ID: 1170350976

View in Genome Browser
Species Human (GRCh38)
Location 20:15440634-15440656
Sequence CAGCATTTAAAGCTGATGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170350976_1170350980 29 Left 1170350976 20:15440634-15440656 CCCTTCATCAGCTTTAAATGCTG 0: 1
1: 0
2: 1
3: 16
4: 175
Right 1170350980 20:15440686-15440708 CTGTGCATATTTACAGAGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 208
1170350976_1170350978 -8 Left 1170350976 20:15440634-15440656 CCCTTCATCAGCTTTAAATGCTG 0: 1
1: 0
2: 1
3: 16
4: 175
Right 1170350978 20:15440649-15440671 AAATGCTGACAGATTTGAGAAGG No data
1170350976_1170350979 25 Left 1170350976 20:15440634-15440656 CCCTTCATCAGCTTTAAATGCTG 0: 1
1: 0
2: 1
3: 16
4: 175
Right 1170350979 20:15440682-15440704 ATTGCTGTGCATATTTACAGAGG 0: 1
1: 1
2: 0
3: 17
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170350976 Original CRISPR CAGCATTTAAAGCTGATGAA GGG (reversed) Intronic
900075158 1:809159-809181 CACAATTTAAAACTTATGAATGG - Intergenic
900248043 1:1648463-1648485 CAGCATGTAAAGATGATGAGAGG - Intronic
900259267 1:1715614-1715636 CAGCATGTAAAGATGATGAGAGG - Intronic
901176246 1:7301662-7301684 CAGTCTTCAAAGATGATGAATGG - Intronic
903294082 1:22332621-22332643 AAGTATTTAAGGCTGATGTAAGG - Intergenic
904108540 1:28106729-28106751 CAGTATTTCAAGCTGCTGATGGG - Intergenic
904124704 1:28229886-28229908 CAGCATTTAAAACTGTTGATGGG + Intronic
906006087 1:42471796-42471818 CAGTATTTATAGATGATAAATGG - Intronic
907570293 1:55477029-55477051 TAGCATTTAAAACTGAAAAAAGG - Intergenic
909651496 1:77980792-77980814 CTGCCTTAAAAGCTGATTAAAGG - Intronic
913073168 1:115319062-115319084 CAGCATTTAAGTCTGACTAAAGG + Intronic
914747949 1:150513131-150513153 GAGCAGTAGAAGCTGATGAAAGG + Intronic
919897269 1:202017089-202017111 CAGTATTTCAAACTCATGAATGG - Intronic
922002094 1:221489377-221489399 CAGGATGTGAAGCTGATGCAGGG - Intergenic
922270997 1:224034058-224034080 CACAATTTAAAACTTATGAATGG - Intergenic
1063360275 10:5448852-5448874 CAGCATTTGGAGGTGATGAAGGG - Intronic
1067142761 10:43670342-43670364 TAGTTTTTAAAGCTGATCAAGGG + Intergenic
1071174162 10:82904448-82904470 CAGCATTTAAACCGGAAGAAAGG + Intronic
1071711946 10:88058702-88058724 CAGCATTTAGAGGTGAGGAGAGG + Intergenic
1072835990 10:98712693-98712715 AAGCATTTAAAGTTGAGCAAAGG - Intronic
1074959278 10:118425504-118425526 AAGCAATTAAAGGTGAAGAATGG + Intergenic
1078232809 11:9458355-9458377 TAACATTTTAAGCTTATGAATGG + Intergenic
1078858491 11:15226027-15226049 CAGCATGTAAAGCTCATAATGGG - Intronic
1079290254 11:19181637-19181659 CTGCTTTTAAAGCTCATGTAGGG + Intergenic
1080480977 11:32650140-32650162 CTGGATTTAGAGCTCATGAAGGG + Intronic
1080678761 11:34453359-34453381 CATCATTTAAGGCCGATGAATGG - Intronic
1082799758 11:57406023-57406045 CAGCGTTTAAATCTAATGGATGG - Intronic
1084418436 11:69048275-69048297 CAGGACTGAAAGATGATGAATGG + Intergenic
