ID: 1170356070

View in Genome Browser
Species Human (GRCh38)
Location 20:15492911-15492933
Sequence CTTTTAGTTACTTGGAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170356066_1170356070 20 Left 1170356066 20:15492868-15492890 CCTAACTTCTGGATATTTATAAC 0: 1
1: 0
2: 1
3: 22
4: 227
Right 1170356070 20:15492911-15492933 CTTTTAGTTACTTGGAAGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170356070 Original CRISPR CTTTTAGTTACTTGGAAGGC TGG Intronic
901291501 1:8127822-8127844 GTCTCAGCTACTTGGAAGGCTGG - Intergenic
901412844 1:9096755-9096777 GTCTCAGTTACATGGAAGGCTGG + Intergenic
904152262 1:28451759-28451781 GTCTTAGCTACTTGGGAGGCTGG - Intronic
904535050 1:31193886-31193908 GTCTTTGTTACTTAGAAGGCAGG + Intronic
905153641 1:35954188-35954210 CTTTTAGTCACTTGGAAGATAGG + Intronic
905815776 1:40949666-40949688 GTTCTAGCTACTTGGGAGGCTGG - Intergenic
906046557 1:42835409-42835431 TTCTTAGTTAATTAGAAGGCTGG - Intronic
906095442 1:43220604-43220626 GTTCTAGCTACTTGGGAGGCTGG + Intronic
906252193 1:44319270-44319292 ATTTCAGCCACTTGGAAGGCAGG - Intronic
908611040 1:65861452-65861474 CTTGTAGTTAGTTTGAAGTCAGG + Intronic
908883778 1:68763820-68763842 CTTGTAGTTAGTTTGAAGTCAGG - Intergenic
909149384 1:71981759-71981781 CTTCTAGTTACTGGTAAGGCTGG - Intronic
910072414 1:83233264-83233286 CTTGTAATTACTTAGAAGACAGG - Intergenic
910988592 1:93030708-93030730 ATTTTAGCTACTGGGAAGGCTGG + Intergenic
911034558 1:93527255-93527277 CTCTTAGTTACTTGAAAGAAAGG + Intronic
915151636 1:153837235-153837257 ATTCTAGCTACTTGGGAGGCTGG + Intronic
915516604 1:156416509-156416531 TTTTTAGTTACTTAGAATCCAGG + Intronic
916916740 1:169415440-169415462 CTTTCAGTGACTTGGGAGGATGG - Intronic
916953933 1:169811535-169811557 GTTCTAGTTACTTGGGAGACTGG + Intronic
918189775 1:182163034-182163056 CTTATAGTTAGTTAGAAGTCAGG + Intergenic
920252662 1:204632114-204632136 GTTCTAGCTACTTGGGAGGCTGG + Intronic
921261914 1:213392072-213392094 CTTTTGGTGAATTGGTAGGCAGG + Intergenic
921707024 1:218334028-218334050 ATTCTAGATACTTGGATGGCTGG + Exonic
921875942 1:220196711-220196733 ATCTTAGCTACTTGGGAGGCTGG + Intronic
921912542 1:220565776-220565798 TTTTTAGTTATTGGTAAGGCTGG + Intronic
922698190 1:227742443-227742465 CTTTTAGTTATTTTGACGGTGGG + Intronic
924122742 1:240818898-240818920 CTTTTAGTTACTTTGAAATATGG - Intronic
924360393 1:243234591-243234613 CTTTTAGATACTTGGTATGATGG - Intronic
1063103474 10:2972169-2972191 CTTTTAATTCCTTTGAAGACAGG + Intergenic
1063681523 10:8192621-8192643 GTTTTATTTGCATGGAAGGCTGG - Intergenic
1066113098 10:32214670-32214692 GTACCAGTTACTTGGAAGGCTGG - Intergenic
