ID: 1170342535

View in Genome Browser
Species Human (GRCh38)
Location 20:15345483-15345505
Sequence GAATCAAGGCTGGCTCCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170342532_1170342535 -5 Left 1170342532 20:15345465-15345487 CCTGTTAGTTTCATGAATGAATC 0: 1
1: 0
2: 0
3: 9
4: 164
Right 1170342535 20:15345483-15345505 GAATCAAGGCTGGCTCCTACTGG 0: 1
1: 0
2: 1
3: 4
4: 94
1170342531_1170342535 21 Left 1170342531 20:15345439-15345461 CCAGCATAATGGATATTGGGCAC 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1170342535 20:15345483-15345505 GAATCAAGGCTGGCTCCTACTGG 0: 1
1: 0
2: 1
3: 4
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170342535 Original CRISPR GAATCAAGGCTGGCTCCTAC TGG Intronic
900394383 1:2447175-2447197 CCATCAAGCCTGGCTCCTCCTGG - Intronic
900890840 1:5448616-5448638 GAATCAGGGCAGCCTACTACAGG + Intergenic
901436505 1:9250212-9250234 GAGTAAATGCTGCCTCCTACTGG + Intronic
901744005 1:11360655-11360677 GAAATAAGGCTGACACCTACTGG - Intergenic
904918478 1:33987115-33987137 CATTCAAGGCTGTCTTCTACTGG - Intronic
909798165 1:79770600-79770622 GTATCAGAGCTGGCCCCTACAGG + Intergenic
913512151 1:119571790-119571812 GGATAAAGGCAGGCTCCAACTGG - Intergenic
914863040 1:151402119-151402141 AAATTAAGTCTGGCTTCTACAGG - Intergenic
918508143 1:185280582-185280604 TAATCATGGCTGGGTCCTTCTGG - Intronic
1066214964 10:33277372-33277394 GAAACAAGGTTGGCTCCTGGAGG + Intronic
1070517119 10:77218498-77218520 GCATCCAGCCTGGCTCCTGCAGG + Intronic
1070682052 10:78455620-78455642 GAATCCAGGCTGTCTCCAGCTGG + Intergenic
1073254256 10:102140969-102140991 GAAGCAGGGCTGGGACCTACAGG - Exonic
1075544166 10:123341801-123341823 AAACCAAGGCTGGCACATACAGG + Intergenic
1076398038 10:130155806-130155828 GAACCAAGGCTGGCACATGCCGG + Intronic
1077232735 11:1465350-1465372 GAATCAAGGTGTGCTCCTCCTGG + Intergenic
1078623515 11:12931746-12931768 GTATAGAAGCTGGCTCCTACTGG - Intronic
1080653974 11:34244104-34244126 GAGTCCAGGCTGGCTGCTAAGGG - Intronic
1085279154 11:75319146-75319168 GAACCACAGCTGGCTCCAACAGG + Intronic
1086479461 11:87218619-87218641 GAATCATGAATGGCTCCAACAGG - Intronic
1101880396 12:108622234-108622256 GTTTCAAGGCTGTCTCCTTCAGG - Intergenic
1103971610 12:124676043-124676065 GAATCAAGGCTGACAGCTTCAGG - Intergenic
1103997664 12:124840661-124840683 GAATCAAGGGTGGTTCCTCAAGG - Intronic
1104326448 12:127803302-127803324 GCATCAAGGCTTTCTCCTAGAGG + Intergenic
1104850023 12:131868381-131868403 GAGGCCAGGCTGGCTCCTGCAGG + Intergenic
1109797132 13:67330474-67330496 GAATGAATGCTGGCACCTATTGG - Intergenic
1115827104 14:37290563-37290585 GAATAAAGGATGACTCCTTCAGG - Intronic
1117657061 14:57965991-57966013 GAAACATTGCTGGGTCCTACTGG - Intronic
1119370471 14:74136833-74136855 GTTTCAAGCCTGGCTACTACTGG - Intronic
1120305863 14:82769839-82769861 GAATCTATGCTGGGTACTACTGG - Intergenic
1121210186 14:92202599-92202621 GAATCAAGGCTGTCTCCTGGGGG + Intergenic
1130859866 15:87876244-87876266 GAATCAATGATGGCACCTACGGG - Intronic
1130919473 15:88332225-88332247 GAATCAAAGCCAGCTCCAACAGG + Intergenic
1131468948 15:92679095-92679117 GAATCAAGGCAGGCCCCAAAGGG - Intronic
1133220400 16:4317004-4317026 GAATCCAGGCTGGCACCTGGAGG + Intronic
1138705350 16:58909831-58909853 GAGTAAAGGCTGGCTGCTACAGG - Intergenic
1140258211 16:73355114-73355136 GAATGGAAGCTGGCTCCTAATGG - Intergenic
1141111851 16:81276389-81276411 GAAGCAAGGCTGGGCCCTTCAGG - Intronic
1146001258 17:29131916-29131938 GAGTGAAGGTTGGCCCCTACTGG + Intronic
1146305829 17:31729216-31729238 TGACCAAGGCTGACTCCTACAGG + Intergenic
1147681810 17:42253649-42253671 AAACCAAGACTGGCTCCTATTGG - Intronic
1154212748 18:12394186-12394208 GAGTCAAGGGTGACTCCTAGGGG - Intergenic
1157245277 18:46048319-46048341 TCAGCAAGGCTGGCTCCTTCTGG - Intronic
1164681954 19:30140691-30140713 CAATCATGGCTGACTCCTGCAGG + Intergenic
1164860001 19:31555271-31555293 AAATCAAGGCTGGCTCATCTGGG - Intergenic
1164941465 19:32254708-32254730 GGATCAAGGCTGGCTTCCAGAGG + Intergenic
1164989253 19:32672870-32672892 AAATCAAGTCTGGATCCTTCTGG + Intronic
1167314826 19:48757115-48757137 GAATCAAGTCTGGCTCCGGGGGG - Intronic
925920025 2:8632060-8632082 TAAGCAGGGCTGGCTCCTTCTGG + Intergenic
927051193 2:19330992-19331014 GAATCAAGGCTGTCTTCTGTAGG - Intergenic
928794530 2:35000638-35000660 GAATGAAGGATGTCTCTTACAGG + Intergenic
946353815 2:219172516-219172538 GAATCAAGCTTTGCTCCTCCAGG + Exonic
947870853 2:233437140-233437162 GAAGCATGACTGGCTCCTGCCGG + Intronic
948856755 2:240733863-240733885 AAATCAAGGCTGCCTGCTCCTGG - Intronic
1168900499 20:1359840-1359862 GAATAAAGGATGGCTTCTTCTGG + Intronic
1169129946 20:3161261-3161283 GAAGGAGGGCTGGGTCCTACTGG + Intergenic
1170342535 20:15345483-15345505 GAATCAAGGCTGGCTCCTACTGG + Intronic
1170522311 20:17199172-17199194 GGATCAAGGATGGCTTCTAAGGG - Intergenic
1175053649 20:56178101-56178123 GAACCAAGACTGGCTCATCCTGG + Intergenic
1175092556 20:56517141-56517163 GAATCAAGGCTGGCTTCTTCAGG - Exonic
1175214833 20:57386586-57386608 GCAGCAAGGCTGGTTCCTTCTGG + Intergenic
1178605130 21:34029698-34029720 GAAGCAAAGCTGGTTCCTGCCGG + Intergenic
1181990723 22:26834827-26834849 GAAGCACAGCTGGCTCCAACAGG - Intergenic
1183364328 22:37399245-37399267 GACTCAAAGCTGCCTCCTACAGG + Intronic
1184309024 22:43629134-43629156 GAATCCAGGCTGGCCCCACCTGG - Intronic
1184572213 22:45332618-45332640 GAATCAAAGTTGTATCCTACGGG + Exonic
949924115 3:9027450-9027472 GAAGCAAGGCTGGCCCCTGGTGG + Intronic
950320949 3:12052721-12052743 TGACCAAGGCTGGCTCCTATGGG - Intronic
951118594 3:18895635-18895657 GTATCAGAGCTGGCTCATACTGG + Intergenic
952954732 3:38549832-38549854 GAATCCAGTGTGGCTCCCACAGG - Exonic
957154338 3:76528473-76528495 GAATCAAGGATGTCTCCAAGTGG + Intronic
969513143 4:7631223-7631245 GAGTCACCGCTGGCTCCTGCAGG + Intronic
970978276 4:22066907-22066929 GGATCAGGGCTAGCTTCTACTGG - Intergenic
978130376 4:105188857-105188879 GAATGAAAACTGGCTCCTAATGG + Intronic
982632072 4:157843172-157843194 GAATAAAGACTGGCCTCTACAGG - Intergenic
996899805 5:128531967-128531989 GAATCAAGGCTGTCTTCTCTGGG - Intronic
997320235 5:132972038-132972060 GAAACAAGGCTGAGACCTACTGG + Intergenic
998311871 5:141140605-141140627 GCATGAAGTCTGGCTCCAACCGG + Intronic
1007280677 6:40710138-40710160 GGATCCAGGCTGGGTCCGACTGG - Intergenic
1013967265 6:115969773-115969795 AAATCAAGACTGCCTCCCACTGG - Intronic
1014432997 6:121391148-121391170 AAATCAAGGATGGTTCCTTCTGG + Intergenic
1020451745 7:8327400-8327422 CACGCAAGGCTGGCTGCTACAGG + Intergenic
1022967107 7:35483898-35483920 GCAACAAGGCTGGATCCTGCAGG + Intergenic
1024832062 7:53472544-53472566 GAAACAAGGCTGAAACCTACTGG + Intergenic
1024932541 7:54678999-54679021 AAAACAAGGCTGACACCTACTGG + Intergenic
1030633293 7:111919067-111919089 AAATGAATGCTGGCTCCTATAGG - Intronic
1034396333 7:150828124-150828146 TAATCAGGGCTGGCTTCTTCTGG + Intronic
1036614126 8:10375249-10375271 GAAACAAGGCTGGCGTCTGCTGG + Intronic
1036688655 8:10927729-10927751 GCATCAAGATTGGCTCCTCCTGG - Intronic
1038979471 8:32742001-32742023 GAATCCAGGTTGGCACCTAGAGG - Exonic
1048527362 8:135215257-135215279 GAATCAGGGCTGGGAACTACTGG - Intergenic
1053069589 9:35093194-35093216 GAATCACCTCTGGCTCCTAAAGG + Exonic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1059670041 9:116482904-116482926 GAATCAGGCCTGGCTGCTGCTGG + Intronic
1061236598 9:129346695-129346717 AAATCCAGGCTGCCTCCTGCTGG + Intergenic
1062486461 9:136778872-136778894 GGATCAACACTGGCTCCTCCAGG + Intergenic
1195837332 X:109131743-109131765 GAATCAGAGTAGGCTCCTACTGG + Intergenic
1197015980 X:121626823-121626845 GAATCAGAGCTGGCTGCCACTGG - Intergenic
1200084540 X:153597372-153597394 TAAGCAGGGCTGGCTCCTTCTGG + Intronic
1201667861 Y:16479151-16479173 AAATCAAGGCTGGGTCTTGCTGG + Intergenic