ID: 1170345031

View in Genome Browser
Species Human (GRCh38)
Location 20:15376292-15376314
Sequence CAGTGCAAGGAGAAGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 573
Summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 513}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170345028_1170345031 1 Left 1170345028 20:15376268-15376290 CCTAGAAAAGTATATAAATATCA 0: 1
1: 1
2: 8
3: 88
4: 804
Right 1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG 0: 1
1: 0
2: 2
3: 57
4: 513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170345031 Original CRISPR CAGTGCAAGGAGAAGGAAGC AGG Intronic
900583396 1:3420475-3420497 CCGCGCAAGCAGGAGGAAGCAGG + Intronic
901396971 1:8988694-8988716 CTGTCCAGGGAGAAGGATGCAGG + Intergenic
902380558 1:16050449-16050471 CATCCCAAGGAGAGGGAAGCAGG - Intronic
902561871 1:17282705-17282727 CTGTGCAATGAGAAGGTAACTGG - Intronic
902652077 1:17843660-17843682 AAGTGAAAGGAGAAGGAAGGTGG - Intergenic
902816185 1:18918011-18918033 CAGAGGAAGGGGCAGGAAGCGGG + Intronic
903352622 1:22727168-22727190 CAGAGCAGGGAGAGGCAAGCTGG + Intronic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
904139506 1:28341266-28341288 CACTGCAAGGAGAAGAAAGCTGG - Intergenic
904259227 1:29278991-29279013 CACTGCAAGGGAAAGGCAGCAGG - Exonic
904272050 1:29356545-29356567 CAGAGCTAAGAGAAGGAAGGAGG + Intergenic
904623472 1:31789276-31789298 TAGCGCAAGGAGTTGGAAGCGGG - Intergenic
905791009 1:40789533-40789555 GAGTGCAAGGAGGAGGAGGAAGG - Intronic
906222155 1:44089301-44089323 GAAAGGAAGGAGAAGGAAGCAGG + Intergenic
906336665 1:44938017-44938039 AAGTGCAAGGGGAAGAAAGGTGG + Intronic
908532822 1:65049794-65049816 CAATGCTAAGAGAAGGAGGCAGG - Intergenic
910162056 1:84283729-84283751 CAGCACAAGGAGACAGAAGCTGG - Intergenic
910549601 1:88461111-88461133 ATGTGAAAGGAGCAGGAAGCAGG + Intergenic
910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG + Intergenic
911126169 1:94343130-94343152 CACTCCAAAGAGAAGGGAGCGGG - Intergenic
911134406 1:94423796-94423818 TAGTGCAGGGAGTAAGAAGCTGG - Intronic
911634772 1:100222744-100222766 CAGTGAAAGGAGGAGAAAGAGGG - Intronic
912214413 1:107591225-107591247 AAGTGCAAGGAAATGGGAGCAGG - Intronic
915647201 1:157281402-157281424 TAGAGCAGGGAGAAGGGAGCAGG + Intergenic
916935081 1:169619357-169619379 CAGGGCAATGAGAAGCAAGAAGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918146361 1:181759430-181759452 GAGTGCAAGGGGAAGGATTCTGG + Intronic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
918188459 1:182148444-182148466 CAGTAATAGGAGAAGGAAGTAGG - Intergenic
918586539 1:186194685-186194707 CAGTGCACTTAGAAGCAAGCAGG - Intergenic
919435074 1:197548288-197548310 CAGTTCAATGAGAAGGAAGTGGG + Intronic
919921886 1:202171090-202171112 CAGTGCATAGGGAATGAAGCCGG + Intergenic
920053974 1:203179676-203179698 CAGTGCAAGGGACAGGAATCTGG + Intronic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
922993537 1:229937829-229937851 CCGGGGATGGAGAAGGAAGCAGG + Intergenic
923124437 1:231022939-231022961 CTGTGCCAGGTGAAGGACGCTGG - Intronic
923226960 1:231947156-231947178 CTGGGCAAGAAGAATGAAGCTGG + Intronic
923394476 1:233547408-233547430 CAGTGCAGGGAGAAGGTGTCTGG - Intergenic
923400521 1:233612000-233612022 CTGTCCAAGCAGAAGGAATCAGG + Intergenic
924315567 1:242791892-242791914 CACTGAAAGGAAAGGGAAGCTGG + Intergenic
1064143257 10:12807644-12807666 CAGGACAAGGAGCAGGTAGCCGG - Intronic
1065070143 10:22015005-22015027 CAGTGCAGGGAGAGGAAGGCTGG - Intergenic
1065861994 10:29879583-29879605 CAGGCCTAGTAGAAGGAAGCAGG - Intergenic
1067039263 10:42940303-42940325 GAGTCCAAGGAGAAGGGAGATGG - Intergenic
1067278088 10:44851978-44852000 CAGGGCAGGGAGAATGCAGCCGG + Intergenic
1068971079 10:62959135-62959157 AAGTGCCAGGAGAAGGATGATGG - Intergenic
1069718518 10:70535587-70535609 AAGAGGAAGGAGAAGGAAGGAGG - Intronic
1069834111 10:71297833-71297855 CAGTCCAAGGGGAGGGAGGCTGG + Intronic
1069914229 10:71777550-71777572 AAGGGCAAGGAGAAGAAAGCAGG - Intronic
1070367867 10:75753546-75753568 AAGTGCAAGGAGGAGAAAGGGGG + Intronic
1070697878 10:78576379-78576401 AAGTTCAAGGGGAAGGAAGAAGG + Intergenic
1070701044 10:78601975-78601997 CAGTGCCAGGAGAGGCAGGCAGG - Intergenic
1070850971 10:79561216-79561238 CACTCCCAGGAGCAGGAAGCTGG + Intergenic
1071116077 10:82221977-82221999 AACTGCAAGCAGAAGAAAGCAGG - Intronic
1071858243 10:89646878-89646900 GAGTACAAGGAGTAGGAAGAGGG - Intergenic
1072069136 10:91899738-91899760 CAGGGCAAGTAGGAGGAAGGAGG - Intergenic
1072240302 10:93489602-93489624 AGATGCAGGGAGAAGGAAGCTGG - Intergenic
1072381233 10:94873073-94873095 CAGTGAAAGGAGAAGCAAACAGG + Intergenic
1074493817 10:113961063-113961085 GGGTGCAAGGAGCAGGGAGCAGG - Intergenic
1075222974 10:120600648-120600670 CAGAGGAAGCAGAAGCAAGCCGG - Intergenic
1075538807 10:123295068-123295090 CACTGCAAGGAGAAGAAACTAGG - Intergenic
