ID: 1170357140

View in Genome Browser
Species Human (GRCh38)
Location 20:15505413-15505435
Sequence AATTGATGGTAGGAGGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 383}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170357140_1170357146 -3 Left 1170357140 20:15505413-15505435 CCCCTCTCCTCCTACCATCAATT 0: 1
1: 0
2: 1
3: 31
4: 383
Right 1170357146 20:15505433-15505455 ATTATAAAGAAGCAGATAGATGG 0: 1
1: 0
2: 3
3: 48
4: 460
1170357140_1170357151 28 Left 1170357140 20:15505413-15505435 CCCCTCTCCTCCTACCATCAATT 0: 1
1: 0
2: 1
3: 31
4: 383
Right 1170357151 20:15505464-15505486 CCAGCGTTCTAGGAGGCTCTAGG 0: 1
1: 0
2: 1
3: 17
4: 139
1170357140_1170357148 21 Left 1170357140 20:15505413-15505435 CCCCTCTCCTCCTACCATCAATT 0: 1
1: 0
2: 1
3: 31
4: 383
Right 1170357148 20:15505457-15505479 CAGAAACCCAGCGTTCTAGGAGG 0: 1
1: 0
2: 1
3: 9
4: 188
1170357140_1170357147 18 Left 1170357140 20:15505413-15505435 CCCCTCTCCTCCTACCATCAATT 0: 1
1: 0
2: 1
3: 31
4: 383
Right 1170357147 20:15505454-15505476 GGACAGAAACCCAGCGTTCTAGG 0: 1
1: 0
2: 0
3: 6
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170357140 Original CRISPR AATTGATGGTAGGAGGAGAG GGG (reversed) Intronic
901739359 1:11332068-11332090 AATAGATGGTAGGAGTTGAGTGG - Intergenic
902043672 1:13510160-13510182 AATTGAAGGAAGGAGCAAAGAGG - Intronic
903496842 1:23774526-23774548 AATTGTTGTTTTGAGGAGAGAGG + Intergenic
903795600 1:25927012-25927034 AATTGAAGGTGGGAGAGGAGGGG - Intergenic
903913194 1:26743856-26743878 ATTTCATGATAGAAGGAGAGAGG + Intronic
904115414 1:28158253-28158275 ATTTGATAGTGCGAGGAGAGAGG + Intronic
904916935 1:33977062-33977084 AGTTCAAGTTAGGAGGAGAGGGG + Intronic
905409403 1:37757930-37757952 ACTGGAAGGGAGGAGGAGAGGGG - Intronic
906515551 1:46436993-46437015 AATGGATGGTTGGAGTTGAGTGG - Intergenic
906560371 1:46752258-46752280 AAGGGAAGGGAGGAGGAGAGTGG + Intergenic
907644619 1:56229747-56229769 AATTCATAGGAAGAGGAGAGGGG + Intergenic
908116819 1:60948976-60948998 AGTTGCAGGAAGGAGGAGAGAGG - Intronic
909469302 1:76008830-76008852 AAATGAGGGTGGGAAGAGAGAGG - Intergenic
910334921 1:86117239-86117261 AAGTGATGGTAGTAGGAGATGGG + Intronic
911381893 1:97125625-97125647 AAGTGATGGTAGTAGGAGGTAGG + Intronic
911541902 1:99166349-99166371 ACTTCATGGAAGGAGGAGAAAGG - Intergenic
912360706 1:109092678-109092700 AATTGCTTGTAGGAGGAAGGGGG - Intronic
913185439 1:116366533-116366555 AAGTGATGGTAGGAGGTAATGGG - Intergenic
914139837 1:144936193-144936215 ATTTGTTGGTTGGAGGAAAGAGG - Intronic
915294258 1:154909078-154909100 AAGGGATGGGAGGAGGAGAATGG + Intergenic
916451592 1:164926304-164926326 AGATGGGGGTAGGAGGAGAGAGG + Intergenic
917309370 1:173662642-173662664 AATTGATGGCAGGAAGAATGGGG + Intronic
919604905 1:199669695-199669717 ACTTGATGCTAGGAAGAGATGGG - Intergenic
920485111 1:206362508-206362530 ATTTGTTGGTTGGAGGAAAGAGG + Intronic
921163040 1:212486451-212486473 AATTCCTGGTAGGAGGAAATGGG + Intergenic
921739530 1:218668058-218668080 AATTGATGAGAGGTGGAAAGAGG - Intergenic
922437234 1:225618507-225618529 AGTTGATAGTAGGAACAGAGAGG - Intronic
922629991 1:227097107-227097129 TATAGATGATTGGAGGAGAGAGG - Intronic
923397668 1:233583275-233583297 ACTTGGTGGGAGGAGGAGGGAGG - Intergenic
923872540 1:238011593-238011615 GATTGGTGGTAGGAAGAGATAGG + Intergenic
924173594 1:241366600-241366622 AAGTGATGGTATTAGGAGATGGG + Intergenic
924562758 1:245170766-245170788 AAGTGATGGTAGTAGGAGGTGGG - Intronic
924633400 1:245763207-245763229 TATTGAGGGAAGGAGGAGGGAGG - Intronic
924927733 1:248699529-248699551 AATTAATGGTAGGAGGAGTGGGG + Intergenic
1063082594 10:2782671-2782693 TTTTCAAGGTAGGAGGAGAGGGG - Intergenic
1063989855 10:11548743-11548765 AAATGATGGTTGGAGGATATAGG - Intronic
1063998095 10:11640192-11640214 AATTGATGGTCTTAGGAGATGGG - Intergenic