1084521620 11:69666664-69666686 CAGCATTAAAAAATGGTGAAGGG - Exonic
1086187109 11:84031607-84031629 CAGCATTGAAAGTTAACGAATGG + Intronic
1086913076 11:92495550-92495572 CAACTTTCAAAGCTGATCAATGG - Intronic
1087007811 11:93486389-93486411 CAGCTTCCAAAGCTGATGAGCGG - Intronic
1087663201 11:101011651-101011673 CAGAATTTAAAGGTGTTGAGAGG + Intergenic
1089008430 11:115112875-115112897 CAGCTGTTAGAGCTGAGGAAGGG - Intergenic
1090260044 11:125312922-125312944 CAGCATTTAAAGATGAACAGAGG + Intronic
1091181262 11:133606529-133606551 AAGCAATTAAAGCTTATAAATGG - Intergenic
1094441608 12:30483932-30483954 CAGGATTTAATCCTGATAAAAGG + Intergenic
1098002820 12:65962874-65962896 CGGTTTTTAAAACTGATGAATGG + Intronic
1098286673 12:68914039-68914061 TAGCATTTATACCTGAGGAATGG - Intronic
1098391715 12:69976850-69976872 CAGCATATCAATCTGATGCATGG + Intergenic
1098751319 12:74296330-74296352 CAGCAGTTAAATCTAATGTATGG + Intergenic
1101707842 12:107237172-107237194 AAGGAGTTAAAGCTGAAGAATGG - Intergenic
1103126829 12:118430677-118430699 CACAATTTAAAACTTATGAATGG - Intergenic
1103694822 12:122806338-122806360 AAGCATTAAAAGCTGGTGAGAGG - Intronic
1104764872 12:131322659-131322681 CATCATTTAAAGTTAAGGAACGG + Intergenic
1105439522 13:20403613-20403635 CAGCATTTGATCCTGATGACCGG - Intergenic
1105541843 13:21322664-21322686 CAGCATTTCACAGTGATGAAAGG - Intergenic
1107996963 13:45870619-45870641 CTGCATTTAAATCTGAAGCAGGG - Intergenic
1110507697 13:76307515-76307537 AAGAATTGAAAGCTAATGAATGG - Intergenic
1110582373 13:77145480-77145502 TGGCATTTAAAACTGAGGAATGG - Intronic
1110981469 13:81904914-81904936 CAGCACTTAAAACAGATGACTGG - Intergenic
1111097460 13:83534259-83534281 CAGGATTTAAAGCAAATTAAGGG + Intergenic
1112391182 13:98985783-98985805 CAGCGCTCAAAGCTGAGGAAGGG - Intronic
1113084814 13:106557527-106557549 CAACTTTTAATGCTGATTAAAGG - Intronic
1115096158 14:29638274-29638296 CACCATGTAAAGATCATGAAAGG + Intronic
1116200496 14:41788230-41788252 CAGCATTTAAAGCTGTTAGAAGG - Intronic
1119566508 14:75633618-75633640 CAGCATTCAGACCTGAAGAAGGG - Exonic
1122182355 14:99965297-99965319 CATCGATTAAAGCTGATAAAGGG - Intergenic
1123928027 15:25137726-25137748 CAACATTTAGAGATCATGAAAGG + Intergenic
1124554078 15:30709338-30709360 CAGCACCTAAATCTGCTGAAGGG - Intronic
1124677167 15:31696333-31696355 CAGCACCTAAATCTGCTGAAGGG + Intronic
1127530025 15:59834679-59834701 CAGCATTGAAAGGGGGTGAAAGG - Intergenic
1127582627 15:60351555-60351577 CAGAATATAAAACTGAAGAAAGG - Intronic
1128199744 15:65794058-65794080 CAACACTTAAAACTAATGAAAGG - Intronic
1138534373 16:57652245-57652267 CAGCATTTAATGGTGCTGAATGG - Intronic
1138541718 16:57691645-57691667 CAGAATTTGAAACTGGTGAACGG - Intergenic
1139336244 16:66233592-66233614 CAGCATGCAAAGCTGGTGCAAGG - Intergenic
1143858154 17:9868049-9868071 CACCATTTAAAGCAGAAGATGGG - Intronic
1145101155 17:20079065-20079087 CAGTATTTAAAGATGCTTAAAGG + Intronic