1075637090 10:124036611-124036633 CAATGCAAAGTGAAAGAAGCAGG + Intronic
1076886885 10:133267100-133267122 GAGTGGAAGGAGAAGGAGCCAGG + Intronic
1077090292 11:775316-775338 CACGTCCAGGAGAAGGAAGCTGG + Intronic
1077523506 11:3050266-3050288 CCGTGCAGTGGGAAGGAAGCAGG - Intronic
1077847300 11:6039524-6039546 CAGAACCAGGAGAAGGAAGGAGG - Intergenic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG + Intronic
1079132560 11:17756030-17756052 AAGTGCAAGAAGAAGGAGGGAGG + Intronic
1079157822 11:17964939-17964961 CTGTACAAGGAGCAGGAAACAGG + Intronic
1079451321 11:20601773-20601795 CAGTGCCAGGTGATGGATGCGGG + Intronic
1079655425 11:22980910-22980932 AAGTGCAAGAAAAAGGCAGCAGG - Intergenic
1080105686 11:28509448-28509470 TAGTGCAACGAGAGGAAAGCAGG - Intergenic
1080410686 11:32022260-32022282 CAGTGGAAGGAGTTGGGAGCAGG - Intronic
1080533283 11:33197578-33197600 CAGAGCCAGGAGATGGAATCAGG + Intergenic
1081773761 11:45664715-45664737 CAGGGCTGGGAGCAGGAAGCAGG + Intronic
1083751737 11:64764750-64764772 CACTTCATGGAGAGGGAAGCGGG + Exonic
1084953202 11:72678014-72678036 CAGGGGAGGGGGAAGGAAGCAGG - Intergenic
1085282863 11:75342243-75342265 CAGGGCTCGGAGAGGGAAGCAGG - Intronic
1085413469 11:76305611-76305633 CAGTGCAAGGAGGAGGCACTTGG - Intergenic
1085484379 11:76849464-76849486 CAGAGCAAGAAGAAGGATTCTGG + Intergenic
1085697248 11:78715448-78715470 CAGTGCAGGGAGACAGGAGCTGG - Intronic
1086897221 11:92327299-92327321 TAGTTCAAGCAGAATGAAGCAGG + Intergenic
1087158223 11:94924921-94924943 AAGTGCAAGGAAAAGAAAGGAGG - Intergenic
1087448448 11:98285832-98285854 CAGGGCAAGGTGAAGAAAGAAGG + Intergenic
1087779462 11:102287352-102287374 TGGGGCAAGGAGAAGGAAGTTGG + Intergenic
1088339330 11:108745128-108745150 GAGTGGAAGGAGAAGGGAGAAGG - Intronic
1088736498 11:112732066-112732088 AGGTGTAAAGAGAAGGAAGCTGG + Intergenic
1088736722 11:112733651-112733673 CACTGCAAGGGAAAGGAAGCAGG + Intergenic
1089297310 11:117477887-117477909 CAGAGCACTGAGAAGGCAGCCGG - Intronic
1089325668 11:117655142-117655164 CAGGGCATGGAGATGGCAGCTGG - Intronic
1089662467 11:119994335-119994357 TATTGCAAGGAGAAGGCAGCAGG + Intergenic
1089778844 11:120858914-120858936 CTGTGGAAGGACAAGGAAGGGGG - Intronic
1090639307 11:128716891-128716913 CAGTGCAGGGAGGAGGAAGAAGG + Intronic
1090981302 11:131724885-131724907 CTGGGCAAGGAAAAGGCAGCAGG + Intronic
1092028484 12:5263220-5263242 CACTGCAAGCAGAAGCAGGCAGG + Intergenic
1092550217 12:9490302-9490324 AGGTGGAAGGAGAAGGAAGAAGG + Intergenic
1093778012 12:23099878-23099900 CAGACCAAGAAGCAGGAAGCAGG + Intergenic
1093878545 12:24377636-24377658 CAGTGGAAGGAGCACGAGGCTGG - Intergenic
1094521591 12:31196071-31196093 AGGTGGAAGGAGAAGGAAGAAGG - Intergenic
1095882566 12:47153811-47153833 CAGTTCATGGAGAAGGAAATAGG - Intronic
1095993648 12:48059018-48059040 AAGTGCAACGAGAAGGAAAAAGG - Intronic
1096260425 12:50086618-50086640 CAGTGCAAAGAAAAAGAAGATGG + Exonic
1096371039 12:51069269-51069291 AAAAGAAAGGAGAAGGAAGCCGG - Intronic
1096809813 12:54162078-54162100 CATGGCAAAGAGAAGGGAGCAGG + Intergenic
1096845268 12:54403157-54403179 CAGGGCAGGGAGAAGGGACCTGG - Intronic
1096884799 12:54706476-54706498 CAGGGCAAGGAGAAGCAATGAGG - Intergenic
1096967426 12:55639346-55639368 CAGAGCCTGGAGAAGGAAGTGGG + Intergenic
1097068773 12:56339636-56339658 CAGTGAATGGAGTAGGAAGAGGG + Intronic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098890195 12:76002446-76002468 CATTGCATGGAGAAAGAAACAGG + Intergenic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1101594226 12:106149471-106149493 CAGGGCAGGGAGAAGGAAGGCGG + Intergenic
1101843621 12:108344701-108344723 CAGGGCAGGGAGAAGGCAGTGGG + Intergenic
1102003865 12:109576148-109576170 GAGTGCAAGGAGGAGAAACCAGG + Intronic
1102419355 12:112791697-112791719 CAGTGCAGGGGGAACCAAGCGGG - Exonic
1102819340 12:115894685-115894707 CAGAGCAAGGGGGAGGCAGCAGG + Intergenic
1102819365 12:115894848-115894870 CTGAGCAAAGAGAGGGAAGCAGG + Intergenic
1103019501 12:117522575-117522597 CACTGCAAGGACATGGATGCAGG - Intronic
1103402577 12:120653373-120653395 CACAGTATGGAGAAGGAAGCTGG + Intronic
1103477902 12:121232236-121232258 CTGTGCAAGCAGGAGGATGCGGG - Intronic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104607109 12:130198243-130198265 CAGTGCAGGGAGGAAGATGCTGG + Intergenic
1106101739 13:26699195-26699217 AGGTTCAAGGAGAAGGAAACAGG - Intergenic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1108008144 13:45973862-45973884 AAATGTAAGGAGAGGGAAGCAGG + Intronic
1110199277 13:72829720-72829742 CTGGGCAAGAAGAAGAAAGCTGG - Intronic
1112124285 13:96447558-96447580 AAGGGCAAGAAGAAGGCAGCAGG - Intronic
1112572832 13:100609118-100609140 CAATGCAATCAGAAGGAAGGAGG - Intronic
1112832510 13:103471128-103471150 CAGTGCAATAAGAATAAAGCAGG - Intergenic
1113096233 13:106666884-106666906 CAGTGCAGGTAGAATAAAGCAGG - Intergenic
1114571747 14:23674104-23674126 AAGTGCAAAGAGAAGGCATCAGG - Intergenic