1064064465 10:12169208-12169230 AAGTGAGGGGAGGTGGAGAGAGG - Intronic
1064178008 10:13092002-13092024 GGCTGATGGTGGGAGGAGAGGGG + Intronic
1064972280 10:21078064-21078086 AATGGACGGGAGGAGGAGATTGG + Intronic
1065868630 10:29936034-29936056 AAGAGCTGGTAGGGGGAGAGGGG - Intergenic
1066487042 10:35856156-35856178 AAGGGAGGGAAGGAGGAGAGAGG - Intergenic
1068044369 10:51867414-51867436 AAGAGATGGAAGGAGGGGAGAGG + Intronic
1068524792 10:58116195-58116217 AGGTGATGGTAGGAGGAGCTAGG - Intergenic
1069220080 10:65872328-65872350 AATTGAGGGTTGGGGGAGGGTGG - Intergenic
1069411128 10:68154490-68154512 AATTGATTGAATGGGGAGAGGGG - Intronic
1069972612 10:72185639-72185661 AATCAGTGGTAGGAGGTGAGGGG + Intronic
1071920360 10:90342791-90342813 AATTTATGTTAGGAGGAGAAGGG + Intergenic
1072840439 10:98768349-98768371 AGGTGGTGGTAGGAGGAAAGCGG + Intronic
1073688785 10:105784875-105784897 AATAGAGTGTAGGAGGAGACAGG + Intergenic
1074031165 10:109689893-109689915 TTTTGGTGATAGGAGGAGAGAGG - Intergenic
1074284289 10:112083422-112083444 ATTTGGGGGCAGGAGGAGAGAGG - Intergenic
1075047783 10:119159655-119159677 AGCTGAGGTTAGGAGGAGAGTGG + Intronic
1075352961 10:121742435-121742457 AATAGCTGGTAGCAGAAGAGGGG + Exonic
1076718579 10:132381879-132381901 AATTTAGGGCAGGAGGGGAGAGG + Intergenic
1077933229 11:6754990-6755012 AATTGGGGGTAGGAGGGGTGGGG + Intergenic
1078154812 11:8790245-8790267 AGTTACTGGTGGGAGGAGAGTGG - Intronic
1079472829 11:20796353-20796375 AATGTAGGGTAGGAGGAAAGGGG + Intronic
1079677053 11:23242413-23242435 AAATGATGGTAGCAGAAGAAAGG + Intergenic
1080067701 11:28038904-28038926 AATTGGTGGTAGCAGCACAGTGG - Intronic
1080083628 11:28252264-28252286 AAATGTTGGTGGGAGGAGTGGGG + Intronic
1080733386 11:34984202-34984224 TCTTGAGGGGAGGAGGAGAGTGG - Intronic
1081198568 11:40190877-40190899 AATTGAAGGTGGGAGGTGGGAGG - Intronic
1081491999 11:43576534-43576556 AGTGGATGGAAAGAGGAGAGAGG - Intronic
1082190174 11:49233588-49233610 AAAAAATGGTAGAAGGAGAGAGG - Intergenic
1082986758 11:59175643-59175665 AAATGATGGCAGGTGGAGAGGGG - Intronic
1083538416 11:63492492-63492514 AAGTGATGGTATCAGGAGATGGG + Intergenic
1085272766 11:75280119-75280141 CATTGGTGGTAGGGTGAGAGGGG + Intronic
1086675951 11:89607324-89607346 AAAAAATGGTAGAAGGAGAGAGG + Intergenic
1087163019 11:94969086-94969108 GATTGATTGTAGCAGCAGAGAGG - Intronic
1088713520 11:112528904-112528926 AATTGCTGTTAGGATGAGAAAGG - Intergenic
1088840694 11:113625111-113625133 AGTTGATGGTAGTAGGAGATGGG - Intergenic
1090088675 11:123674174-123674196 AAGTGATGATAGGCTGAGAGTGG + Intergenic
1090094167 11:123727296-123727318 AAATGATGGGAGGAGAAAAGAGG + Intronic
1090108142 11:123873951-123873973 ATGGGATGGTAGGAGGAGCGTGG + Intergenic
1090446109 11:126766184-126766206 AAGAGAGGGGAGGAGGAGAGAGG - Intronic
1090787002 11:130058350-130058372 AATTGAGGGTGGGAGGAGTGTGG - Intergenic
1090876963 11:130798814-130798836 ACGTGATGGTATGTGGAGAGGGG + Intergenic
1091134898 11:133179857-133179879 GCTTGGTGGCAGGAGGAGAGCGG + Intronic
1091358447 11:134956148-134956170 GACTAAGGGTAGGAGGAGAGAGG + Intergenic
1091946158 12:4545385-4545407 AATGGTTGCTAGGAGGGGAGAGG + Intronic
1093555372 12:20466840-20466862 AATTGATGAGAGGAAAAGAGAGG - Intronic
1094307739 12:29039697-29039719 CATTGCTGGTATGAGTAGAGAGG - Intergenic
1094332071 12:29304573-29304595 AATTGAGGGTATCAGGGGAGGGG + Intronic
1094621888 12:32087840-32087862 AAAAGATGGGAGCAGGAGAGGGG - Intergenic
1094633245 12:32198690-32198712 CCTTGACGGCAGGAGGAGAGAGG - Intronic
1095197889 12:39344272-39344294 AATTGATGATTGGATGAAAGGGG - Intronic
1095380130 12:41581141-41581163 AATTTAAGTTAGGAGGAGACTGG + Intergenic
1095648771 12:44582090-44582112 CATCGATAGTAGGAGGAGGGTGG + Intronic
1096202728 12:49697018-49697040 CATAGATGGGAGGGGGAGAGGGG + Intronic
1096826345 12:54280997-54281019 AACTCATGGTTGGCGGAGAGCGG - Intronic