1145748768 17:27340389-27340411 TGCCTTTTAAAGCTGATGAAAGG - Intergenic
1145769106 17:27479596-27479618 CAGCACTTGAAGGAGATGAAGGG - Intronic
1147767065 17:42844338-42844360 CATCATTTAGACCAGATGAAAGG - Intergenic
1149376476 17:56048873-56048895 CAGGATTTGAAGCTGATGTCTGG + Intergenic
1153488359 18:5624933-5624955 CAGGATTTCAAGGTGAAGAAAGG + Intronic
1156375166 18:36507910-36507932 GAGAAGTTAAAGCTGAAGAATGG - Intronic
1156516503 18:37684853-37684875 CAGCATTTAAGGATGATGCTGGG - Intergenic
1157265974 18:46222142-46222164 AATCATTTAAAGCTGATGCCTGG - Intronic
1158154431 18:54409355-54409377 CATCATTTAAAGATGACAAAAGG + Intergenic
1158790240 18:60771347-60771369 CCTCATTCAAATCTGATGAATGG + Intergenic
1161523341 19:4738270-4738292 CAGCAATTACAGCTAATAAACGG - Intergenic
1167504477 19:49863827-49863849 CAGAATTTGTAGCTGATGATGGG + Intronic
925013004 2:500087-500109 TGGCATTTAAAGCTGTTGACAGG + Intergenic
927924919 2:27005245-27005267 CAGCAACTAAAGCTAATGTAAGG + Intronic
928913286 2:36444557-36444579 CAGCATTCAAAAATGAAGAATGG + Intronic
929953159 2:46432571-46432593 CAGAAATTAAATATGATGAATGG + Intronic
930407398 2:50976394-50976416 CAGCAATTAAAGAAGATGTAAGG - Intronic
932406214 2:71513910-71513932 CAGGATTTCCAGGTGATGAACGG + Exonic
932866897 2:75352944-75352966 CAGCCTTTAAAGATTATGACAGG + Intergenic
933762928 2:85685976-85685998 CAGCATTTCAAGCTGACAAATGG + Intronic
935320405 2:101882433-101882455 CAGCACTTAAACCTAGTGAAAGG - Intronic
935804989 2:106736697-106736719 CAGCATTTAGACCTGAATAAAGG - Intergenic
936030325 2:109065809-109065831 CAGCATTTGAGGCAGATGACAGG - Intergenic
936495095 2:113012943-113012965 CAGCATCAAAAGTTGCTGAATGG + Intergenic
936981953 2:118272790-118272812 CAGTATGTAAAGCAGATAAAAGG - Intergenic
937745381 2:125406080-125406102 CAGAATTTAAAACTTATGAATGG + Intergenic
940256229 2:151732982-151733004 CATCATTTAAAGCATAAGAAAGG - Intronic
940440936 2:153715461-153715483 TACCATTTAAAGCTGCTAAAAGG - Intergenic
940800119 2:158123815-158123837 GAGCATTTAAAGCTGGTGTCAGG + Exonic
941616072 2:167721295-167721317 ATGCAGTTAAAGCTGAGGAAAGG + Intergenic
942893531 2:181020997-181021019 ATGCATTTGAAACTGATGAAAGG + Intronic
943389780 2:187251001-187251023 CAGCATTTTCAGCTTATGACAGG - Intergenic
944189074 2:196982009-196982031 CAGCATTTAGAGGTTAGGAAGGG - Intronic
945064174 2:205934477-205934499 CAGCATTAAAACATGCTGAATGG - Intergenic
949082564 2:242115625-242115647 CACAATTTAAAGCTTATGAATGG + Intergenic
1170350976 20:15440634-15440656 CAGCATTTAAAGCTGATGAAGGG - Intronic
1170541190 20:17389697-17389719 CAGGGTTTACAGCTGCTGAAAGG + Intronic
1171376161 20:24695445-24695467 CTGCATGTAAAGCTAATGACAGG + Intergenic
1174464561 20:50707283-50707305 CAGCTTTAAAAGGTGACGAAGGG + Intergenic
1182144022 22:27985754-27985776 CAGTATTTAAAGCTGGTGCATGG + Intronic
950854748 3:16094601-16094623 CAGCATTTTAAACAGATGGAGGG - Intergenic