1114790787 14:25656010-25656032 CAGTGGAAGTAGAATAAAGCTGG + Intergenic
1115028124 14:28766414-28766436 CAGTACAATGAGGAGGAAGCCGG + Intergenic
1115305258 14:31927372-31927394 CAGTGGAAGGAGAAGGAGTTGGG - Intergenic
1117778948 14:59212564-59212586 CAGTGGAAGGAATAGGAAGTGGG - Intronic
1118072991 14:62266292-62266314 CTGTGGAAGGAAAAGGAAGGAGG - Intergenic
1118868986 14:69726117-69726139 CATAGCAAGGAGAAGAAAGGCGG + Intergenic
1119072442 14:71600536-71600558 CAGAGCAAAAAGAATGAAGCTGG - Intronic
1119443776 14:74647303-74647325 CAGAGGAAGGAGAAGGGAGTCGG - Intergenic
1119567074 14:75637842-75637864 TAGTGCAGGGAGAAGAATGCAGG + Intronic
1119701008 14:76754724-76754746 CAGTGCATGGAGAAAAACGCTGG + Intergenic
1119829259 14:77686479-77686501 TAGTGCCTGGAGAAGGCAGCAGG - Intronic
1120241405 14:81953624-81953646 TAGTGTAGAGAGAAGGAAGCAGG - Intergenic
1120431327 14:84419369-84419391 CTGTGCAAGGAGAAAGTAGCAGG - Intergenic
1120630261 14:86881810-86881832 CATTTCAAGGTGAAGGAAGATGG + Intergenic
1120913673 14:89690743-89690765 AAGGGCAAAGAGGAGGAAGCAGG + Intergenic
1120974104 14:90233993-90234015 CATAGCAAGGAAAAGGGAGCAGG + Intergenic
1121686655 14:95840403-95840425 CCGAGCCAGGAGAAGTAAGCTGG + Intergenic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1122272912 14:100576347-100576369 CAGTGCATGGAGGAGGAGGGAGG - Intronic
1122799702 14:104223414-104223436 CAGAGAAAGGAGGAGGCAGCTGG - Intergenic
1124947997 15:34288424-34288446 CTGTGCAAGAAGAACAAAGCTGG - Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1127173432 15:56328077-56328099 CCTTACAAGCAGAAGGAAGCGGG - Intronic
1127530516 15:59839164-59839186 CAGAGCAGTGTGAAGGAAGCTGG - Intergenic
1127723042 15:61721484-61721506 CAGGGAAAGGAGAAGACAGCTGG + Intergenic
1127973902 15:63983335-63983357 CAGTTTCAGGAGGAGGAAGCGGG + Intronic
1128080765 15:64855536-64855558 AAGTGCAAGGGGAGGAAAGCTGG - Intronic
1128349133 15:66877488-66877510 CAGAGACAGGAGAAAGAAGCAGG + Intergenic
1128609869 15:69064967-69064989 CAGTGTTTGGAGAAGGATGCAGG - Intergenic
1128756748 15:70188399-70188421 CAGTGCCAGGAGCAAGATGCTGG + Intergenic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129071682 15:72956700-72956722 TTGGGAAAGGAGAAGGAAGCAGG - Intergenic
1129411297 15:75352007-75352029 GGGTGCAAGGGGAAGGAAACTGG - Intronic
1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG + Intronic
1130254721 15:82320612-82320634 CAGGGTCAGGAGAAGAAAGCTGG - Intergenic
1130408507 15:83624421-83624443 AAGCGCAAAGAGCAGGAAGCGGG + Intergenic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1130600252 15:85269394-85269416 CAGGGTCAGGAGAAGAAAGCTGG + Intergenic
1130727336 15:86452849-86452871 CAGGGCAAAGAGAATGAATCTGG - Intronic
1131086186 15:89577364-89577386 AAGTGCAATGAGAAGGATGAAGG - Intronic
1132397356 15:101483718-101483740 GACTGGAAGGAGAAAGAAGCAGG + Intronic
1132752451 16:1465048-1465070 GAGTGCAGGGCGCAGGAAGCCGG - Intronic
1133046053 16:3088978-3089000 AAGTGGAAGGAGAGGGAAGTGGG + Exonic
1133200370 16:4200510-4200532 GAGTGCAGGGGCAAGGAAGCGGG + Intronic
1133759279 16:8785475-8785497 CAGTGTAAGGAGCAGGACGTGGG + Intronic
1133893310 16:9902317-9902339 CATTGCAACTAGAAGGAAGGAGG - Intronic
1134469761 16:14513594-14513616 CAGGGGAGGGAGCAGGAAGCTGG - Intronic
1134840721 16:17399433-17399455 CAGTGTAATGAGGAGGGAGCAGG - Intronic
1135620297 16:23950000-23950022 CAATGCAAGGAGAGGGAAGGAGG - Intronic
1135793647 16:25421485-25421507 CTGGGCAGGGAGAAGGAAGAGGG + Intergenic
1135857998 16:26029760-26029782 CAGTTCCAGGAGAAGGGTGCTGG + Intronic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1136267198 16:29128746-29128768 CAGTGGAGGGGGAAGGAGGCTGG + Intergenic
1137762582 16:50952568-50952590 CAAGGCCAGGAGCAGGAAGCTGG + Intergenic
1137876299 16:51999605-51999627 CATTTCAAGGAGAAGGAAGGGGG - Intergenic
1138445261 16:57059374-57059396 CAGGGCACAGAGAGGGAAGCGGG - Intronic
1139654390 16:68378529-68378551 GACTGCAGGGAGAAGGAGGCAGG - Intronic
1141686063 16:85570669-85570691 CAGGGCAAGGAGAACAAAGTTGG - Intergenic
1141985152 16:87575170-87575192 CAGTGCAGGGAGGAGGGAGCAGG - Intergenic
1142070490 16:88089069-88089091 CAGTGGAGGGGGAAGGAGGCTGG + Intronic
1143382821 17:6507120-6507142 CAGGGGAAGGAGAAGAAAGCTGG + Intronic
1143586127 17:7851422-7851444 CAGAGGGAGGGGAAGGAAGCAGG - Intronic
1143592558 17:7894379-7894401 CGGTGGAGGGATAAGGAAGCAGG - Intronic
1143712284 17:8743226-8743248 CAGTGCAAGGACAAGGATGGAGG + Intronic
1143831637 17:9656675-9656697 CACAGCTAAGAGAAGGAAGCAGG - Intronic
1143881786 17:10035500-10035522 CAGTGCCAGGGGAAGGGAGATGG - Intronic
1144702044 17:17346476-17346498 CAGGGCACGGAGAGGGAAGTCGG + Intronic
1144814759 17:18026201-18026223 TATTGCAAGGACAAGGAAGGTGG - Intronic
1145309058 17:21691601-21691623 CAGTGCCTGGAGAGTGAAGCTGG + Intergenic
1145798608 17:27669772-27669794 CAGGGCCAAGAGGAGGAAGCAGG + Intergenic