1096862506 12:54539984-54540006 AACTGAGGGTGGGAGGAGAAGGG + Intronic
1098522982 12:71454524-71454546 AGGAGATGGTAGGAGGAAAGTGG + Intronic
1099027667 12:77486132-77486154 AATGAGTGGAAGGAGGAGAGAGG + Intergenic
1100332566 12:93598332-93598354 AGGTGAAGGTGGGAGGAGAGGGG + Intergenic
1101374021 12:104155245-104155267 AAATGATGGCAGGGGGAAAGGGG + Intergenic
1101465994 12:104949921-104949943 AATTGAGGGGAGGTGGGGAGGGG + Intronic
1101494547 12:105241284-105241306 TATTGAAGGTTTGAGGAGAGAGG + Intronic
1101922611 12:108945087-108945109 GATTGAGGTAAGGAGGAGAGCGG - Exonic
1102364054 12:112316125-112316147 ACGTGATAGTAGAAGGAGAGGGG - Intronic
1102631393 12:114283873-114283895 AAGAGAAGGAAGGAGGAGAGGGG + Intergenic
1104374415 12:128251105-128251127 AATGGAGGGAAGGAGGACAGAGG + Intergenic
1104573156 12:129942937-129942959 AACTGATAGGCGGAGGAGAGTGG + Intergenic
1106301374 13:28469151-28469173 AATAGAAGTTAGCAGGAGAGAGG + Intronic
1107064546 13:36198856-36198878 AATTGATGATAGAATGAAAGTGG - Intronic
1107262881 13:38516497-38516519 AATTGAAGGTAGGAAAAGATTGG + Intergenic
1107378856 13:39833975-39833997 AATTGATGGATGGATGAGAATGG + Intergenic
1107677768 13:42814611-42814633 AATTGAAGGCTGGTGGAGAGAGG + Intergenic
1108441103 13:50453647-50453669 AATTGATGGTTGGAAGAGTGAGG + Intronic
1109311637 13:60701565-60701587 AAAAGATGGGAGGAGGAGAGGGG + Intergenic
1109447524 13:62462114-62462136 TATTGATAGTAGTAGGATAGTGG + Intergenic
1109749965 13:66677630-66677652 AATGGAGGGGAGGCGGAGAGAGG - Intronic
1110511162 13:76352725-76352747 AATTGAGGGTAGGAGAACAAGGG - Intergenic
1111867176 13:93783714-93783736 ATATGATGGTAGGAGAAGATGGG - Intronic
1112875427 13:104032486-104032508 GAAAGATGGAAGGAGGAGAGAGG + Intergenic
1115222202 14:31069135-31069157 AGTGGATGGGAGGTGGAGAGTGG - Intronic
1116648350 14:47559235-47559257 ACTTGATGGTAGAGGGAGGGAGG - Intronic
1117615512 14:57530049-57530071 AATTGGTGGTAGGAGAAGGGTGG + Intergenic
1118134132 14:63002826-63002848 AAATGATGGTAGAATGAGACAGG + Intronic
1118657056 14:67963543-67963565 AAATGATGGTAAGAGAAAAGGGG - Intronic
1118657728 14:67970227-67970249 AATTAATGGTAGCAGTAGGGTGG + Intronic
1119997094 14:79265202-79265224 AAGTGAGGGTAGGAGGAATGGGG + Intronic
1121772772 14:96564254-96564276 AATTGAAAGTGGGAGGACAGTGG + Intronic
1122413766 14:101538915-101538937 CATTGTTGGCAGGAGGGGAGTGG - Intergenic
1124191057 15:27576563-27576585 AATGGATGGAAGGTGGTGAGAGG + Intergenic
1124733281 15:32218836-32218858 AAATCATGGCAGGAGGAGAAGGG + Intergenic
1125433497 15:39622342-39622364 AAATGAAGGTGGGAAGAGAGGGG - Intronic
1126913935 15:53444325-53444347 AATTAATGGTTGGAGTGGAGAGG - Intergenic
1127026847 15:54815980-54816002 AAATGATGGTATTAGGAGAAGGG - Intergenic
1128227903 15:66015190-66015212 AATTGCTGGTGAGGGGAGAGGGG - Intronic
1128682452 15:69661837-69661859 AACTGATGATAGGATGAGGGTGG + Intergenic
1128925599 15:71652465-71652487 AAATGGGGGAAGGAGGAGAGAGG - Intronic
1129099267 15:73243976-73243998 AATTGATGGAAGGTGGATATTGG - Intronic
1130313264 15:82772623-82772645 CATTGATGGTATGGGGAAAGGGG + Intronic
1130769141 15:86906911-86906933 AATTGGTTGGAAGAGGAGAGTGG - Intronic
1130991666 15:88879329-88879351 CAGTGAAGGTGGGAGGAGAGCGG - Intronic
1131459207 15:92606653-92606675 AAATGATGCTGGGAGGAGATTGG + Intergenic
1131639694 15:94278719-94278741 ACTTGAGGGTAGAGGGAGAGAGG - Intronic
1133252263 16:4490784-4490806 AATTGATGAAGGGATGAGAGGGG + Intronic
1133864628 16:9631091-9631113 ACTTTATGGTAGGAACAGAGTGG - Intergenic
1134571855 16:15298009-15298031 ACTAGAAGGTGGGAGGAGAGAGG - Intergenic
1134730529 16:16458034-16458056 ACTAGAAGGTGGGAGGAGAGAGG + Intergenic
1134936904 16:18253862-18253884 ACTAGAAGGTGGGAGGAGAGAGG - Intergenic
1135691550 16:24541055-24541077 AAATGAGGGAGGGAGGAGAGGGG + Intronic
1136124659 16:28169194-28169216 ACAGGAAGGTAGGAGGAGAGGGG - Intronic