952056269 3:29450682-29450704 TAACTTTTAAACCTGATGAAAGG + Intronic
952179948 3:30907009-30907031 CAGCAATTAAGGCTGACAAATGG - Intergenic
953578477 3:44132268-44132290 CAGCATTTACAGATGAGCAATGG - Intergenic
954731880 3:52670671-52670693 CAGCATTCTAAGCTGCTGCATGG + Intronic
954753936 3:52828892-52828914 CAGCACTTAGGGATGATGAATGG + Intronic
955516867 3:59734521-59734543 CACCATTTAAAGGTACTGAATGG + Intergenic
955696723 3:61644423-61644445 GAGAATTTAAAGCTGCTCAAGGG + Intronic
956004809 3:64767304-64767326 CAGCATTTTAATATCATGAATGG + Intergenic
956633693 3:71342074-71342096 CAGCATGTAAATCTGATAAGCGG - Intronic
960974141 3:123159124-123159146 CATAATTTAAAGCAGATGCAGGG + Intronic
962462270 3:135625425-135625447 CTGCATTTTTAGCTGATTAAGGG + Intergenic
966675591 3:182584005-182584027 CAGTATTTAAAACTGAAGACTGG - Intergenic
967103051 3:186232271-186232293 TAGCATTTATAGGTTATGAAGGG - Intronic
968021420 3:195394072-195394094 CAACGTTTAAAGCTAATAAAGGG + Intronic
969107436 4:4818418-4818440 CAGGTTTTAAAGGAGATGAAGGG + Intergenic
970881624 4:20939156-20939178 CTACATTTAAAGGTGAGGAAGGG - Intronic
972236478 4:37139446-37139468 CAGTATACAAGGCTGATGAAAGG + Intergenic
972259052 4:37389676-37389698 CAGCAGCTGATGCTGATGAAGGG - Intronic
975660504 4:76684090-76684112 CAGCATTTAAAGTGAAAGAAGGG - Intronic
976053573 4:81035816-81035838 TAGCATTTAAAGGTCTTGAAAGG - Intronic
978768845 4:112432657-112432679 GATCACTTAAAGCTCATGAAAGG + Intronic
981075050 4:140582254-140582276 CTGCATTTAGAGCTGATAAGTGG - Intergenic
981255397 4:142655625-142655647 CATTCTTTAAAGCTAATGAATGG + Intronic
982239189 4:153281686-153281708 CAGCACTTAAAGTTGATGACAGG - Intronic
986945331 5:13011389-13011411 CAGCATTTAAAAATCATGAGTGG - Intergenic
989721978 5:44539809-44539831 CAGCATTTAAAGGTGATTCTTGG + Intergenic
994017488 5:94984677-94984699 CATCTTTTAAAGCTGATAGATGG + Intronic
994947850 5:106418971-106418993 AAGCATTTAAAGATTTTGAATGG - Intergenic
995486650 5:112646480-112646502 TATGATTTAATGCTGATGAAAGG - Intergenic
1003294440 6:4811905-4811927 CAACACTAAGAGCTGATGAATGG - Intronic
1003410306 6:5856125-5856147 CAGCATTTCACAGTGATGAAAGG + Intergenic
1004783128 6:18934998-18935020 CAGAGTTTAAAGATGATGACAGG + Intergenic
1007914488 6:45548530-45548552 CAGCATTTCATGCTGATAAAGGG - Exonic
1007957849 6:45933464-45933486 CTGCAGTTACAACTGATGAAGGG + Intronic
1008049784 6:46888576-46888598 CAGCAGTTAAAGGTAATGACAGG + Intronic
1008904994 6:56667545-56667567 AAGCATTTAAACCTGATATATGG + Intronic
1011802833 6:91037034-91037056 CAGCGTAGAAAGCTGAGGAAAGG - Intergenic
1012085693 6:94823656-94823678 CAACATGTATAGCTGATAAAAGG + Intergenic
1013334241 6:109139270-109139292 CACAATTTAAAACTTATGAATGG + Intronic
1017087950 6:150731925-150731947 CAGCATTTAAATATGATGTTGGG - Intronic
1020223658 7:6262080-6262102 CAGCAATTACAGCTGAAGAAAGG + Intronic
1021067579 7:16195882-16195904 CTGCATCCAAAGCTGAGGAAAGG + Intronic