1145839609 17:27983549-27983571 CAGTTCAGGAAGAAAGAAGCAGG + Intergenic
1146809338 17:35890757-35890779 CAGTGCAAGGTGACAGAAGAGGG - Intergenic
1147165689 17:38592054-38592076 CAGGGCAGGGAGGAGGAAGTAGG - Intronic
1147353244 17:39868462-39868484 CAGGGCGAGGCGAAGGAGGCAGG - Intronic
1147937788 17:44023536-44023558 CAGAGCAAGGTCAAGGCAGCTGG - Intronic
1148205145 17:45775293-45775315 CAGTCCATGGTGAAGGAAGTAGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148995822 17:51708711-51708733 CAGTGCAGGTAGAATAAAGCAGG + Intronic
1149998249 17:61416240-61416262 CAGTGCCAGGCTAAGGAGGCTGG - Intergenic
1150128675 17:62654343-62654365 CATTCCAAGGACAAGGAAGGCGG - Intronic
1151161799 17:72172211-72172233 CAGAGCAAAGAAAAGGAAACTGG - Intergenic
1151315596 17:73320147-73320169 CAGTAAAAAGAGAAGGAAGGAGG - Intergenic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1151915008 17:77111482-77111504 CAGTGCAAGCAGCCGGCAGCCGG + Intronic
1153096981 18:1418286-1418308 CAGAGAAATGAGAAGGGAGCTGG + Intergenic
1153736142 18:8069836-8069858 AAGTGCGAGAAGAAGTAAGCTGG + Exonic
1153778982 18:8477950-8477972 CAGTGGAAGCAGCAGGAAGGTGG + Intergenic
1154047761 18:10922739-10922761 GAGTGCATGGAGAGGCAAGCTGG + Intronic
1154173171 18:12065544-12065566 GAGTGCATGGAGAGGCAAGCTGG - Intergenic
1155108449 18:22689900-22689922 CACTGCAGGGAGCAGGAAGCAGG + Intergenic
1155171143 18:23267586-23267608 CAGTGCAGGGAGTGGGCAGCCGG - Intronic
1155191801 18:23437127-23437149 TTTTGCAAGGAGAGGGAAGCTGG - Intronic
1156473963 18:37394262-37394284 CAGAGCAGGGAGAGGGACGCGGG + Intronic
1156952272 18:42916862-42916884 GAAAGGAAGGAGAAGGAAGCAGG + Intronic
1156965379 18:43085046-43085068 GAGTAGAATGAGAAGGAAGCGGG + Intronic
1157289231 18:46398310-46398332 CAGGGCAGGAAGAAGGAAGCAGG + Intronic
1157879589 18:51307915-51307937 CAGTGGAAGGGGAAGCAAACAGG + Intergenic
1158249132 18:55467265-55467287 AAGTTCAAGGAGAGGGAAGATGG - Intronic
1158622178 18:59042403-59042425 CAGTGCTAAGAGGAGGAAGCAGG - Intergenic
1158735982 18:60080054-60080076 CTGAGCAAAGAGAACGAAGCTGG + Intergenic
1158962975 18:62601666-62601688 CAGGGCGAGGAGAGGGCAGCTGG + Intergenic
1159151601 18:64530163-64530185 CAGTGCAGGTAGAATAAAGCAGG - Intergenic
1159783786 18:72690745-72690767 AAGTAGAAGCAGAAGGAAGCAGG + Intergenic
1159810720 18:73015428-73015450 CACTGAAAGGAGAAGCTAGCAGG - Intergenic
1160912472 19:1481324-1481346 CAGTCCATGGAGAATGCAGCCGG - Intergenic
1162497399 19:11030913-11030935 CAGGTCGAGGAGAAGGAAGGGGG + Intronic
1162543109 19:11310223-11310245 AAGTGCAGGAAGAAGGAAGAAGG + Intronic
1162765013 19:12913911-12913933 ATGTGCGAGGAGAGGGAAGCTGG + Intronic
1163241338 19:16065722-16065744 CATGACAAAGAGAAGGAAGCTGG + Intergenic
1163334246 19:16660913-16660935 CCGTGCAAGGCGAGGGAGGCTGG - Intergenic
1163902542 19:20117452-20117474 CAGAGCCAGAAGAAGGAAGGAGG - Intronic
1164896654 19:31882859-31882881 GTGAGCAAGGAGAAGGCAGCTGG - Intergenic
1164968568 19:32509915-32509937 CAATGTCAGGGGAAGGAAGCTGG + Intergenic
1165730792 19:38143370-38143392 CACTGCAAGGAGGAGGAGGAAGG - Intronic
1165804549 19:38572607-38572629 AGGTGCAAGGAGGTGGAAGCAGG - Intronic
1166103624 19:40586700-40586722 CAGGGCAGGGAGAAAGAAACAGG - Intronic
1166184230 19:41128958-41128980 CACTGCAGAGAGATGGAAGCAGG + Intergenic
1166264559 19:41670880-41670902 AAGTGCAATGAGAAGGAAATAGG - Intronic
1166273561 19:41734561-41734583 AAGTGTAATGAGAAGAAAGCAGG + Intronic
1166278630 19:41774404-41774426 AAGTGTAATGAGAAGGAAGTAGG + Intergenic
1166397938 19:42456163-42456185 TAGTGTGATGAGAAGGAAGCAGG - Intergenic
1166776949 19:45318794-45318816 CATTGCAAGGCGAAGAGAGCTGG - Intronic
1168471524 19:56644046-56644068 CAGTGAATGGAGGAGGAAGAAGG - Intronic
925174486 2:1772502-1772524 CAGTGTAAGGAACTGGAAGCTGG - Intergenic
925198456 2:1947015-1947037 CTGATGAAGGAGAAGGAAGCTGG - Intronic
925673647 2:6337798-6337820 CAGTGCAAGGAAATTGAGGCGGG - Intergenic
927562810 2:24085301-24085323 CAGCCCCAGGAGAAGGATGCTGG + Intronic
927593063 2:24373428-24373450 GAGTGCAATCTGAAGGAAGCAGG + Intergenic
928859466 2:35839455-35839477 CATTGCAAGGACAAGGCTGCAGG - Intergenic
929818054 2:45251613-45251635 CAATGAAAGGAGAAGGAGGTTGG - Intergenic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
930701144 2:54457894-54457916 CAGTGCAGGCAGAGGGGAGCCGG + Intronic
931340744 2:61398506-61398528 CAGGGGAAGGAGGCGGAAGCGGG + Intronic
931691470 2:64837990-64838012 AAGGGAAAGGAAAAGGAAGCAGG + Intergenic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
932356455 2:71071975-71071997 CAGAGCAAGGACCAGGCAGCAGG + Intronic
932412265 2:71554520-71554542 CAGTGCAAGGAGATGGGGGGTGG + Intronic
932583074 2:73005133-73005155 AAGTGGAAGGAGAGGGAAACAGG + Intronic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
933951908 2:87338348-87338370 CAGTGCAGAGAGGAAGAAGCAGG + Intergenic
934134150 2:88979124-88979146 CAGTGCAGAGAGGAAGAAGCAGG - Intergenic
934139087 2:89027824-89027846 CAGTGCAGAGAGGAAGAAGCAGG - Intergenic
934145158 2:89085831-89085853 CAGTGCAGAGAGGAAGAAGCAGG - Intergenic
934224094 2:90114724-90114746 CAGTGCAGAGAGGAAGAAGCAGG + Intergenic
934236150 2:90234682-90234704 CAGTGCAGAGAGGAAGAAGCAGG + Intergenic
935187321 2:100745879-100745901 CACTGGAAGAAGAAGGAAGCTGG + Intergenic
935785534 2:106545202-106545224 CAGTGAAAGGAGACGGTGGCAGG - Intergenic
936065471 2:109328876-109328898 CAGAGCATGGAGAAGGCAACTGG - Intronic
937505147 2:122528354-122528376 CAGGGACAGGAGAAAGAAGCTGG + Intergenic
938231563 2:129665690-129665712 CAGTGCTAGGACAATGGAGCTGG + Intergenic
938663011 2:133506519-133506541 CAGTGTGAGGAGAATGAAGTGGG + Intronic
938692663 2:133806627-133806649 TATTGCAAGGATAAGGAAGGTGG + Intergenic
939199800 2:139019003-139019025 AGGTTGAAGGAGAAGGAAGCTGG - Intergenic
939257785 2:139766696-139766718 CAGTGCAGGCAGAAGGAAGTGGG + Intergenic
939832495 2:147089373-147089395 CAGTGCAACTAGAACAAAGCAGG - Intergenic
940133710 2:150412624-150412646 CAGACCAAGGAGGAGCAAGCTGG + Intergenic
940687856 2:156876441-156876463 TACTGAAAGGAGAAGGAAGAAGG - Intergenic
940716492 2:157230848-157230870 GTGTGCAAGGAGAAGGAAGCAGG - Intergenic
943162808 2:184277512-184277534 CTGTGCATTGTGAAGGAAGCAGG + Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944207421 2:197171244-197171266 GAGTGATGGGAGAAGGAAGCTGG + Intronic
944338331 2:198564997-198565019 CAGTGCAGTGAGAACAAAGCAGG + Intronic
944401544 2:199332365-199332387 CAGTGGAAAAAGAAGGAAGTTGG + Intronic
944662369 2:201931916-201931938 CAATGCAAGGAGAAAGCATCAGG - Intergenic
944818918 2:203409137-203409159 CAGTGAAAAGAGAAGGTAGTTGG - Intronic
945010689 2:205459917-205459939 CACTGCCAGGAGAAAGAAGCTGG - Intronic
945743381 2:213690650-213690672 CAGTGCAGGTAGAACAAAGCAGG + Intronic
946496703 2:220202684-220202706 CTCTTCAAGAAGAAGGAAGCTGG - Intergenic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
946931468 2:224675702-224675724 GAGAGCAAGGAGAAGGCAGAGGG + Intergenic
948028839 2:234800144-234800166 CAGAGCAAGGAGGATGGAGCTGG + Intergenic
948029057 2:234801421-234801443 CAGTTTGAGGAGAAGGGAGCAGG - Intergenic
948692937 2:239718431-239718453 CAGGGCCAGGAGAAGGGAGATGG - Intergenic
1168916333 20:1491291-1491313 CAGTGCCAGCAGCAGGAAGCAGG + Exonic
1169623254 20:7532024-7532046 GAGAGAAAGGAGAAGGAAACTGG + Intergenic
1170120151 20:12902578-12902600 CATTGAAAGGTGGAGGAAGCAGG - Intergenic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170528280 20:17262942-17262964 GACAGGAAGGAGAAGGAAGCTGG - Intronic
1170829905 20:19830971-19830993 CTGTGGAATGGGAAGGAAGCAGG - Intergenic
1172765982 20:37351129-37351151 CAGAGCAAGGAGTAGGGAGATGG - Intronic
1172882116 20:38208866-38208888 CAGTGCACAGAGAGGGAAGCAGG + Intergenic
1172906103 20:38370711-38370733 AAATGCCAGAAGAAGGAAGCAGG - Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173900384 20:46583447-46583469 CAGTGAAAGGAGAAGCAGGAAGG + Intronic
1174402766 20:50284825-50284847 CTGTGCAGGCAGCAGGAAGCTGG - Intergenic
1174758180 20:53180622-53180644 CAGTGTTAGGAGAAGGATGTTGG - Intronic
1175140451 20:56857025-56857047 AAGGGAAAGGAGAAGGGAGCGGG + Intergenic
1176281938 20:64318252-64318274 CAGAGAAAGGAAAAGGAACCGGG + Intergenic
1177216020 21:18130042-18130064 CGGAGCAAGGAGAAGGAATAGGG + Intronic
1178929258 21:36803300-36803322 GAGACCATGGAGAAGGAAGCTGG - Intronic
1180018573 21:45104143-45104165 AAGTGGAAGGAGAGGGTAGCAGG - Intronic
1180025375 21:45158173-45158195 CTGTGCAGGGTGCAGGAAGCTGG - Intronic
1180954015 22:19733402-19733424 CAGTGCGGGGAGGAGGGAGCTGG - Intergenic
1181349447 22:22244729-22244751 CAGAGCAGGGAGGAGGATGCTGG + Exonic
1181891087 22:26064156-26064178 CAGAGCACGGAGCATGAAGCAGG + Intergenic
1182277522 22:29200125-29200147 CAGTGGGAGGACAAGCAAGCTGG + Intergenic
1183061837 22:35340889-35340911 CAGGGCAAGGTGGAGGACGCTGG + Intronic
1183226748 22:36555613-36555635 AAGGGCAAGGAGAAGGAAAAGGG - Intergenic
1183499801 22:38171993-38172015 CAGAGCAAGGAGAGAGAACCTGG - Intronic
1183589263 22:38770381-38770403 CAGTGCAGTGAGAAGCAAGGGGG - Intronic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1185019582 22:48366430-48366452 CATTGCAATGGCAAGGAAGCTGG - Intergenic
951636716 3:24786814-24786836 CAGTAAAGGGAGAAGGAAACAGG - Intergenic
951699408 3:25479893-25479915 CAGTGCAATAACGAGGAAGCTGG + Intronic
952275554 3:31872299-31872321 CAGAGCAAGGACAAGAAAGCAGG + Intronic
952880216 3:37980711-37980733 CAGTGCATGGAGGAGGCAGCAGG - Intronic
953013889 3:39053850-39053872 CAGTGCACGTAGAATGAGGCAGG + Intronic
954718217 3:52537722-52537744 CAGTGCTGTGAGAAGGAAGTGGG + Intronic
954911460 3:54114263-54114285 AACTCCAAGGAGAAGGAGGCTGG + Intergenic
955709624 3:61764652-61764674 CATTGCAGGTAGAGGGAAGCGGG + Intronic
955788931 3:62568373-62568395 CAGTGCAGCTAGAACGAAGCAGG + Intronic
