ID: 1170369397

View in Genome Browser
Species Human (GRCh38)
Location 20:15632111-15632133
Sequence CAAATTTCATTTTGTTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2870
Summary {0: 1, 1: 1, 2: 14, 3: 228, 4: 2626}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170369397 Original CRISPR CAAATTTCATTTTGTTGCCC AGG (reversed) Intronic
Too many off-targets to display for this crispr