1136639482 16:31550678-31550700 AATTTTTTGTGGGAGGAGAGTGG + Intergenic
1136665281 16:31805850-31805872 AATTTTTTGTGGGAGGAGAGTGG - Intergenic
1137322231 16:47396794-47396816 AAGGGGTGGTAGTAGGAGAGTGG + Intronic
1137541281 16:49363706-49363728 TATTCATGGTAGAAGGAGAAGGG - Intergenic
1138144189 16:54594563-54594585 AATAGATGGAAGGAGGGGAGAGG - Intergenic
1138918173 16:61493806-61493828 AATGGAAGGTAATAGGAGAGTGG - Intergenic
1139631421 16:68234164-68234186 AAGTGAGGGTAGGAGGAAGGAGG + Intronic
1139844187 16:69907913-69907935 ATATGATGCTCGGAGGAGAGGGG + Intronic
1140456922 16:75111134-75111156 AGCTGATGGGAGGAGGAGAGGGG + Intergenic
1141286272 16:82675394-82675416 AACTGATGGAAGGAGGAAATTGG + Intronic
1141713938 16:85716362-85716384 AAGGGAGGGAAGGAGGAGAGAGG + Intronic
1143091460 17:4451468-4451490 AAGTGAGGGTGGGAGAAGAGAGG + Intronic
1143212371 17:5198079-5198101 AATTGATGGCAGAAGCAGATAGG + Intergenic
1143867120 17:9932116-9932138 TAGTGATGGTGGGAGGACAGAGG + Intronic
1144726475 17:17504966-17504988 CATGGATGCCAGGAGGAGAGGGG + Intergenic
1146548833 17:33762745-33762767 ATTTGATGGTAGGAGGGCACTGG + Intronic
1147029103 17:37616224-37616246 ACTTGTTGGTAGGAGAGGAGTGG - Intronic
1148284147 17:46372991-46373013 ACTTGAGGGTAGCAGGGGAGCGG + Intergenic
1148306368 17:46590912-46590934 ACTTGAGGGTAGCAGGGGAGCGG + Intronic
1148457541 17:47819109-47819131 AAGTGTTGGTAGAGGGAGAGGGG + Intronic
1148523128 17:48301113-48301135 GATAAATGGTAGGAGGAGAGAGG - Intronic
1149348090 17:55758844-55758866 ATTTGGTGGAAGGAGGGGAGAGG + Intronic
1149577918 17:57727117-57727139 AATGGAGGGTAGGATGAGGGAGG + Intergenic
1150630261 17:66875551-66875573 AGTTGACTGTAGGAGGAGAGTGG - Intronic
1150846997 17:68669207-68669229 AATTGTTGGGAGAAGGAGGGAGG + Intergenic
1150969992 17:70016694-70016716 ATTTTATGGAAGGTGGAGAGGGG - Intergenic
1155479842 18:26273508-26273530 AATTGATAGAAGGAGAGGAGTGG - Intronic
1155532088 18:26777521-26777543 AAAAGAAGGTGGGAGGAGAGCGG - Intergenic
1156372516 18:36484328-36484350 AATTGAAGGTAGGATGTGCGTGG + Intronic
1156613406 18:38753619-38753641 GTTTGATGGTTTGAGGAGAGTGG - Intergenic
1157381372 18:47221407-47221429 AAGACATGGAAGGAGGAGAGGGG + Intronic
1157936496 18:51878974-51878996 AATAGTTGGTAGGTGGGGAGAGG - Intergenic
1160477661 18:79207387-79207409 AAGGGTTGGCAGGAGGAGAGTGG + Intronic
1160703512 19:518750-518772 GATGGGGGGTAGGAGGAGAGGGG + Intronic
1162032205 19:7922421-7922443 TAGTGATGGATGGAGGAGAGGGG - Intronic
1162718168 19:12646931-12646953 GATTGAGGGTACGAGGACAGTGG - Intronic
1162791429 19:13065084-13065106 AATGGAGGGTAGGAGGAGGAAGG - Intronic
1163684725 19:18704924-18704946 AATGGAGGGTAGTAGGAGGGTGG - Intronic
1164972281 19:32542836-32542858 AAGTGATGGTATGAGGAGGTGGG + Intergenic
1165586782 19:36923845-36923867 AAGTGAAGGTGGGAGGAGGGTGG - Intronic
1166312261 19:41969576-41969598 CATTCCTGGAAGGAGGAGAGAGG + Exonic
1166359749 19:42248207-42248229 AAGTGGTGGTAGGGGGAGGGAGG - Exonic
1166371949 19:42306832-42306854 AATTGAGGCTGGGAGGGGAGGGG + Intronic
1167161283 19:47768887-47768909 GACTGAGGGTAGTAGGAGAGAGG + Intergenic
1167226167 19:48242144-48242166 ATGTGATGATAGGAGGAGATGGG + Intronic
1167228089 19:48263135-48263157 ATATGATGATAGGAGGAGATGGG - Intronic
1167835427 19:52064565-52064587 AAATGATGGTGGGAGGTGAAGGG + Exonic
1168364661 19:55775743-55775765 AATTGATGGAAGGAAAAGGGAGG + Intergenic
1168596806 19:57684015-57684037 AATTAGTGGTAGTTGGAGAGAGG + Intronic
925491611 2:4401245-4401267 AATCAAAGGGAGGAGGAGAGAGG - Intergenic
925605291 2:5654164-5654186 CATTGATTTTGGGAGGAGAGTGG - Intergenic
925947568 2:8879912-8879934 AAGTGATGGCAGGAAGGGAGGGG + Intronic
926293344 2:11548708-11548730 AACAGAGGGTAGAAGGAGAGGGG - Intronic
927304728 2:21557745-21557767 GAATGATGTTAGGAGAAGAGGGG - Intergenic