957951425 3:87132188-87132210 CAGTGCAACTAGAATAAAGCAGG - Intergenic
959254927 3:103997296-103997318 CAGTGCAGAGAGAAGGCAGAAGG + Intergenic
959907636 3:111728314-111728336 CAGTGGAAGGTCAAGGCAGCTGG + Intronic
960254688 3:115499353-115499375 CAGGGCAAGGAAAAGGCAGTGGG + Intergenic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
961058389 3:123808125-123808147 CAGTGAAGGGTGAAGGAGGCTGG - Intronic
961959673 3:130841705-130841727 CTCTGCAGGGAGAAGGAAGCAGG + Intergenic
962480375 3:135792813-135792835 CAGTGGAAGATGAGGGAAGCTGG - Intergenic
963358809 3:144244542-144244564 TTGTGGAAGAAGAAGGAAGCAGG + Intergenic
964207441 3:154190058-154190080 CCATGAAGGGAGAAGGAAGCAGG - Intronic
967073707 3:185983677-185983699 TAGTGGTGGGAGAAGGAAGCTGG - Intergenic
967387234 3:188923770-188923792 AAGTGGAAGGAAAAGCAAGCAGG + Intergenic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968075969 3:195816307-195816329 CTGTGTAAGGAAAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076255 3:195817343-195817365 CCTTGTAAGGAGAAGGAGGCCGG - Intergenic
968076293 3:195817475-195817497 CTGTGTAAGGAGAACGAGGCCGG - Intergenic
968181910 3:196601681-196601703 AAGGGAAAGGAGGAGGAAGCTGG - Intergenic
968199534 3:196740208-196740230 CAGGCCACGGAGAAGGAAGGAGG - Intronic
968772202 4:2514587-2514609 CTGTGCCAGGTGAAGGACGCTGG - Exonic
969164931 4:5299293-5299315 CAGTGAAAAGGGAAGGAAACAGG + Intronic
970356268 4:15256293-15256315 CAGGTCAAGGAGAAGGAATGAGG - Intergenic
970754579 4:19409717-19409739 CAGTCTCAGGAGAAGAAAGCTGG - Intergenic
971136681 4:23876641-23876663 CAGTTCAAGGAGGAGCAATCAGG - Intronic
971296876 4:25401603-25401625 CAGTGCACGGAGAGGGCAGCTGG - Intronic
971327243 4:25654743-25654765 CTGTGCAAGGGGAAGGACTCGGG - Intergenic
971375246 4:26050907-26050929 CAGTGGAAGCATGAGGAAGCTGG - Intergenic
973765973 4:54163242-54163264 GAGGGGAAGGAGAAGGAAGTGGG - Intronic
973864675 4:55100108-55100130 GAGTGCAAGGAGAATCAAACCGG + Intronic
973884859 4:55310281-55310303 CAGTGAAAAGAGAAAAAAGCAGG + Intergenic
974022707 4:56705969-56705991 TAGGGCAAGAAGCAGGAAGCTGG - Intergenic
974348443 4:60713329-60713351 CAGTGAAAGGAAAAGGAAACAGG + Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976971947 4:91114618-91114640 AACTGCAAAGAGCAGGAAGCAGG - Intronic
977005868 4:91569233-91569255 CAGAGCAATGAGAAGGAACATGG - Intronic
978672494 4:111267218-111267240 AATTGCAAAGAGAAAGAAGCTGG + Intergenic
978915925 4:114125858-114125880 CAGTGCCAGAAGAAGAAAGCAGG + Intergenic
979134401 4:117090934-117090956 CTGTCCAATGACAAGGAAGCAGG + Intergenic
979443697 4:120784467-120784489 CAGCGCAAGGAGTAGCAAACAGG - Intronic
980108179 4:128608255-128608277 GAGTGCAAGGACAAGGGACCTGG + Intergenic
980453291 4:133005548-133005570 AGGTGGAAGGATAAGGAAGCAGG + Intergenic
981157967 4:141462347-141462369 CAGTGCATGGGGAAGAAACCAGG + Intergenic
981521145 4:145663643-145663665 CAGTGAATGGAGAAGGGAGTGGG + Intergenic
981532595 4:145766505-145766527 CATTGCAGAGAGAAGGAACCAGG + Intronic
981817098 4:148843097-148843119 CAGGAAGAGGAGAAGGAAGCAGG - Intergenic
982013163 4:151126417-151126439 CAGTGCTAGAAGAAGGAGGGTGG - Intronic
983038337 4:162894593-162894615 CCGTTCCAGGAGAAAGAAGCTGG - Intergenic
985390378 4:189486282-189486304 CAGTGCAAGAAGAAAGAAAGAGG + Intergenic
985751339 5:1678761-1678783 CTGAGCAAAAAGAAGGAAGCTGG - Intergenic
986129375 5:4912731-4912753 GAGAGAAAGGAGAAGGAAGAAGG + Intergenic
988005235 5:25402103-25402125 CAGTGCATGTAGAATAAAGCAGG + Intergenic
989280597 5:39638481-39638503 GAGAGCTTGGAGAAGGAAGCAGG - Intergenic
990893746 5:60675128-60675150 CACTGCCAGGGGTAGGAAGCAGG + Intronic
991674336 5:69076252-69076274 GAGTGTCTGGAGAAGGAAGCAGG - Intergenic
992258664 5:74948199-74948221 CACTGCAAACAGGAGGAAGCAGG + Intergenic
992518802 5:77525619-77525641 CCCTGCAAGGTGAAGGAAGAGGG - Intronic
992846442 5:80753832-80753854 CAGTGGAAGGAGAAAGAACAGGG + Intronic
993430533 5:87827168-87827190 CAGTTCAAGGTGAGGGAGGCAGG + Intergenic
993836137 5:92822440-92822462 AAGGGCAAGGAGAAGAGAGCTGG + Intergenic
994438153 5:99764072-99764094 CTGTGGAAGGAGAGAGAAGCAGG - Intergenic
995093498 5:108208752-108208774 CTGTGCAAGAAGAACAAAGCTGG - Intronic
996434105 5:123415159-123415181 GAATGCAAGGAGCAGGAAGCAGG + Intronic
997632541 5:135379721-135379743 CACTGAAAGGAGAAGGAAGAAGG - Intronic
998038775 5:138937721-138937743 GAGTGCAGGGAGTAGGGAGCAGG - Intergenic
998138546 5:139687315-139687337 CTGTGCAGGAAGAAGGAAGAAGG + Intergenic
999701806 5:154235095-154235117 CTGTGGAAGGACAAGGAACCTGG + Intronic
999717319 5:154371742-154371764 CAATGCAAGGAGAATGGGGCAGG - Intronic
999734655 5:154503824-154503846 CAATGCAAGGAGAGGAAAGAAGG + Intergenic
1000042040 5:157491938-157491960 CAGTGCAATGGGAGGGATGCTGG + Intronic
1001699134 5:173694164-173694186 CAGTGCATGGAGGAGGACTCAGG - Intergenic
1002290059 5:178194292-178194314 CTGTGCAGGGAGAAGGGAGGTGG + Intergenic
