ID: 1170370627

View in Genome Browser
Species Human (GRCh38)
Location 20:15644253-15644275
Sequence GTTTAGATGCTGGAGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170370627_1170370639 30 Left 1170370627 20:15644253-15644275 CCCACCACCTCCAGCATCTAAAC 0: 1
1: 0
2: 1
3: 17
4: 252
Right 1170370639 20:15644306-15644328 AGAGAATCATCCCTCTCTGCAGG 0: 1
1: 0
2: 1
3: 11
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170370627 Original CRISPR GTTTAGATGCTGGAGGTGGT GGG (reversed) Intronic
902144832 1:14389883-14389905 GGATAAATGCTGGAGGTGATGGG + Intergenic
903841190 1:26242056-26242078 GTTTAAATGCTGAAGTTGGCCGG - Intronic
904121789 1:28203256-28203278 GGTTATATGCTTCAGGTGGTTGG - Intronic
906285094 1:44581956-44581978 GCATAGATGCTGGTGCTGGTGGG - Intronic
907807671 1:57837768-57837790 GTGAAGGTGGTGGAGGTGGTAGG - Intronic
911459296 1:98169364-98169386 ATTTAGATGAAGAAGGTGGTGGG - Intergenic
911635918 1:100236239-100236261 GTATAGAAGCTGGGTGTGGTGGG - Intronic
912586015 1:110766594-110766616 GTTGAGATTCTGGAGGCTGTTGG + Intergenic
912702433 1:111888225-111888247 GAGAAGAAGCTGGAGGTGGTGGG + Intronic
913223308 1:116676820-116676842 GTGGTGATGATGGAGGTGGTGGG + Intergenic
913255043 1:116945245-116945267 GTTGAGAGGTTGGAGGTGGGCGG + Intronic
914758045 1:150577321-150577343 GTTTTGGTGGTGGTGGTGGTTGG + Exonic
915646450 1:157276208-157276230 GTTTAGTTTGTGGAGGTGGGAGG + Intergenic
917380090 1:174396893-174396915 GTTTGGAAGGTGGAGGTGGGAGG + Intronic
917558409 1:176116879-176116901 GTTTATATGTTTGAGGTGGTGGG - Intronic
920422237 1:205842878-205842900 GTTGAGTTGGTGGAGGTGGGAGG - Intronic
921597331 1:217068880-217068902 TTTTAAATGCTGGACGTGGAGGG - Intronic
924599640 1:245477393-245477415 GCTTAGATCCTGGTGGGGGTGGG + Intronic
924859631 1:247907786-247907808 GTTAATACTCTGGAGGTGGTGGG + Intergenic
1063518159 10:6716748-6716770 GTAAAGATGCTGAAGGAGGTAGG + Intergenic
1064861110 10:19827084-19827106 GTTTACATGCAGGAGATGCTTGG + Intronic
1065125812 10:22573048-22573070 TTCTAGATGCTGGAAGTGATGGG - Intronic
1067157321 10:43792972-43792994 GTTTCCAGGCTGGACGTGGTGGG + Intergenic
1068362670 10:55999012-55999034 TGATAAATGCTGGAGGTGGTGGG + Intergenic
1069832308 10:71288857-71288879 GATGAGATGATGGATGTGGTGGG - Intronic
1070612707 10:77944665-77944687 GTGTCGATGCTTGTGGTGGTAGG + Intergenic
1071692639 10:87838281-87838303 GTTTAGAAGGCCGAGGTGGTCGG + Intronic
1072255496 10:93616574-93616596 GTTTAGGAGCTGGATATGGTTGG + Intronic
1073740632 10:106402222-106402244 GGATAGATGCTTGAGGTGATGGG + Intergenic
1074322355 10:112414930-112414952 GTTAAAATCTTGGAGGTGGTTGG - Intronic
1075247820 10:120839744-120839766 ATTTTGATGCTAGAGTTGGTGGG + Intergenic
1076042482 10:127262550-127262572 GTTTAGAAGCTGGATCAGGTGGG + Intronic
1076043980 10:127275754-127275776 GTGTAGATGTAGGTGGTGGTTGG + Intronic
1078615496 11:12861648-12861670 GTTTGTATGCTGTGGGTGGTGGG - Intronic
1079085373 11:17441092-17441114 TTTTAGTTGGAGGAGGTGGTCGG + Intronic
1079105065 11:17565810-17565832 GTGTATATGCTAGTGGTGGTGGG + Intronic
1079349259 11:19678906-19678928 GTTTAGCTCGTGGAGGTGGTGGG - Intronic
1081611659 11:44566490-44566512 GTTCTGTTCCTGGAGGTGGTGGG + Intronic
1084415144 11:69027745-69027767 ATCTAGAAGCTGGAGGTGGTAGG + Intergenic
1085122224 11:73974539-73974561 GATTGGATGCTGGAGGTGGAAGG + Intergenic
