ID: 1170338288

View in Genome Browser
Species Human (GRCh38)
Location 20:15295227-15295249
Sequence GTCTCACAGTTCCACATGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19537
Summary {0: 1, 1: 211, 2: 3593, 3: 7068, 4: 8664}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170338288_1170338291 16 Left 1170338288 20:15295227-15295249 CCAGTCATGTGGAACTGTGAGAC 0: 1
1: 211
2: 3593
3: 7068
4: 8664
Right 1170338291 20:15295266-15295288 CTTTAGAAATCTCCCAGTCTCGG 0: 1
1: 6
2: 206
3: 4094
4: 5067
1170338288_1170338292 17 Left 1170338288 20:15295227-15295249 CCAGTCATGTGGAACTGTGAGAC 0: 1
1: 211
2: 3593
3: 7068
4: 8664
Right 1170338292 20:15295267-15295289 TTTAGAAATCTCCCAGTCTCGGG 0: 1
1: 6
2: 448
3: 8318
4: 16235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170338288 Original CRISPR GTCTCACAGTTCCACATGAC TGG (reversed) Intronic
Too many off-targets to display for this crispr