1002295751 5:178230237-178230259 CAGAGCAGGGAGAGAGAAGCTGG + Intronic
1002845760 6:942933-942955 CAGTGCAAAAAGAATGCAGCAGG + Intergenic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004177731 6:13354734-13354756 CAAGGGAAGGAGAAGGGAGCAGG - Intergenic
1005009130 6:21319345-21319367 CTGGGCAAGAAGAACGAAGCTGG + Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005083678 6:21981824-21981846 CAGTGCAGGAAGGAGGAGGCAGG - Intergenic
1005396942 6:25392566-25392588 CAGTCCAGGAAGAAGCAAGCAGG - Intronic
1006264931 6:32913022-32913044 CATTGCAAGGAGAAGAAATTGGG + Intergenic
1006598212 6:35208951-35208973 CAGTGGAGAGAGAAGGGAGCAGG + Intergenic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1008966908 6:57322043-57322065 CAGTGGTTGGAGAAGGAAGGTGG + Intronic
1009412057 6:63377469-63377491 AAGTGCAAGGATAAAGAAGCAGG + Intergenic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010022064 6:71171872-71171894 CAAGGCAAGCAGAAGGAAGAAGG - Intergenic
1011261252 6:85472118-85472140 CAGTGCAAGGTGGGGGAAGTGGG - Intronic
1012861520 6:104565830-104565852 GAGTGGAAGAAGAGGGAAGCAGG - Intergenic
1013482806 6:110566661-110566683 CAGTGCCCTGAGATGGAAGCAGG - Intergenic
1013487796 6:110614662-110614684 GAGTGCTAGGAGAAGGAAACAGG + Exonic
1013575018 6:111474340-111474362 CAATGAGAGGACAAGGAAGCAGG - Intronic
1014066026 6:117126591-117126613 CAGTGAAAGGATATGGAGGCTGG + Intergenic
1014075312 6:117228490-117228512 CAGTCCTATAAGAAGGAAGCTGG + Intergenic
1014298078 6:119644767-119644789 CAGTACAAGTAGAAGGAAAGTGG - Intergenic
1015058055 6:128928549-128928571 CCGTTCAAGGAGAGGGAAGGAGG + Intronic
1015555768 6:134459842-134459864 CAGTGAGTGCAGAAGGAAGCGGG - Intergenic
1015841062 6:137477849-137477871 CATTGCACAGAGAAGGAAACAGG + Intergenic
1016100887 6:140098745-140098767 AAGTGCAGGGGGAAGGGAGCAGG + Intergenic
1016190066 6:141254345-141254367 CAGTGCAACTAGAACAAAGCAGG + Intergenic
1016763527 6:147767257-147767279 CTGTGGAGGAAGAAGGAAGCAGG + Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017702893 6:157093067-157093089 CAGCGAAGGGAGAAGGCAGCGGG - Intronic
1017852202 6:158314490-158314512 CAGTGCAGGGAGAGGACAGCAGG - Intronic
1017927406 6:158922283-158922305 CCGAGCCAGGAGGAGGAAGCCGG - Intergenic
1018181773 6:161229535-161229557 TAGAGCAAGGAAAAGGAACCAGG + Intronic
1018346878 6:162908857-162908879 CAGCACAGGGAGATGGAAGCTGG + Intronic
1018371308 6:163170661-163170683 CAGTGCAAGGTGGGGGAAGCTGG - Intronic
1019659546 7:2216358-2216380 CACGGCTAAGAGAAGGAAGCCGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020803172 7:12756842-12756864 CTGGGAAAGGAGAAGGAAACTGG + Intergenic
1021504944 7:21371868-21371890 CATTGCAAGGAGAGAGAACCGGG - Intergenic
1021808849 7:24382998-24383020 CAGGGCAAGTACAAGGAAGCAGG + Intergenic
1021849296 7:24791896-24791918 TAGTGTTGGGAGAAGGAAGCTGG + Intergenic
1022022087 7:26410361-26410383 CAGTGTAAGAAGAAAGAACCAGG - Intergenic
1022043595 7:26604037-26604059 AAGAGCAAGGAGCAGGAATCTGG + Intergenic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022319980 7:29279027-29279049 CATTGCAGAGAGAAGGAAGCAGG - Intronic
1023027456 7:36063628-36063650 CTGTGGATGGAGCAGGAAGCAGG + Intergenic
1023753772 7:43396842-43396864 CCGTCCAAGGACAAGGAAGTCGG + Exonic
1024839701 7:53571652-53571674 CAGACCCAGGAGAAGGAAGAGGG - Intergenic
1024878110 7:54050219-54050241 TAGTGCAATGAGTAGGAAGTAGG - Intergenic
1026959480 7:74399239-74399261 CAGTGTAAGAAGAAGGGTGCTGG + Intronic
1028399037 7:90404668-90404690 CGGTGAAAGGATAAGGAAGGTGG - Intronic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1029957013 7:104650789-104650811 CAATGACAGGAGAAGGAAACAGG + Intronic
1030576891 7:111298868-111298890 CAATGCAAGAAGAAGAATGCAGG + Intronic
1032130340 7:129222802-129222824 CCTGGCAAGGAGAAGGAAGGAGG - Intergenic
1032222574 7:130005891-130005913 CAGTGGAAGGGGAAAGCAGCTGG - Intergenic
1032402532 7:131633760-131633782 CAGTGCTTGGAGGAGGATGCTGG - Intergenic
1033378744 7:140791236-140791258 CAGTAAGAGGAGAAGGCAGCAGG - Intronic
1033426888 7:141252881-141252903 CAGGGCAAGGAGAATGGAGCTGG - Intronic
1033460054 7:141538726-141538748 GAATGCAAGGAGAAGAAAGGGGG + Intergenic
1033869094 7:145728132-145728154 GGGTTCAAGGAGAAGGAAGGGGG + Intergenic
1034298259 7:149993090-149993112 CAGTGCAGGCAGAACAAAGCAGG - Intergenic
1034468510 7:151243682-151243704 CAGTGCCAAGAGGAGGAAGATGG - Exonic
1034807759 7:154103693-154103715 CAGTGCAGGCAGAACAAAGCAGG + Intronic
1035100500 7:156392333-156392355 CATTCCAGGGAGGAGGAAGCTGG + Intergenic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035154123 7:156898325-156898347 CAGTGCAAGGTGAAGTGAGCCGG - Intergenic
1035669826 8:1408853-1408875 CAGGGCACAGAGAAGAAAGCTGG + Intergenic
1036768820 8:11565266-11565288 GGGTTCAAGGGGAAGGAAGCGGG - Intergenic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1038259600 8:25981296-25981318 CAGTGCTAGGTGAGGGAAGATGG - Intronic
1038552324 8:28480923-28480945 GAGAGCAAAGAAAAGGAAGCAGG + Intronic
1039904117 8:41773722-41773744 CAGTGCATGCAGGAGGGAGCGGG - Intronic
1040982829 8:53262917-53262939 CAGTGCAAGCAAAAGGGACCTGG + Intergenic
1041289421 8:56294625-56294647 CAGGGCAGTGAGAAGGGAGCAGG + Intergenic
1041306011 8:56461735-56461757 CTGTGAAAGTAGAAGGAAGTGGG - Intergenic
1041456631 8:58067459-58067481 CAGTGGATGGAGGAGGAAGGAGG - Intronic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042666321 8:71210471-71210493 CAGTGCCAGGCTAAGGAAGGTGG + Intronic
1043836455 8:85052737-85052759 CAGGGCAAGAAGAACAAAGCTGG + Intergenic
1044973003 8:97638188-97638210 CAGTGGAAGGAGAAGGAACTAGG + Intergenic
1045046040 8:98279517-98279539 CAGTGAAAGGACAGGGAAGTGGG - Intronic
1045105388 8:98887760-98887782 CAGAGCAAGGAGCAGTCAGCAGG + Intronic
1045981165 8:108189685-108189707 CAGTTTATTGAGAAGGAAGCAGG - Intergenic
1047177439 8:122554949-122554971 CACTGCAAGGTTAAAGAAGCTGG - Intergenic
1047367222 8:124222648-124222670 CAGTGGAAGGAGAGGGTAACAGG - Intergenic
1047446863 8:124927617-124927639 CAAAGGAAGGAGGAGGAAGCCGG + Intergenic
1048282313 8:133114417-133114439 CAGTACTAGGAGAGGGAGGCAGG - Intronic
1049417308 8:142500974-142500996 CAGTGCAAGCAGAACCAGGCTGG - Intronic
1050222791 9:3413619-3413641 CAGAGCAAGGAGAAAGAAACAGG - Intronic
1050456798 9:5842130-5842152 CAGTGCAAGGGGACTGGAGCAGG + Intergenic
1051596129 9:18825971-18825993 CAGTACAAAGAGGAGGAAACAGG - Intronic
1052040723 9:23735875-23735897 CAGAGCAAGGAGAGGAAAACAGG + Intronic
1052348023 9:27429609-27429631 TAGTGGCAGGAGGAGGAAGCTGG + Intronic
1053480547 9:38413434-38413456 CAGTGGGAGGAGGAGGAAGGAGG - Intronic
1053705429 9:40748406-40748428 TAGTGTCAGGAGAAGGAAGCTGG + Intergenic
1054415504 9:64872013-64872035 TAGTGTCAGGAGAAGGAAGCTGG + Intergenic
1055140896 9:72876008-72876030 CAGTGCAAGGGAGAGGAAACAGG + Intergenic
1055467252 9:76577864-76577886 CAAGGCATTGAGAAGGAAGCTGG - Intergenic
1055737007 9:79341353-79341375 CAGTGCTTGGACCAGGAAGCAGG - Intergenic
1055896960 9:81188233-81188255 CAGTGAAATGAAAAGAAAGCGGG - Intergenic
1056150056 9:83776941-83776963 CAGTGCTATAAGAAGGAAGTAGG + Intronic
1056697695 9:88873921-88873943 CAGGACAAGGAGAATGAAGCAGG - Intergenic
1056729733 9:89155317-89155339 AAGAGCAAGGAGAGAGAAGCCGG - Intronic
1057187084 9:93062995-93063017 CAGTGCCAAGAGTAGGAGGCTGG - Intronic
1057414166 9:94846603-94846625 CTGGGCAAAGAGAAAGAAGCTGG + Intronic
1058345046 9:103951011-103951033 CGGTGCAGGGCAAAGGAAGCTGG + Intergenic
1059098024 9:111439894-111439916 CACAGCAAGGAGAAGGAAGGAGG + Intronic
1059214738 9:112550591-112550613 CAGTGCAGGGAAAAGGCAGACGG + Intronic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1061336931 9:129944598-129944620 TAATGCAAGGAGAAGGATACAGG + Intronic
1061386914 9:130295825-130295847 CAGGGCAAGTAGGAGGAAGATGG - Intronic
1062126149 9:134864122-134864144 CAGGGGAGGGAGAGGGAAGCAGG - Intergenic
1062240723 9:135536377-135536399 GACTGCAAGGAGAAGGGGGCGGG - Intergenic
1062344148 9:136107107-136107129 AAGTTCAGGGAGAAGGAACCAGG - Intergenic
1062426932 9:136510445-136510467 AAGTGCAGGGAGGAGCAAGCCGG + Intronic
1185752921 X:2628411-2628433 CAGTGCATGGTGAGAGAAGCAGG + Intergenic
1185889380 X:3810775-3810797 CTGTCCAAGGAGAAGGACCCTGG - Intergenic
1186496800 X:10017136-10017158 CTGTGCAGGTAGGAGGAAGCAGG - Intronic
1187565332 X:20443964-20443986 CATGGCAAGGAGAGGGAAGAAGG + Intergenic
1187688416 X:21839678-21839700 CGGTGCAGGGAGGAGGACGCCGG + Exonic
1188244998 X:27828963-27828985 CACTGCAAGGAAAAAGAAACTGG + Intergenic
1191001968 X:55669771-55669793 CAGGGCAAGAAGAACAAAGCTGG - Intergenic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1193160829 X:78227372-78227394 CTGTGCAAGAAGAAGAAAGCTGG - Intergenic
1193461741 X:81798271-81798293 CAGTGCAACTAGAATAAAGCAGG + Intergenic
1195045305 X:101050036-101050058 CAGAGGAGGGACAAGGAAGCTGG + Intronic
1195520361 X:105822476-105822498 CGGTGCAAGGAGAGGGGACCCGG - Intergenic
1195890252 X:109685660-109685682 CAGTGAAATGAGAAAGAAACTGG + Intronic
1196130134 X:112146590-112146612 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196130138 X:112146609-112146631 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196505537 X:116436740-116436762 AAGTGCAGGGAGAAGGAGGTAGG + Exonic
1197169698 X:123418199-123418221 CATTGAAAGGAGAAGGTAGGAGG - Intronic
1198520667 X:137449246-137449268 CAGTGAAAGGAAAAGGGAGAAGG - Intergenic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1199304513 X:146251699-146251721 CAGTGCAGTTAGAAGAAAGCAGG + Intergenic
1200090295 X:153632850-153632872 AGGTGCCAGGAGAAGGGAGCAGG + Intergenic
1200152008 X:153955774-153955796 CAGGGCAAGGGGAAGGCAGGAGG + Intronic
1201219194 Y:11750251-11750273 CACTGAAAGGAAAGGGAAGCTGG + Intergenic
1201361319 Y:13153069-13153091 CAGTGAGAGGTGAAGGTAGCTGG - Intergenic