1085390675 11:76180555-76180577 GTGTATGTGCAGGAGGTGGTGGG + Intergenic
1087503711 11:98993584-98993606 GTGCAGATGCTGGTGATGGTTGG + Intergenic
1088899958 11:114108307-114108329 CTCTAGATGCTGGAGATGATAGG - Intronic
1091198306 11:133750524-133750546 GTTTTGTTGTTGGTGGTGGTGGG + Intergenic
1092114475 12:5989139-5989161 GTGGAGCTGCTGGTGGTGGTGGG - Intronic
1093094060 12:14952603-14952625 GTGTAGATGTTGTAGGTTGTGGG + Intronic
1093524017 12:20085675-20085697 ATTTAGATGCTTGAGGGGATGGG - Intergenic
1094367776 12:29702402-29702424 GTTCAGTTCCTTGAGGTGGTTGG + Intronic
1099346541 12:81507606-81507628 GGTTATATGCTGGATGTGTTTGG - Intronic
1099633517 12:85181086-85181108 GTATATATACTGGGGGTGGTAGG - Intronic
1099825802 12:87776133-87776155 GTTTAGGTCCTGGTGGGGGTTGG - Intergenic
1100025376 12:90121918-90121940 ATTTGGATGCTGGCTGTGGTGGG + Intergenic
1100440068 12:94608820-94608842 GAGTAGATGGTGGAGGTGGAAGG - Intronic
1100574122 12:95873521-95873543 GTGGAGATTCTTGAGGTGGTAGG + Intronic
1101032946 12:100677886-100677908 GTGGAAATGGTGGAGGTGGTAGG - Intergenic
1102361993 12:112296138-112296160 GTGTAGGTGCAGCAGGTGGTAGG + Intronic
1105205324 13:18218436-18218458 GTTTGGAAGGTGGAGGTGGGCGG - Intergenic
1106519872 13:30487202-30487224 GTGTAGATGTTGTAGGTAGTTGG - Intronic
1107094500 13:36520297-36520319 AATTAGAGTCTGGAGGTGGTAGG - Intergenic
1108135502 13:47353152-47353174 GATTAGACACTGGAGGTGTTTGG - Intergenic
1112029956 13:95447903-95447925 GCTTTGATGCTGCAGGTGGGAGG - Intronic
1112547354 13:100383725-100383747 TCTTAGATGCTTGAGGTGGAAGG + Intronic
1115379466 14:32718868-32718890 GTTTAAATGTAGGAGGTTGTTGG - Intronic
1116525137 14:45894831-45894853 GTTAAGGGGCTGGGGGTGGTCGG + Intergenic
1116909166 14:50439790-50439812 GTTTAGATGCTGGGTGGGTTTGG + Intronic
1117206574 14:53449766-53449788 GTTTAGTTTTAGGAGGTGGTGGG + Intergenic
1117736140 14:58770713-58770735 GGTGAGATGAAGGAGGTGGTGGG - Intergenic
1118737336 14:68711458-68711480 ATTTAGGTGCTGTAGGAGGTGGG - Intronic
1120740421 14:88102956-88102978 TTTTAGTTGCTTGAAGTGGTAGG + Intergenic
1124098657 15:26672614-26672636 GTTCAGGGGCTGGAGGTGGAGGG - Intronic
1127887020 15:63210557-63210579 GTTGGGAAGCTGGAGGTGGAAGG - Intronic
1129412670 15:75358663-75358685 GTGGGGATGGTGGAGGTGGTGGG - Intronic
1130444548 15:83988256-83988278 ATTTTCATGCTGGAGGTGATTGG - Intronic
1130575615 15:85090693-85090715 GTTTAGATGGGGGTGGGGGTGGG - Intronic
1131280049 15:91013777-91013799 GTTTGGATCCTGGAGGAAGTGGG - Intronic
1132406173 15:101542908-101542930 TTTTAGGTGCTGGAGATGGCAGG - Intergenic
1135875476 16:26196129-26196151 CTTTTAATGCTGGAGGTGGGGGG - Intergenic
1137798237 16:51239723-51239745 GTGGTGATGGTGGAGGTGGTGGG + Intergenic
1137798253 16:51239782-51239804 GTGGTGATGGTGGAGGTGGTGGG + Intergenic
1137976814 16:53039075-53039097 GTTTAGAGGATGGAGTTGGGAGG - Intergenic
1138330988 16:56215068-56215090 GTATGGAGGCAGGAGGTGGTGGG - Intronic
1139671219 16:68493370-68493392 GGTTTGATGCTGGAAGTGCTTGG - Intergenic
1139797850 16:69497634-69497656 GTTTAGGAGCTGGGGCTGGTGGG - Intergenic
1140208613 16:72953439-72953461 GATTTGATGCTTCAGGTGGTTGG - Intronic
1141033006 16:80606154-80606176 GGCTAGAGGCTGCAGGTGGTGGG + Intronic
1141839545 16:86566005-86566027 GTTTCGAAGCTGAAGTTGGTAGG + Intergenic
1143385988 17:6530794-6530816 ATTTAGATGCTGGAGGGGGTTGG + Intronic
1143442686 17:6987634-6987656 GTTAAGATGCTGGAGGCCTTGGG - Intronic
1146182231 17:30705828-30705850 GCTGGGATGCTGGAGGTGCTAGG + Intergenic
1148636346 17:49152002-49152024 GTTTAGCTGCTGCAGCTGGGTGG + Intronic
1149361404 17:55899374-55899396 GTATGGCTGGTGGAGGTGGTGGG - Intergenic
1149399488 17:56280424-56280446 GTGTAAATCCTGGAGGTGGAAGG - Intronic
1150699169 17:67432928-67432950 GCTTATATTCTGGAGGTGGGAGG + Intronic
1150861878 17:68808930-68808952 GTTTAGAAGCTGTAGGTTGTGGG + Intergenic
1151312224 17:73300288-73300310 GCTTGGAGGCTGGGGGTGGTGGG - Intronic
1152079558 17:78178267-78178289 CTTCAGATGCTGGTGGTGGGTGG - Intronic
1153203713 18:2673099-2673121 TTTTTGATGCTGGTGGTGATTGG + Intronic
1154318813 18:13327727-13327749 GTTGAGAAGCCGGAGATGGTGGG + Intronic
1154424935 18:14264938-14264960 GGGTGGATGCTGGGGGTGGTGGG + Intergenic
1154432624 18:14320162-14320184 GGGTGGATGCTGGGGGTGGTGGG + Intergenic
1155056484 18:22188266-22188288 GTTTAAAACATGGAGGTGGTAGG + Intronic
1155255394 18:23992914-23992936 GTGTAGGTGCTGGAGGGGTTAGG - Intronic
1157763765 18:50282816-50282838 GTTTTGGTGCTGCATGTGGTAGG - Intronic
1157898712 18:51492968-51492990 GTTTAGATGAGGGAGTAGGTTGG - Intergenic
1159255189 18:65935819-65935841 ATTGAGATGCTGGAATTGGTTGG + Intergenic
1159700773 18:71623890-71623912 GCTGTAATGCTGGAGGTGGTCGG + Intergenic
1160541582 18:79626929-79626951 GTGCAGATTCTGGAGGTGGGTGG - Intergenic
1161397702 19:4053169-4053191 GTTGAGCTGCGGGAGGTGGGCGG - Intronic
1162976601 19:14209974-14209996 GCTGGGATGCTGGAGGTGCTAGG - Intergenic
1163416446 19:17189709-17189731 TTTTAGATGGTCGAGGTGGCTGG - Intronic
1168126464 19:54286128-54286150 GTTCAGATGCTGGCTGTGATGGG - Intergenic
1168175430 19:54624736-54624758 GTTCAGATGCTGGCTGTGATGGG + Intronic
925170420 2:1746794-1746816 GTTGGGATGCTGCAGGTGGATGG - Intergenic
925609978 2:5694153-5694175 GTGTTGATGGTGGCGGTGGTAGG + Exonic
925866473 2:8232383-8232405 GTGGAGATGCTGGAACTGGTGGG - Intergenic
926780675 2:16468556-16468578 GGTCAGAAGCTGGAGATGGTTGG - Intergenic
927631208 2:24775706-24775728 TTTGAGGTGCTGGAGGTGGGAGG - Intergenic
928044362 2:27913020-27913042 CTTTAGATGCTGAAGGTCCTTGG - Intronic
928351810 2:30564005-30564027 GTTGAGATTCTAGAAGTGGTTGG + Intronic
929173335 2:38953531-38953553 GCTTACATGCTGTATGTGGTGGG + Intronic
929729405 2:44471449-44471471 ATTTAGCTGGTGGTGGTGGTGGG + Intronic
929852056 2:45600926-45600948 GTTCAGATGGTGGTGGTGGCAGG - Intronic
936020947 2:108994349-108994371 GCTTACATAATGGAGGTGGTGGG - Intergenic
937202244 2:120211297-120211319 GGGTAGAAGCTGGAGGAGGTTGG - Intergenic
938127639 2:128686080-128686102 GTTTGGGGGCTGCAGGTGGTGGG - Intergenic
938279976 2:130056941-130056963 GTTTGGAAGGTGGGGGTGGTTGG - Intergenic
938330934 2:130447656-130447678 GTTTGGAAGGTGGGGGTGGTTGG - Intergenic
938359015 2:130673847-130673869 GTTTGGAAGGTGGGGGTGGTTGG + Intergenic
938435408 2:131280496-131280518 GTTTGGAAGGTGGGGGTGGTTGG + Intronic
939442001 2:142261465-142261487 GTTAAAATGTTAGAGGTGGTAGG + Intergenic
940932945 2:159457647-159457669 TTTAAGATCCTGGAGGTGGTAGG - Intronic
941362017 2:164563085-164563107 GTTTAGATGGTGGACTTGCTTGG - Intronic
942688507 2:178560160-178560182 GTTTGGATGGAGGAGATGGTAGG + