ID: 1170364503

View in Genome Browser
Species Human (GRCh38)
Location 20:15584714-15584736
Sequence GGCTGGTTACCACCTTCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 81}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170364486_1170364503 25 Left 1170364486 20:15584666-15584688 CCCTTCCTTGCGTAGTGTACCCA 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1170364503 20:15584714-15584736 GGCTGGTTACCACCTTCCCGTGG 0: 1
1: 0
2: 0
3: 8
4: 81
1170364494_1170364503 6 Left 1170364494 20:15584685-15584707 CCCACAGGGGGCACTGGTACCCA 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1170364503 20:15584714-15584736 GGCTGGTTACCACCTTCCCGTGG 0: 1
1: 0
2: 0
3: 8
4: 81
1170364495_1170364503 5 Left 1170364495 20:15584686-15584708 CCACAGGGGGCACTGGTACCCAT 0: 1
1: 0
2: 0
3: 14
4: 165
Right 1170364503 20:15584714-15584736 GGCTGGTTACCACCTTCCCGTGG 0: 1
1: 0
2: 0
3: 8
4: 81
1170364487_1170364503 24 Left 1170364487 20:15584667-15584689 CCTTCCTTGCGTAGTGTACCCAC 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1170364503 20:15584714-15584736 GGCTGGTTACCACCTTCCCGTGG 0: 1
1: 0
2: 0
3: 8
4: 81
1170364489_1170364503 20 Left 1170364489 20:15584671-15584693 CCTTGCGTAGTGTACCCACAGGG 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1170364503 20:15584714-15584736 GGCTGGTTACCACCTTCCCGTGG 0: 1
1: 0
2: 0
3: 8
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170364503 Original CRISPR GGCTGGTTACCACCTTCCCG TGG Intronic
900211740 1:1459622-1459644 TGCTGGTGTCCAACTTCCCGTGG - Intronic
900224549 1:1526922-1526944 TGCTGGTGTCCAACTTCCCGTGG - Intronic
902354353 1:15886410-15886432 GGCTGCTTGCCACCTCCCGGAGG + Intronic
905231307 1:36516357-36516379 GCCTGGTCACCACCTTCCCCTGG + Intergenic
907241999 1:53086026-53086048 AGCTGGGTACCACCTCCCGGTGG - Intergenic
908021691 1:59904870-59904892 GGCTGGGTACCACCTGCCCAAGG - Exonic
913267706 1:117060761-117060783 GGCTGGTTACCCCCCTCTCTGGG + Intronic
916415051 1:164584741-164584763 GGCTGGACACAACCTTCCAGTGG + Intronic
917553483 1:176058823-176058845 GGCGTGTTACCACATTCCAGAGG - Intronic
919584817 1:199423415-199423437 GGCTGTTTACTTCCTTCCCCAGG - Intergenic
920585733 1:207158152-207158174 GGCTGGCTATCACCTCCCCGTGG - Intergenic
923685237 1:236148910-236148932 GGCTGGTTACCACCTCTCTAAGG + Intronic
1066491524 10:35899364-35899386 GGCTGGATACTACCTTTCCAGGG + Intergenic
1067433064 10:46256601-46256623 GGCTGGGTACCCCCTTTCCCAGG + Intergenic
1067440201 10:46304823-46304845 GGCTGGGTACCCCCTTTCCCAGG - Intronic
1075048186 10:119162681-119162703 GAATGGTTACCACCATCCCCTGG + Intronic
1075416034 10:122265151-122265173 GGCTGGTCACCACCAACCTGGGG - Intergenic
1079085599 11:17442753-17442775 GGCTGGTCATCTCCTTCCTGCGG + Exonic
1087825900 11:102764471-102764493 GTCTGGTTACCACCATTCTGTGG + Intergenic
1092712592 12:11353780-11353802 GGCTGGTTACCTCCTTGTGGGGG + Exonic
1100713687 12:97283717-97283739 GCCTGGTAACCACCTTGCTGTGG + Intergenic
1102443047 12:112978238-112978260 GGCTGGTCACCACGCTGCCGGGG + Intergenic
1103216061 12:119202288-119202310 GGCTGCCTTCCTCCTTCCCGAGG - Intronic
1110254081 13:73412477-73412499 GGCTGGTTACCAGCATACAGAGG + Intergenic
1121643886 14:95504634-95504656 GACTGGGTCCCACCTTCCCAGGG + Intergenic
1122006184 14:98705839-98705861 GGCTGTTCACCACCTTCCCTGGG + Intergenic
1129698773 15:77755637-77755659 TTCTGGTTAACACCTTCCCAAGG + Intronic
1130553164 15:84904928-84904950 GTGTGGCTACCACCTTCCCCAGG + Intronic
1132242115 15:100265956-100265978 GGCTGGTTCCCACACTCCGGTGG - Intronic
1139549655 16:67666484-67666506 GGCTGTTTACCTCCCTCCCCGGG + Exonic
1142150954 16:88512350-88512372 GGCTGGTGCCCACCTTTCCAGGG - Intronic
1144779494 17:17800706-17800728 TCCTGGTTCCGACCTTCCCGGGG - Intronic
1145118312 17:20232370-20232392 TGCTGGTGACCACCCTGCCGTGG - Exonic
1146724664 17:35147655-35147677 GGCTGGTCAGCACCTCCACGTGG + Intergenic
1152276411 17:79360401-79360423 GGCTGGTGAGCAGCTTCCAGTGG - Intronic
1153227546 18:2909894-2909916 GGCTGGTTCCCAGCGTCCCGTGG + Intronic
1155416494 18:25605031-25605053 GGCTGGGGCCCACCTTCCCTGGG + Intergenic
1165487581 19:36104817-36104839 AGCTGGTCTCCACCTTCCTGTGG + Exonic
1166957221 19:46472560-46472582 GGCTGGTTACCCACTTCCACAGG + Intergenic
1167977681 19:53243734-53243756 GGGTGGTTACCATCTTCTGGAGG + Exonic
936152486 2:110029491-110029513 GGCTGCTGACCATCTTCCAGAGG - Intergenic
936192194 2:110341921-110341943 GGCTGCTGACCATCTTCCAGAGG + Intergenic
936291571 2:111228237-111228259 GGCTGGTGCCCACCTTTCAGAGG - Intergenic
1169389446 20:5177738-5177760 GGCTGGGCACCCCCTTCCTGAGG + Intronic
1170364503 20:15584714-15584736 GGCTGGTTACCACCTTCCCGTGG + Intronic
1176172403 20:63701883-63701905 CGCTGGTCACCACCTTCTCTGGG + Exonic
1178918883 21:36725420-36725442 TGCTGCTTACCACCTTCCAATGG - Intronic
1179715191 21:43282673-43282695 GGCTGGTTCCCACCGACCCACGG - Intergenic
1180177660 21:46098273-46098295 GGCTGGAGTCCCCCTTCCCGGGG - Intronic
1182093809 22:27613239-27613261 GACTGGCTACCACCTGCCCAGGG - Intergenic
1182477598 22:30584639-30584661 TCCTGTTTTCCACCTTCCCGCGG - Exonic
1184214766 22:43059437-43059459 TGCTGGTCACCTCCTTGCCGCGG + Exonic
950129018 3:10529075-10529097 TGCTACTTCCCACCTTCCCGGGG + Intronic
953797306 3:45995519-45995541 GGCCGGCTTCCACCTGCCCGAGG + Intronic
955701467 3:61686057-61686079 TGCTCGTTACCTCATTCCCGTGG + Intronic
955851050 3:63220384-63220406 GGCTGGTTACTAGATTCCTGGGG + Intergenic
962258481 3:133887773-133887795 GGCTGGTTCCCACCTACTCTGGG - Intronic
968061253 3:195727571-195727593 AGCTTGTTACCACCTTTCTGGGG + Intronic
969372968 4:6746023-6746045 GGGTTGTTGCCACCTTCCCTTGG + Intergenic
969639442 4:8388196-8388218 GGCTGGTGACCACCTTGCAGGGG - Intronic
970239003 4:13988705-13988727 GACTGGATCCCAACTTCCCGAGG + Intergenic
970880492 4:20923632-20923654 GACTGGTTTCCACCTTTCCATGG + Intronic
977961107 4:103086767-103086789 GGGGGATTACCACCTTCCCATGG + Intronic
980977342 4:139623898-139623920 GGCTGGTAACCACATTGCAGTGG + Intergenic
987677816 5:21097933-21097955 GGCTGAATACCACTTTCCTGAGG + Intergenic
988327990 5:29796196-29796218 GTATGGTTACCAGCTCCCCGGGG - Intergenic
991486603 5:67143701-67143723 GACTGGCTACCACCTTCTCCAGG - Intronic
993605644 5:89987610-89987632 GGCTGGTTACCACCTGTTCTGGG + Intergenic
999827567 5:155288741-155288763 GGCTGGTTTCCACATTCCCAAGG - Intergenic
1002471139 5:179436865-179436887 GCATGGTTAGCACCTTCCCAGGG - Intergenic
1003426342 6:6000435-6000457 GGCTGGTCCCCACCTGCCCCGGG + Intronic
1004463563 6:15862108-15862130 GTCTGGTGACCACCTTCCCATGG - Intergenic
1006562238 6:34923553-34923575 GTCTGGTTACCTACTTCCCAGGG - Intronic
1022611509 7:31879085-31879107 GGCTGGCCTCCACCTTCACGCGG - Exonic
1023622769 7:42089605-42089627 GGCTGGGTACACCCTTCCCATGG + Intronic
1023751381 7:43376384-43376406 GGCTGGCTACCCCCATCCCAGGG - Intronic
1023995033 7:45154602-45154624 AGCTGTTTTCCACCTTCCCACGG - Intergenic
1025083611 7:56004997-56005019 CCCTGGTGGCCACCTTCCCGTGG - Intergenic
1036677951 8:10850719-10850741 GCCGGGTTACCTCCTTCCCTGGG - Intergenic
1037970813 8:23170629-23170651 GGCTGGTTCCCCCCACCCCGAGG - Intergenic
1043815355 8:84794349-84794371 GACTGATTACCTCCTTCCCCAGG + Intronic
1048994757 8:139787470-139787492 GCCCGGTTCCCACCTTCCCTTGG - Intronic
1049714524 8:144083558-144083580 GGCTGGGTATCACCTTGCGGGGG + Intronic
1060260042 9:122066471-122066493 TGCTGGTTTCCATCTTTCCGTGG - Intronic
1061361302 9:130144025-130144047 GGCTGGTTTCCACCCTGCCACGG + Intergenic
1061858549 9:133456160-133456182 GGAGGGTCACCACCTCCCCGAGG - Exonic
1190007552 X:46755040-46755062 GGCTGCTTTCAACCTTCCTGGGG + Intronic
1191104133 X:56761845-56761867 GGCTGATTACCTCCTTTCCCTGG + Intergenic
1195863950 X:109409520-109409542 GGGTGGTTACCAGCTTCTAGAGG - Intronic
1199706327 X:150428546-150428568 GGCTGTGTACCATCTTCCCATGG - Intronic