1067984617 10:51128935-51128957 TTTTTAGTTACTTGTAATGATGG + Intronic
1070871803 10:79761137-79761159 GTCTCAGTTACTTGGGAGGCTGG + Intergenic
1071083902 10:81845583-81845605 TTTTTAATTAATAGGAAGGCAGG + Intergenic
1071096891 10:81986623-81986645 CTTTTAATTATTTGTAAGGAAGG + Intronic
1071638724 10:87283304-87283326 GTCTCAGTTACTTGGGAGGCTGG + Intergenic
1071656516 10:87454648-87454670 GTCTCAGTTACTTGGGAGGCTGG - Intergenic
1071830560 10:89367934-89367956 GTTCTAGCTAATTGGAAGGCTGG - Intronic
1074829405 10:117238337-117238359 GTCCCAGTTACTTGGAAGGCTGG - Intergenic
1074952572 10:118353543-118353565 ATTTTAGATTCTTGGATGGCAGG - Intergenic
1076364106 10:129911061-129911083 CCTGCAGTTACCTGGAAGGCAGG - Intronic
1078491424 11:11772707-11772729 CTATTTGTTACTTTGAAGGAAGG + Intergenic
1078616497 11:12870766-12870788 GTTATAGCTACTTGGGAGGCTGG + Intronic
1081241986 11:40717829-40717851 CTTTATGTAACTTGGAAGCCAGG - Intronic
1082060335 11:47854716-47854738 GTTTCAGCTACTTGGGAGGCTGG + Intergenic
1086095379 11:83045248-83045270 GTTTCAGTTGCTTGGGAGGCTGG - Intronic
1086330957 11:85753651-85753673 GTTTTAGCTACTTGGGAGACAGG + Intronic
1086894463 11:92295963-92295985 GTTTTGGTCACTTGGATGGCTGG + Intergenic
1088276736 11:108095337-108095359 CATTTTGTTACATGGAAAGCTGG + Intronic
1090418373 11:126556521-126556543 CTTCTGGCTACTTGGGAGGCTGG + Intronic
1091430515 12:429876-429898 GTTCCAGCTACTTGGAAGGCTGG - Intronic
1094246808 12:28307193-28307215 TTTTTATTTACTTTGAAAGCAGG + Intronic
1095579954 12:43786147-43786169 ATCTTAGCTACTTGGAAGGCTGG - Intronic
1097590008 12:61563009-61563031 ATTTTAGTTATTATGAAGGCTGG + Intergenic
1097655805 12:62361702-62361724 CTTTTATTTTCTTGGAGGGAGGG - Intronic
1098547127 12:71723653-71723675 GTCTTAGCTACTTGGGAGGCTGG - Intergenic
1099031599 12:77531918-77531940 CTCTCAGTTATTTGGGAGGCTGG + Intergenic
1100444959 12:94651408-94651430 TTTTAAGCTACTTGGAAGTCAGG + Intergenic
1100571443 12:95846859-95846881 TTTTTATTTACTTGGAATACTGG + Intergenic
1102393204 12:112566369-112566391 GTTCCAGTTACTTGGGAGGCGGG + Intergenic
1102572671 12:113836598-113836620 CTGTAACTGACTTGGAAGGCAGG + Intronic
1103081993 12:118031562-118031584 CTTTTAGTTGCTTGGATGACAGG + Exonic
1103607543 12:122098322-122098344 CTTTTAGGTTCTTGGAAAGATGG + Intronic
1103661444 12:122522416-122522438 CATTTAGTTACTTGGAAAGCAGG - Intronic
1103808596 12:123594428-123594450 CTTTTAATTACTATGTAGGCTGG - Intronic
1104272508 12:127294773-127294795 ATTTAAGGTGCTTGGAAGGCCGG - Intergenic
1104667558 12:130658076-130658098 CTTTTAAGTACTGGGAAGGTGGG - Intronic
1105772963 13:23630183-23630205 ATTCTAGCTACTTGGGAGGCTGG + Intronic
1109023302 13:57127794-57127816 CTTTTAGTTGGTTGGCAGGAGGG + Intergenic
1112571257 13:100595481-100595503 CCTTTAGTTACTTGGAACCTGGG - Intergenic
1114033927 14:18603133-18603155 CTCTTAGCTTCTTGGAAGGAAGG - Intergenic
1114078722 14:19182307-19182329 CTCTTAGCTTCTTGGAAGGAAGG - Intergenic
1114980901 14:28162714-28162736 CATTTATTTACTGGGATGGCTGG - Intergenic
1115710108 14:36041115-36041137 CTCTTAGTTACTTGTAAGAATGG + Intergenic
1116344796 14:43778754-43778776 CTTTTACTGACTTGTAAGACTGG + Intergenic
1117147038 14:52846025-52846047 GTCCTAGCTACTTGGAAGGCTGG - Intergenic
1117225065 14:53649329-53649351 CTTTTAGTTACTGATAAGGAGGG - Intergenic
1117652649 14:57922902-57922924 CTTTTATTTTCTTAGAATGCTGG - Intronic
1118585976 14:67353603-67353625 GTTCTAGCTACTTGGGAGGCTGG - Intronic
1119545885 14:75471146-75471168 GATTTAGTTTCTGGGAAGGCTGG + Intronic
1120548302 14:85837672-85837694 CTTTTTGTTTCTGGAAAGGCGGG + Intergenic
1120632568 14:86908797-86908819 ATTTTAAATACTTGGAAGGAAGG - Intronic
1121356925 14:93223443-93223465 GTTTCAGCTACTTGGGAGGCTGG + Intronic
1121745069 14:96282318-96282340 CTTTAAGTTCCTTGAAAGGAAGG - Exonic
1121864585 14:97350769-97350791 TTGTTAGTCACTGGGAAGGCAGG + Intergenic
1126817518 15:52468550-52468572 GTTCCAGTTACTTGGGAGGCTGG + Intronic
1126863127 15:52906775-52906797 CTTGTAGTTAGTTTGAAGTCAGG - Intergenic
1128437938 15:67673964-67673986 CTCCCAGCTACTTGGAAGGCTGG - Intronic
1129370177 15:75088288-75088310 ATCCTAGCTACTTGGAAGGCTGG - Intronic
1129952556 15:79604902-79604924 CCTTTAGCTTCTGGGAAGGCAGG + Intergenic
1131124113 15:89843688-89843710 ATTCTAGCTACTTGGGAGGCTGG + Intronic
1135941871 16:26828800-26828822 CTCCTAGTTACTTGGGAGGCTGG + Intergenic
1136047477 16:27625965-27625987 GTTCTAGCTACTTGGGAGGCTGG - Intronic
1137486110 16:48892713-48892735 TTTCTAGTTCTTTGGAAGGCAGG + Intergenic
1137980547 16:53065515-53065537 GTCTCAGTTACTTGGGAGGCTGG + Intronic
1138304541 16:55962469-55962491 CTTTTGTTTACCTGGAAGGATGG - Intergenic
1138429168 16:56957242-56957264 GTTCCAGTTACTTGGGAGGCTGG + Intergenic
1140482687 16:75270540-75270562 GTTTCAGCTACTTGGGAGGCTGG - Intergenic
1140867701 16:79078322-79078344 GGTTTTGTTACTTGCAAGGCAGG + Intronic
1141123015 16:81376758-81376780 ATCTCAGCTACTTGGAAGGCTGG + Intronic
1141308608 16:82890962-82890984 CTTTTATATACTTGGAGGGTAGG + Intronic
1146144592 17:30402267-30402289 ATCTTACTTCCTTGGAAGGCTGG + Intronic
1146495114 17:33314878-33314900 CTTTTAATTAATTGGGAAGCTGG + Intronic
1148005755 17:44428163-44428185 GTCCCAGTTACTTGGAAGGCTGG + Intronic