1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG + Intronic
1022785756 7:33635236-33635258 CAGCATCTCCAGCTGATGGAGGG + Intergenic
1023026028 7:36050256-36050278 CAGCATTTAGAGGTTATGAATGG - Intergenic
1024558511 7:50624042-50624064 CAGCATTTTAAGCCTATGTAGGG - Intronic
1024771418 7:52727944-52727966 CAGCAGTTAGAGCTGTTCAAAGG + Intergenic
1027834789 7:83227185-83227207 CGGAATTTAAAGATAATGAACGG + Intergenic
1031933264 7:127708477-127708499 CAGCATTTTCAGCTTATGATGGG + Intronic
1034137649 7:148786129-148786151 CAGTCATTAAAGATGATGAAGGG - Intronic
1034366145 7:150550603-150550625 AAGCATTGAAAGCAGATGGAGGG + Intergenic
1035540486 8:432328-432350 CACAATTTAAAACTTATGAATGG + Intronic
1035905321 8:3503594-3503616 TACCATTTAAAGCTGACAAAAGG - Intronic
1035914141 8:3600301-3600323 GGGCATTTAATGCTGTTGAAGGG + Intronic
1038358728 8:26856369-26856391 CAGCATTTCAAGATTATCAAAGG - Intronic
1038865150 8:31431486-31431508 TAGCTTTTAAAGAAGATGAAGGG - Intergenic
1043977103 8:86595955-86595977 CAGCATTTAAATGTTTTGAATGG + Intronic
1044423712 8:92027488-92027510 CAGCATATAAAGCAACTGAAAGG - Intronic
1045695816 8:104807598-104807620 CAGAATTTAAAGCAGAGGCAGGG - Intronic
1046913071 8:119650087-119650109 CAGCATTACCAACTGATGAATGG + Intronic
1046927983 8:119813790-119813812 CAGCATTTAGAAATAATGAAAGG + Intronic
1048760914 8:137794283-137794305 CTTCATTTAAAACTGCTGAATGG - Intergenic
1048842998 8:138581436-138581458 CATAGTTTAAAGCTGAGGAATGG - Intergenic
1049582491 8:143418952-143418974 CTGCATTTGAAGATGAAGAAAGG - Intergenic
1050456663 9:5840934-5840956 CCTAATTTAAAGTTGATGAAAGG + Intergenic
1050948136 9:11551381-11551403 CACTATTTAAAACTTATGAATGG + Intergenic
1051412211 9:16801536-16801558 CAGCATTTAAAGGTGAGGAATGG - Intronic
1051944299 9:22548421-22548443 CAATATATAAAGCTGAAGAAGGG + Intergenic
1056115969 9:83441604-83441626 CAGCATTTAAAACTCCTCAATGG + Intronic
1058287924 9:103203781-103203803 CTGCCTTTAAAGTTGAGGAAAGG - Intergenic
1060257618 9:122046556-122046578 GAGCATTGAAAGCTGACAAATGG + Intronic
1061633190 9:131886826-131886848 CAGCATTTAAAGATTATTCAGGG + Intronic
1061646719 9:132008969-132008991 CAGCAGATAAATCTGGTGAAGGG + Intronic
1187076159 X:15937333-15937355 CAGCAATTAAACTGGATGAATGG + Intergenic
1188401216 X:29747165-29747187 CAGAATTGAGAGGTGATGAAGGG + Intronic
1188831516 X:34903625-34903647 CAGCATATAAAGATAATGACTGG + Intergenic
1189458420 X:41215727-41215749 CAGCATTTAAATCAGCTGATAGG + Intronic
1189676451 X:43465454-43465476 CAGCATGGAGAGCTGATGATGGG + Intergenic
1190699468 X:52976024-52976046 CAGCATTTAAAACAGAAGGAAGG - Intronic
1194167260 X:90533304-90533326 TTGCTTTTGAAGCTGATGAATGG - Intergenic
1197309925 X:124892193-124892215 CAGCATCAACAGATGATGAAGGG + Intronic
1197998588 X:132407825-132407847 CAGAATTAACAGCTGATGGAGGG + Intronic
1200513524 Y:4111080-4111102 TTGCTTTTGAAGCTGATGAATGG - Intergenic