronic
1181461518 22:23088755-23088777 TGTGTGGTAGGTATCTGGGGAGG + Intronic
951815644 3:26751064-26751086 GGTATGTTAAATATATTGGTTGG - Intergenic
953507536 3:43500938-43500960 GGTATGTAAGAGGGCTGGGGAGG + Intronic
956105698 3:65815898-65815920 AGTATGTTAGATCTCTGCGTTGG - Intronic
957041725 3:75341065-75341087 GGTATGTAATGTATCTGGGCAGG + Intergenic
958086218 3:88811085-88811107 GGTATGTAAGATATCAAGGTAGG - Intergenic
959971711 3:112417014-112417036 GGTATGTTAGGCCTCAGGGGTGG - Intergenic
961046437 3:123711858-123711880 GGTATGTAATGTATCTGGGCAGG + Intronic
964728968 3:159844834-159844856 GGTGTGATCTATATCTGGGGCGG - Intronic
966414772 3:179677286-179677308 GGTATGTTAAATTTCTGGCCGGG + Intronic
968945525 4:3661547-3661569 GGTATGTTAGATAAGTGGCCAGG - Intergenic
972345658 4:38190314-38190336 GGTATGCTAGAAATCTAAGGCGG - Intergenic
981719836 4:147790134-147790156 GGTATATTCGGTATCTGGTGAGG + Intronic
981915887 4:150032858-150032880 GGTAGGAGAGATATTTGGGGTGG - Intergenic
981969390 4:150648557-150648579 GGTAATTTAGAAATGTGGGGTGG - Intronic
982302604 4:153895020-153895042 AGTATGCTAGCTATCTGGGGTGG + Intergenic
983696693 4:170541234-170541256 GATAGGTTGGATATCTGGTGAGG - Intergenic
983969277 4:173851232-173851254 GGCAGATTAGATATCTGGTGAGG - Intergenic
986470457 5:8068512-8068534 AGTATGGTAGAAATCTGGGAGGG + Intergenic
993288959 5:86040101-86040123 GGTAGGTCTGATGTCTGGGGAGG + Intergenic
994356564 5:98799926-98799948 CGTATGCTGGATTTCTGGGGTGG - Intergenic
997393918 5:133541190-133541212 TGTAGGTCAGATATCTGGGGAGG + Intronic
997709909 5:135995562-135995584 GGTAGGTTTGGTATCTGGTGAGG - Intergenic
1009368171 6:62871942-62871964 ATTATTTTTGATATCTGGGGAGG + Intergenic
1010094582 6:72026283-72026305 GGTATGTGATAAATCTGAGGTGG - Intronic
1011548074 6:88502243-88502265 GGTATTTTAGAACCCTGGGGAGG - Intergenic
1014149716 6:118040629-118040651 AGAATCTTAGAAATCTGGGGTGG + Intronic
1014289016 6:119536897-119536919 AGTAGGTTAGATATCTGCAGTGG - Intergenic
1017603808 6:156111796-156111818 GGTAGGTGAGATATTTGGAGTGG + Intergenic
1026365271 7:69642346-69642368 TGTATGTTAGAAAACTGGGATGG - Intronic
1030968080 7:116018616-116018638 GACATTTTAGATTTCTGGGGAGG + Intronic
1031295567 7:119998181-119998203 GGTGGGCTAGATATCTTGGGAGG + Intergenic
1034642781 7:152618007-152618029 GGCAGGTTGGATATCTGGTGAGG - Intergenic
1034903309 7:154921563-154921585 GGTATATTACAAATTTGGGGTGG - Intergenic
1037385663 8:18337846-18337868 GGTATCTTAGGTATCTTGGAAGG - Intergenic
1038035627 8:23683575-23683597 GGTATGTCATGTGTCTGGGGAGG - Intergenic
1039582605 8:38679095-38679117 GGCATGTTAAATATCTGGAATGG + Intergenic
1046041550 8:108911943-108911965 GGGATGTTAGATGTGGGGGGTGG - Intergenic
1046504681 8:115122348-115122370 AGTATGTTAGTTATCTAGGTTGG - Intergenic
1048801145 8:138194712-138194734 CTTGTGTTAGATATCTGGGTGGG - Intronic
1048934673 8:139344935-139344957 GGAAGGAAAGATATCTGGGGAGG - Intergenic
1050289100 9:4135314-4135336 GGAATGATAGATGTCGGGGGTGG - Intronic
1051253089 9:15181944-15181966 GTTATGATAGCTTTCTGGGGAGG - Intronic
1057505989 9:95634022-95634044 GGGATGTTAATGATCTGGGGAGG - Intergenic
1189841856 X:45088037-45088059 GGTAAGTTTGATTTTTGGGGCGG + Intronic
1196455817 X:115890949-115890971 GGTATGTTAGGTAACAGGGTAGG + Intergenic
1197362647 X:125525541-125525563 AGTATGTTACATATTTGGAGAGG + Intergenic