1148475132 17:47923653-47923675 CCTTTGGTTATTTGCAAGGCTGG - Intronic
1148578642 17:48728336-48728358 CTTATGGTTACTTTGGAGGCGGG - Exonic
1149389320 17:56173573-56173595 GTCTCAGCTACTTGGAAGGCTGG - Intronic
1149874587 17:60218719-60218741 ATTTCAGCTACTTGGGAGGCTGG - Intronic
1149888850 17:60367688-60367710 CTTATAGCTACTTGGGAGGTTGG + Intronic
1150088375 17:62295970-62295992 ATTTCAGCTACTTGGGAGGCTGG - Intergenic
1153270237 18:3313360-3313382 CTTTTTGAAACTTGGAAGTCTGG + Intergenic
1153364081 18:4234115-4234137 TTTTTAGTTTCTTGGATGGAAGG + Intronic
1155412968 18:25566292-25566314 GTTTTAGTTTGTTGGATGGCTGG + Intergenic
1158823782 18:61191298-61191320 GTTTCAGCTACTTGGGAGGCTGG - Intergenic
1159046688 18:63375584-63375606 GTCCTAGCTACTTGGAAGGCTGG + Intergenic
1162275269 19:9648740-9648762 GTTTTAGCTACTTGGGAGGGTGG - Intronic
1163307838 19:16492910-16492932 ATCTTAGCTACTTGGGAGGCTGG + Intronic
1165492142 19:36130096-36130118 CTCCTAGCTACTTGGGAGGCTGG - Intergenic
1166239781 19:41482366-41482388 GTTTTATATACTTGGAAAGCTGG + Intergenic
1166274668 19:41744549-41744571 CTTCCAGTTATTTGGGAGGCTGG + Intronic
1167024044 19:46901438-46901460 GTTCCAGCTACTTGGAAGGCTGG + Intergenic
927602867 2:24459674-24459696 CTTTGAGTTCCTTGGAAGAAAGG - Intergenic
929149129 2:38732172-38732194 ATCCTAGCTACTTGGAAGGCTGG - Intronic
930146941 2:48017052-48017074 GTTCCAGCTACTTGGAAGGCTGG - Intergenic
930686195 2:54311108-54311130 CTTTTTGTGAATTGCAAGGCTGG - Intergenic
930950749 2:57141732-57141754 GTTTCAGCTACTTGAAAGGCTGG - Intergenic
931736854 2:65203087-65203109 GTCCTAGTTACTTGGGAGGCTGG + Intergenic
933666509 2:84969683-84969705 CTTTTAGTTTCTTTGAAATCAGG + Intergenic
937630435 2:124095562-124095584 CTGTGAGCTCCTTGGAAGGCTGG + Intronic
940207033 2:151214249-151214271 ATCTTAGCTACTTGGGAGGCTGG + Intergenic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
941006945 2:160257806-160257828 CTTTTAGGTAATTGCAAGGGCGG + Intronic
942736307 2:179118086-179118108 GTCTTAGCTACTTGGGAGGCTGG - Intronic
943321296 2:186446303-186446325 GTTCTAGCTACTTGGGAGGCTGG + Intergenic
943340860 2:186680325-186680347 CTTTTAGTTTGTTGGTTGGCTGG + Exonic
944687157 2:202127681-202127703 CTTTTAGTTACTAGGAATAGAGG - Intronic
944773480 2:202937740-202937762 ATTCCAGTTACTTGGGAGGCTGG - Intronic
944864240 2:203845480-203845502 CTTTTAGTTATTTGGAAATACGG + Intergenic
945137177 2:206641677-206641699 CTTTTTTTTTCTTGGAAAGCTGG + Intergenic
946670473 2:222098301-222098323 CTTCTTTTTACTTGGAAGGTAGG + Intergenic
1169270919 20:4198859-4198881 CTTTAAGTTATTTTGCAGGCAGG + Intergenic