928340003 2:30434843-30434865 AATTGCTGGGGGCAGGAGAGTGG + Intergenic
929249277 2:39735018-39735040 AATTGATTGTAGGAAGAGAAGGG - Intergenic
930265710 2:49196666-49196688 AGTTGAAGGAAGGAAGAGAGTGG - Intergenic
931819910 2:65941429-65941451 AATTCAGGCAAGGAGGAGAGAGG - Intergenic
932819368 2:74886535-74886557 AACTGGTGGAAGGAGAAGAGGGG + Exonic
935660916 2:105466235-105466257 AAGTGAGGGAAGGAGCAGAGAGG + Intergenic
936659499 2:114526800-114526822 AAGTGATGGTACCAGGAGATGGG - Intronic
936872613 2:117150512-117150534 ATTTGATCATAGAAGGAGAGTGG + Intergenic
937089795 2:119198550-119198572 AATTGGAGGTGTGAGGAGAGGGG - Intergenic
938676209 2:133637165-133637187 TATTGGTGGTAGGAGAAGTGCGG - Intergenic
939172904 2:138716275-138716297 AATGGATGGTAGTAGGAGACCGG + Intronic
939320631 2:140615598-140615620 AATTTGTGGTTGGGGGAGAGAGG + Intronic
939373003 2:141326988-141327010 AAGTGATGGTAGCAGCAAAGGGG + Intronic
939642521 2:144657525-144657547 AATTGATGGCAGGTAGAAAGAGG - Intergenic
939973470 2:148688858-148688880 ACTTTATGCTAGGGGGAGAGGGG + Intronic
940619019 2:156087309-156087331 AAGTGATGGTATTAGGAGACAGG - Intergenic
940829432 2:158452049-158452071 CATTGAAGGTAAGAGGATAGAGG - Intronic
944081917 2:195797628-195797650 AATGGTGGGTAGGAGTAGAGTGG - Intronic
944208183 2:197179330-197179352 ATTTGGTGGTAGGAGTTGAGTGG - Intronic
944547202 2:200810892-200810914 ACTCTCTGGTAGGAGGAGAGTGG - Intronic
947153684 2:227139007-227139029 AGGTGATAGTAGGAGGAGATGGG + Intronic
947395651 2:229684294-229684316 AATTGATGATAGGAGGAGCTAGG + Intronic
947985319 2:234442661-234442683 ATTTGAGGGCAGGGGGAGAGGGG - Intergenic
948281557 2:236751199-236751221 AAGTGATGGTATTAGGAGTGGGG - Intergenic
948359200 2:237406728-237406750 CAATTAGGGTAGGAGGAGAGTGG + Intronic
948682756 2:239647373-239647395 AAGTGATGGTAGTAGGAGCTAGG - Intergenic
1168748793 20:267466-267488 AAACGATGGGAGGCGGAGAGGGG + Intergenic
1170357140 20:15505413-15505435 AATTGATGGTAGGAGGAGAGGGG - Intronic
1170490092 20:16863818-16863840 CACTGATGGTGGGAAGAGAGTGG + Intergenic
1170851739 20:20011131-20011153 AAATAATGGTGGGAGGGGAGGGG - Intergenic
1172215051 20:33229695-33229717 AACTCTTGGTTGGAGGAGAGTGG - Intergenic
1172265673 20:33611110-33611132 CATTCAGGGTAGGAGGAGAATGG - Exonic
1172848560 20:37944635-37944657 GAGGGATGGTAGGAGGAGGGAGG - Exonic
1173898310 20:46567742-46567764 ATTTGATGGTGAGAGGACAGAGG - Intronic
1174122372 20:48275931-48275953 ATTTGCTGGCAGGAGGGGAGGGG - Intergenic
1174184975 20:48699962-48699984 AATGGATGGTAGAAGGAGGCAGG - Intronic
1176246830 20:64101561-64101583 AGCTGATGGTATCAGGAGAGGGG - Intergenic
1177264392 21:18764668-18764690 AAGTGCTGGGAGGAGAAGAGTGG + Intergenic
1177922149 21:27165257-27165279 AAATGAGGGTGGGAGGAGAGAGG + Intergenic
1178081404 21:29069898-29069920 AATTGGTGGTAGAAGGCAAGAGG + Intronic
1178224882 21:30704768-30704790 AATTGAGGGTGGAGGGAGAGAGG - Intergenic
1178440015 21:32591166-32591188 AATTGGAGTTATGAGGAGAGCGG + Intronic
1178744091 21:35230852-35230874 TATTAATGGTATGAGGATAGCGG + Intronic
1179100797 21:38354335-38354357 GCTTGATGGCACGAGGAGAGCGG - Intergenic
1181774445 22:25149410-25149432 AATTTCAGGGAGGAGGAGAGTGG + Intronic
1183605066 22:38863336-38863358 TATTGAACGTAGGAGGAGATTGG + Exonic
1184942728 22:47780954-47780976 AATGGATGGTTGGAGGATGGAGG + Intergenic
950145725 3:10648389-10648411 CATTGATGCTGGGAGGAGAAAGG - Intronic
950235807 3:11319383-11319405 AAGTGCTGGTAGGAGGAGGAGGG - Intronic
950341088 3:12245342-12245364 TATTGATGGTGGGAGGTAAGAGG + Intergenic
950798864 3:15533215-15533237 AAGTGATGGTATTAGGAGATAGG - Intergenic
950884090 3:16347692-16347714 AATTGAGGGTCAGAGGAGAGAGG + Intronic
951627888 3:24686521-24686543 AGATGATGGTATGAGGAGATGGG - Intergenic
953027891 3:39155095-39155117 AAATGAGGGTATGAAGAGAGAGG - Intergenic
