ID: 1170367722

View in Genome Browser
Species Human (GRCh38)
Location 20:15616044-15616066
Sequence AGGTATACACCCCTGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170367713_1170367722 28 Left 1170367713 20:15615993-15616015 CCAAAGTGGAAAGCTGGTATTTG 0: 1
1: 0
2: 2
3: 13
4: 184
Right 1170367722 20:15616044-15616066 AGGTATACACCCCTGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170367722 Original CRISPR AGGTATACACCCCTGGTGGG TGG Intronic
No off target data available for this crispr