1169759447 20:9075495-9075517 GTTTTAGTTTTCTGGAAGGCCGG + Intronic
1170356070 20:15492911-15492933 CTTTTAGTTACTTGGAAGGCTGG + Intronic
1170697623 20:18674174-18674196 ATTTTATTGACTTGGAAGCCTGG + Intronic
1171137111 20:22705609-22705631 GTCTTAGCTACTTGGGAGGCTGG - Intergenic
1172695911 20:36822625-36822647 CATTTTGTTCCTTGGAAGGTTGG - Intronic
1173613149 20:44385584-44385606 ATTTCAGCTACTTGGGAGGCTGG - Intronic
1173768390 20:45635077-45635099 ATTTTTGCTACTTGGGAGGCTGG + Intergenic
1175156124 20:56972860-56972882 CTGTCATTTGCTTGGAAGGCAGG - Intergenic
1179303776 21:40136363-40136385 CCTTGAGCTACTTGGGAGGCTGG - Intronic
1180458046 22:15530175-15530197 CTCTTAGCTTCTTGGAAGGAAGG - Intergenic
1182360703 22:29744785-29744807 CTTTTAATTCATTGGAAGGGAGG + Intronic
1183256362 22:36764991-36765013 CTTTCAGATCCTTGGAAGGCGGG + Intronic
1183421829 22:37716227-37716249 ATCTTAGCTACTTGGGAGGCTGG - Intronic
1183497639 22:38157916-38157938 ATTCCAGCTACTTGGAAGGCTGG + Intronic
1184350536 22:43940689-43940711 CTCCCAGCTACTTGGAAGGCTGG + Intronic
949265181 3:2148735-2148757 CATCTAGTTACATGGAAGGAGGG - Intronic
950770425 3:15306645-15306667 CTGATAGTTACTTGTGAGGCAGG - Intronic
952734533 3:36675673-36675695 CTTTTACTTACTTGAAAAGCTGG + Intergenic
953791690 3:45952487-45952509 CTTTAACTGACTTGGAAGGGTGG + Intronic
954476244 3:50748824-50748846 AATTTAATTACTTGGTAGGCTGG + Intronic
955766510 3:62349412-62349434 ATCTTAGCTACTTGGGAGGCTGG + Intergenic
956515794 3:70046579-70046601 ATTTTTATTACTTGGAAGCCTGG + Intergenic
956625297 3:71260658-71260680 GTCTCAGCTACTTGGAAGGCTGG - Intronic
956921974 3:73939444-73939466 CTATTAGTTCCCTGGAAAGCTGG + Intergenic
958477842 3:94607852-94607874 CTTATAGGTTCCTGGAAGGCAGG + Intergenic
960410347 3:117315449-117315471 CTCTTAGTTACTTGGAGGTTGGG + Intergenic
960624300 3:119665490-119665512 AGTTCAGTTACTTGGGAGGCTGG - Intronic
961134603 3:124498091-124498113 CTAGTAGTTAGTGGGAAGGCAGG + Intronic
963114059 3:141710798-141710820 CTGTTAGATAATAGGAAGGCTGG - Intergenic
963523710 3:146389364-146389386 CTTGTAGTCCCCTGGAAGGCAGG + Intergenic
964074915 3:152682231-152682253 GTTCTAGCTACTTGGGAGGCTGG + Intergenic
964811174 3:160666297-160666319 CTTCCTGTTGCTTGGAAGGCTGG + Intergenic
966233882 3:177679535-177679557 CTTTTATTAACTTGGCAGCCTGG + Intergenic
966901312 3:184488165-184488187 CTTATAGTTAGTTTGAAGTCAGG + Intronic
967731742 3:192913277-192913299 CTCCTAGCTACTTGGGAGGCTGG + Intronic
967785773 3:193492982-193493004 ATTTTAGTTCTTTGGAAGACTGG - Exonic
969408940 4:7015230-7015252 TTTTAAGTTACCTGGAAGGCAGG + Intronic
972133859 4:35866681-35866703 ATTTTAGATACTTTAAAGGCTGG + Intergenic
975675133 4:76820525-76820547 TTCCTAGCTACTTGGAAGGCTGG + Intergenic
976241532 4:82962175-82962197 GTTCCAGCTACTTGGAAGGCTGG - Intronic
978797314 4:112721166-112721188 CTTTGTGTTTCTTGGAAGGAGGG + Intergenic
980140407 4:128909365-128909387 GTTCTAGCTACTTGGGAGGCTGG - Intronic
980332729 4:131430144-131430166 CTTTGTCTTACTTGGGAGGCTGG + Intergenic
981628296 4:146787001-146787023 GTCTTAGCTACTTGGGAGGCTGG + Intronic
983506673 4:168560752-168560774 CTATTAGTTTTGTGGAAGGCAGG + Intronic
985023927 4:185720581-185720603 CTCTTAGATACATGGAAGGAAGG - Intronic
986340731 5:6786987-6787009 GTTCCAGCTACTTGGAAGGCTGG + Intergenic
986352080 5:6889726-6889748 CTCTGAGTTACTTGGAAGGGAGG - Intergenic
987468762 5:18304679-18304701 GTTATAGCTACTTGGGAGGCTGG + Intergenic
988371790 5:30379645-30379667 CTTTTACTTATTTGGATGGTTGG - Intergenic
988722206 5:33890419-33890441 CTTTGCTTTACTTGGAAAGCTGG - Intronic
989591755 5:43119378-43119400 GTTTCAGCTACTTGGAAGACTGG - Intronic
991415108 5:66384148-66384170 CTTGTAGTTAGTTTGAAGTCAGG + Intergenic
991533929 5:67645706-67645728 ATTCTAGCTACTTGGGAGGCTGG - Intergenic
992376384 5:76191944-76191966 CTTCTAGTTCTGTGGAAGGCAGG + Intronic
993277283 5:85876891-85876913 GTCTCAGCTACTTGGAAGGCTGG - Intergenic
993919916 5:93788742-93788764 CCTTAATTTACTTTGAAGGCAGG + Intronic
994865076 5:105258260-105258282 CTATTAGTTAATTTGAGGGCTGG - Intergenic
995345122 5:111104919-111104941 CTTTGAGTGACTTAGAAGTCTGG + Intronic
995360633 5:111292811-111292833 GTTCTAGCTACTTGGGAGGCTGG + Intronic
997997061 5:138595530-138595552 CTTTGAATTCCTTGCAAGGCAGG - Intergenic
1002389014 5:178895147-178895169 CTATTAGTTACTGAGAAGGTAGG + Intergenic
1002393007 5:178930436-178930458 GTCTTAGCTACTTGGGAGGCTGG - Intronic
1003904222 6:10684188-10684210 GTCTCAGCTACTTGGAAGGCTGG + Intronic
1004673960 6:17823583-17823605 ATCCTAGTTACTTGGGAGGCCGG - Intronic
1004932465 6:20475617-20475639 GTTCCAGTTACTTGGGAGGCTGG - Intronic
1005224497 6:23626123-23626145 CTTTTACTTACTGTGAAGCCTGG + Intergenic
1006480595 6:34290348-34290370 GTCCTAGCTACTTGGAAGGCTGG - Intronic
1008110817 6:47492301-47492323 CTTTTTGGTACATGGAAGGCTGG + Intronic
1010716118 6:79232551-79232573 GTTTTATTTCCCTGGAAGGCAGG - Intronic
1011840439 6:91491210-91491232 ATTTTAGTTATTTTGAGGGCTGG + Intergenic
1013333165 6:109127046-109127068 GTCTCAGTTACTTGGGAGGCTGG + Intronic
1014187112 6:118447301-118447323 ATTCCAGTTACTTGGGAGGCTGG - Intergenic
1014681060 6:124430909-124430931 CTTTCAGTTACTTGGGTGTCAGG + Intronic
1016539806 6:145151742-145151764 CCTTTACTTACTTGGTAGTCAGG - Intergenic
1016673935 6:146741004-146741026 CTTTTAGTTATTTGGAACTTTGG + Intronic
1018199507 6:161381992-161382014 GTTTCAGCTACTTGGAAGGCTGG + Intronic
1018322998 6:162633464-162633486 CATTTAGTCACTGGGAAGGGAGG + Intronic
1019569205 7:1701682-1701704 GTTCTAGCTACTTGGGAGGCTGG + Intronic
1019948365 7:4348646-4348668 CTTTTATTTACTTAGAATTCTGG + Intergenic
1023119847 7:36898527-36898549 CTTTTGGCTCCTTGGAAGACCGG + Intronic
1023286789 7:38629687-38629709 CAAGTAATTACTTGGAAGGCAGG + Intronic
1026071882 7:67129106-67129128 CCTTTTCTTACATGGAAGGCCGG + Intronic
1026705025 7:72683148-72683170 CCTTTTCTTACATGGAAGGCCGG - Intronic
1027217481 7:76193367-76193389 CTTCAAGCTACTTGGAAGGCTGG - Intergenic
1027290127 7:76698237-76698259 CTTGTAATTACTTAGAAGACAGG - Intergenic
1028151021 7:87371874-87371896 CTCCCAGCTACTTGGAAGGCTGG + Intronic
1030141278 7:106306506-106306528 CTTTTAGGAACTTGACAGGCGGG - Intergenic
1031940156 7:127780015-127780037 CTTTTAGCTCCTTTGAAGGTAGG + Intronic
1032466063 7:132145966-132145988 GTTTCAGCTACTTGGGAGGCAGG + Intronic
1033335069 7:140445292-140445314 GTTCTAGCTACTTGGGAGGCTGG + Intergenic
1037591865 8:20319346-20319368 CTTTGAGTTGCTTGCAAGCCAGG + Intergenic
1042923611 8:73943806-73943828 GTTCTAGCTACTTGGGAGGCTGG + Intronic
1044213536 8:89580294-89580316 CTCTCAGCTACTTGGGAGGCTGG - Intergenic
1044459784 8:92430335-92430357 CTCTTAGTTCCTTTGAAAGCTGG + Intergenic
1044785365 8:95787389-95787411 CTTTGAGTTCCTTGGAAGAAAGG - Intergenic
1045094846 8:98786428-98786450 GTTCTAGCTACTTGGGAGGCTGG + Intronic
1047418773 8:124688534-124688556 CTTTTAGCTCTTTGGAAGGGGGG - Intronic
1047676981 8:127213067-127213089 CTTTCTATTACTTGGAAGCCAGG + Intergenic
1048212503 8:132467066-132467088 CTTTAAATAACCTGGAAGGCAGG + Intronic
1048350544 8:133612373-133612395 ATTAAAGTTACTTGGAAGGAGGG + Intergenic
1048789406 8:138085755-138085777 TTTTTATGTACTAGGAAGGCTGG - Intergenic
1053367515 9:37533752-37533774 GTTTCAGCTACTTGGGAGGCTGG + Intronic
1058837183 9:108868090-108868112 CTATTAGTTCCTTTGAAAGCTGG + Exonic
1061267768 9:129517599-129517621 GTTCTAGCTACTTGGGAGGCTGG - Intergenic
1186754065 X:12651406-12651428 CTTTTAGTATCTTGGAAGGAAGG - Intronic
1187673822 X:21695788-21695810 CTTCTAGACTCTTGGAAGGCAGG + Intergenic
1189569788 X:42284314-42284336 CTTTTATTTTCTTTGAAGCCAGG + Intergenic
1189900289 X:45699529-45699551 CTTTTAAGTACTTGGAAGGAGGG + Intergenic
1198259000 X:134949917-134949939 GTTCTAGATACTTGGGAGGCTGG - Intergenic
1199752181 X:150830432-150830454 GTTCCAGCTACTTGGAAGGCTGG + Intronic
1200923787 Y:8636337-8636359 CATTTAGTCAATTGGGAGGCAGG + Intergenic