953451596 3:43010984-43011006 ATTTGTTGGTGGGTGGAGAGGGG - Intronic
953552716 3:43916863-43916885 AGTTGATGGTATTAGGAGACAGG + Intergenic
954455860 3:50599512-50599534 ACCTGAGGGTGGGAGGAGAGAGG + Intergenic
954768430 3:52942980-52943002 GCTTGAGGGTATGAGGAGAGAGG + Intronic
957525620 3:81375287-81375309 ACTTGATGGCAGGGAGAGAGAGG + Intergenic
958911353 3:99997578-99997600 AATAGATGGTAGGGGCAGGGTGG + Intronic
959280018 3:104325573-104325595 AATTGATGTTAGGAGGTGTTGGG - Intergenic
960313855 3:116151601-116151623 AATTGGAGGTAGGAGCAGGGTGG + Intronic
960316759 3:116187933-116187955 GATGGAGGGTGGGAGGAGAGAGG - Intronic
960684462 3:120283382-120283404 AATTGGGGGAAGGGGGAGAGAGG - Intronic
960808253 3:121604844-121604866 AACAGATGGTAGGAAGAGTGAGG + Intronic
961173163 3:124813533-124813555 AATTGATGAAAGAAGGAGAGGGG - Intronic
961364370 3:126389986-126390008 AAGAGATGGGAGGAGGACAGGGG + Intergenic
965382271 3:168004701-168004723 AATGGAGGGAAGGAGGAGACAGG - Intergenic
965681093 3:171252396-171252418 AAATGAGGGGAGGAGAAGAGAGG + Intronic
966170578 3:177075640-177075662 AGTAGATGGCAGGAGGAGAGGGG - Intronic
966207842 3:177423076-177423098 AAATGTTGGTAGAAGGAAAGGGG + Intergenic
968986182 4:3875737-3875759 AATGGAGGGTAGGAATAGAGTGG + Intergenic
970062374 4:12049739-12049761 CAATCATGGTAGAAGGAGAGGGG - Intergenic
971695896 4:29902485-29902507 AATTCAAGGTAGGTGGAGAATGG + Intergenic
971727301 4:30330596-30330618 AATTGTTTGTGGAAGGAGAGAGG + Intergenic
971774291 4:30941536-30941558 AGTTGATAGTAAGAGGAGGGAGG + Intronic
972374653 4:38459192-38459214 AATGTATGGAGGGAGGAGAGAGG + Intergenic
974099787 4:57403890-57403912 AAGGGATGGTAGGAGGAGCAGGG + Intergenic
974267038 4:59598713-59598735 AATTGATGGTAGTCGGGTAGTGG + Intergenic
974979128 4:68931605-68931627 ATTTGATGGTAGAATGAGATTGG - Intronic
975247462 4:72136290-72136312 CAGTGGTGGTAGGAGCAGAGGGG + Intronic
977238596 4:94539742-94539764 GGTTGATAGTAGGAGGAAAGAGG + Intronic
977778096 4:100947167-100947189 TGTTGATGGTAGGGGGAGAGAGG + Intergenic
978070867 4:104466902-104466924 GATGGAGGGTGGGAGGAGAGAGG + Intergenic
978327339 4:107574730-107574752 AAGTGCTGGGAGGAGAAGAGTGG + Intergenic
978880373 4:113695354-113695376 AATTCAGGGGAGGAGTAGAGAGG - Intronic
979311410 4:119208520-119208542 AATTCCTTGTAAGAGGAGAGAGG + Intronic
979621157 4:122800419-122800441 CACTGATGGTGGGAGGAGATTGG + Intergenic
980330837 4:131408992-131409014 AAGTGCTGGGAGGAGAAGAGTGG - Intergenic
980364583 4:131784648-131784670 AATTTATGGTATTAGGAGATGGG + Intergenic
980731973 4:136835486-136835508 AAGTGATGGTAGTAGGAGGTGGG + Intergenic
981936142 4:150241893-150241915 ATGTGATGGTAGTAGGAGATGGG - Intronic
982371727 4:154640754-154640776 AAATGATGGTAAGATGAGAAAGG - Intronic
982410934 4:155076617-155076639 AAGTGATGGTGTTAGGAGAGGGG + Intergenic
982538675 4:156639746-156639768 AATGGATTGTAAGAGGGGAGGGG + Intronic
982997119 4:162363521-162363543 AATTGCTGGTAGCAGAAGAGTGG + Intergenic
983240828 4:165230724-165230746 AATGGATGCTAGGTGGAGATAGG + Intronic
983769947 4:171536680-171536702 ATTTGATGGTATTAGGAGATAGG + Intergenic
984045713 4:174796082-174796104 AGTTGATGGTAATAGGAGTGGGG + Intronic
985158143 4:187014582-187014604 AATTAATGGTATTAGGAGATGGG + Intergenic
987686192 5:21206280-21206302 AATTGATTCTAGGATGAGAAGGG + Intergenic
990420193 5:55624190-55624212 AATTGCTGGTAGTAGGAGTTCGG - Intergenic
990866308 5:60384537-60384559 AAATCATGTCAGGAGGAGAGAGG - Intronic
991290451 5:65029333-65029355 ATTTGAAGGTAGCAGGAGAATGG - Intergenic
991531149 5:67616267-67616289 AATTGATGGTGGGGGGTGGGGGG - Intergenic
991669551 5:69034059-69034081 TTTTTATGGTTGGAGGAGAGAGG - Intergenic
992497514 5:77308386-77308408 AAGTGAGGCTGGGAGGAGAGAGG + Intronic
994337495 5:98585226-98585248 ATTTGAGGGTAGGAAGAGAATGG + Intergenic
995046064 5:107649606-107649628 AATTGAGGGTTGGAGAAAAGAGG + Intronic
995118229 5:108505968-108505990 AATAGAGGAGAGGAGGAGAGAGG - Intergenic
995269311 5:110203358-110203380 AATTGATGGTTCGTGGAGGGAGG + Intergenic
997376066 5:133398443-133398465 ATTTAATGGTAGCTGGAGAGTGG - Intronic
997521029 5:134524874-134524896 AAGTGCTGGCAGGAGGGGAGTGG - Intronic
997902257 5:137777817-137777839 GAAGGATGGCAGGAGGAGAGAGG - Intergenic
998636169 5:143957276-143957298 ATTTTTTGGGAGGAGGAGAGAGG + Intergenic
999242831 5:150137484-150137506 AAGGGATGGGAGGAGGAGGGGGG + Intronic
999832478 5:155333651-155333673 AAGGGATGGGAGGAGGAGAGGGG + Intergenic
999943210 5:156567314-156567336 AATTAATGGGGGAAGGAGAGAGG + Intronic
1001530240 5:172456094-172456116 GATTGAGGGCAAGAGGAGAGAGG + Intergenic
1001842860 5:174894129-174894151 TATTCATGGGTGGAGGAGAGGGG - Intergenic
1001944687 5:175769227-175769249 TAGTGAGGGTAGGAAGAGAGTGG + Intergenic
1002386490 5:178871033-178871055 AGATGTTGGTAGGAGGGGAGGGG - Intronic
1004802231 6:19162029-19162051 TATTGATGATGGGAGGAGAATGG - Intergenic
1006927016 6:37662176-37662198 AATAGATGGGAGGAGGGGTGAGG + Intronic
1007188057 6:39989451-39989473 AGGGGAGGGTAGGAGGAGAGAGG - Intergenic
1007377033 6:41464067-41464089 GATGGATGGGAGGTGGAGAGGGG + Intergenic
1008138916 6:47809203-47809225 AATTCATGGTCTGAGGTGAGGGG + Intronic
1008903446 6:56649569-56649591 TATTGATGGGGGGAGGTGAGTGG + Intronic
1010520001 6:76820996-76821018 AAAAGATGGGAGGATGAGAGGGG - Intergenic
1011241158 6:85272731-85272753 ACTTCAGGGCAGGAGGAGAGAGG - Intergenic
1011429458 6:87269807-87269829 AGGGGAAGGTAGGAGGAGAGAGG - Intergenic
1011738632 6:90337263-90337285 AACTGAGGGCAGGAGGAGATGGG - Intergenic
1012352076 6:98264265-98264287 ATTCGATGGTATGAGGAGATGGG - Intergenic
1012639922 6:101597222-101597244 AATAGAGGGGAGGAGGAGGGAGG + Intronic
1013606153 6:111750630-111750652 AAATGAGGAAAGGAGGAGAGAGG - Intronic
1013943528 6:115694456-115694478 AATTGAAGGTGGGGGGAAAGTGG - Intergenic
1015975578 6:138787196-138787218 AGGTGATGGTAGGAGGAGATGGG + Intronic
1018220801 6:161577032-161577054 AATTGAAGGGAAGAGGAAAGAGG + Intronic
1018312697 6:162527114-162527136 AATCGAAGGTAGGAGGAGCCAGG + Intronic
1018946227 6:168348199-168348221 AAGGGATGGGTGGAGGAGAGGGG - Intergenic
1018964558 6:168474351-168474373 AAATGCTGGAAGGAGGAGCGGGG - Intronic
1021128192 7:16879187-16879209 AATTGTTGGAAGGATGAGAAAGG - Intronic
1021341327 7:19466059-19466081 AAATGATGATAAGACGAGAGGGG - Intergenic
1022340361 7:29461863-29461885 GATGGATGGAAGGAAGAGAGAGG + Intronic
1022997498 7:35772427-35772449 GATTGGTGGTAGGAATAGAGAGG - Intergenic
1023053340 7:36272403-36272425 AAGTGAAGTTAGGAGGAGGGAGG - Intronic
1023912798 7:44567397-44567419 AATGGATTGAAGGAGGAGAGTGG - Intronic
1024129547 7:46336578-46336600 ATGGGATGGTAGGAGGAGCGTGG + Intergenic
1026229922 7:68473660-68473682 AACTGAGGATTGGAGGAGAGAGG - Intergenic
1027508922 7:79054580-79054602 AGTTTATGGTATGAAGAGAGTGG - Intronic
1028123528 7:87084869-87084891 ACATGATTGTAGGAGGAGACAGG - Intergenic
1029055936 7:97742858-97742880 TATGGATGGGAGGAGGAGAGTGG + Intergenic
1029364131 7:100106536-100106558 AAGTGAATGTGGGAGGAGAGGGG - Intronic
1030807920 7:113938720-113938742 GGTGGAGGGTAGGAGGAGAGAGG - Intronic
1031181957 7:118430724-118430746 ACTTGAGGGTAGAAGGTGAGAGG - Intergenic
1032479652 7:132236089-132236111 AATTGAGAGTAGCAGGAGAGAGG + Intronic
1033064241 7:138138362-138138384 CATTTATGGTAGGAGGTGAAGGG + Intergenic
1033165663 7:139036374-139036396 AAAAGGTGGTAGGAGGTGAGTGG + Intergenic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1034470836 7:151253565-151253587 AACTGCTGGTGGCAGGAGAGCGG + Intronic
1034924177 7:155107760-155107782 ATGTGATGGTAGTTGGAGAGGGG + Intergenic
1035058998 7:156055367-156055389 AAGTGAGGGTAGGAGGGAAGGGG - Intergenic
1037878625 8:22561817-22561839 CATTGAAGGTGGGAGGAGACAGG - Intronic
1039087672 8:33796004-33796026 ATTCTATGGCAGGAGGAGAGAGG - Intergenic
1039671993 8:39612256-39612278 AATTGAGGGTGGGTGGAGGGAGG + Intronic
1040380138 8:46864613-46864635 AATTGAAGGCAGGAAGAGAGTGG + Intergenic
1040549630 8:48428231-48428253 AATTGGTGGGAGGTGGAGGGTGG - Intergenic
1040584984 8:48731439-48731461 ACTTGGTGGGAGGAGTAGAGAGG - Exonic
1040845618 8:51835236-51835258 TATTAAGGGTAGAAGGAGAGGGG - Intronic
1045697790 8:104829827-104829849 AATGCATGGTTGGAGGGGAGTGG + Intronic
1045891305 8:107161033-107161055 AAAAGATGGAAGAAGGAGAGAGG - Intergenic
1047033463 8:120909783-120909805 ACTTGATGGTGGAAGGTGAGAGG + Intergenic
1047391528 8:124455861-124455883 AAGTGAGGGTAGGAGGAGTAGGG + Intronic
1047569772 8:126085118-126085140 AGTTGAGAGTAGGATGAGAGTGG - Intergenic
1047597620 8:126394771-126394793 AATGGAGGGTGGGAGTAGAGAGG - Intergenic
1047682108 8:127264745-127264767 AATAGAAGGTAAGTGGAGAGAGG - Intergenic
1048232792 8:132660122-132660144 AAATGAAGGTAGGAGCAGAAAGG - Intronic
1048639143 8:136333539-136333561 CATTCCTGGTAGGAGGTGAGGGG - Intergenic
1050289398 9:4138513-4138535 TTTTAATGGCAGGAGGAGAGGGG + Intronic
1050844368 9:10195624-10195646 AATAGATGGTTGGATGACAGAGG - Intronic
1050950208 9:11581443-11581465 ATTTGATGGTATTAGGAGATAGG - Intergenic
1051103332 9:13548253-13548275 AATTAATGGTAGAGGGAGAATGG - Intergenic
1051267179 9:15320352-15320374 AAGTTATGGTGGGAGGTGAGTGG - Intergenic
1051995390 9:23209771-23209793 TAATGAAGGCAGGAGGAGAGAGG - Intergenic
1052359083 9:27534924-27534946 AATTGCAGGTAGGATAAGAGGGG - Intergenic
1053025009 9:34722205-34722227 GAGTGATGGTAGCAGTAGAGAGG + Intergenic
1054865434 9:69995728-69995750 AGGTGATGGTATGAGGAGATGGG + Intergenic
1055607544 9:77986458-77986480 GAATGATGGTAGGAGGAGCCAGG - Intronic
1055728485 9:79257323-79257345 AATTAATTGGAGGAGGAGAGAGG - Intergenic
1055803737 9:80069472-80069494 AATTGATGGTATTAGGAAGGGGG + Intergenic
1058345082 9:103951397-103951419 ATTTGATGGTGAGAGGAAAGGGG - Intergenic
1059501617 9:114758967-114758989 AAATGGGGGTAGGAGGAGAGGGG - Intergenic
1060320251 9:122552495-122552517 AAGTGATGGAAGGGAGAGAGTGG + Intergenic
1060760653 9:126245462-126245484 AATGGGTTGTAGGAAGAGAGAGG + Intergenic
1186158908 X:6755831-6755853 AGTTGATGGTAACACGAGAGAGG + Intergenic
1186239623 X:7552541-7552563 CTTTGATGGGAGGAGGGGAGGGG - Intergenic
1186429407 X:9491795-9491817 ACTTGAGGGTAGGAGAAGAAAGG - Intronic
1186596320 X:10985453-10985475 AATTGATGGTGGGTGGAGGATGG - Intergenic
1189152359 X:38721379-38721401 AAGTCATTATAGGAGGAGAGGGG + Intergenic
1189610466 X:42727961-42727983 TGTGGAGGGTAGGAGGAGAGAGG + Intergenic
1190138179 X:47816194-47816216 AATGGAAAGTAGGAGGAAAGGGG + Intergenic
1192042375 X:67636251-67636273 GAGTGATGGTAAGAGGAAAGAGG - Intronic
1192125292 X:68496136-68496158 CTTTGAGGGTAGGAGAAGAGGGG + Intergenic
1192305413 X:69954186-69954208 AATAAGTGGTAGGAGGTGAGAGG - Intronic
1192307822 X:69982074-69982096 AATTCATGGTTTCAGGAGAGAGG - Intronic
1192617814 X:72646256-72646278 AATTGGTTGTAAGAGTAGAGGGG + Intronic
1193360250 X:80572504-80572526 AACTGGTGGAAGGAGAAGAGGGG - Intergenic
1194809466 X:98373042-98373064 ACTGGATGGTTAGAGGAGAGAGG + Intergenic
1194955521 X:100174715-100174737 AATTGATGATTGGAAAAGAGAGG - Intergenic
1195001122 X:100644443-100644465 AATTGATGAGAGGAGCAGAGAGG + Exonic
1195027319 X:100890122-100890144 AAGTGAGGGTAGGTGGGGAGAGG + Intergenic
1195866738 X:109440369-109440391 AATTGATGGTATAAAGAGATGGG - Intronic
1196160633 X:112478727-112478749 TAATGATGGTGGGAGGAAAGAGG - Intergenic
1198217533 X:134569698-134569720 AATTGCAGGTAGCAGGAGAAGGG - Intronic
1198813197 X:140557751-140557773 AAGTGATGTGAGGAGGGGAGAGG + Intergenic
1200981796 Y:9269394-9269416 GATTGATGGTAGGTGGGAAGTGG - Intergenic
1201653335 Y:16315603-16315625 TAATGATGGTAGAAGGAGAAAGG + Intergenic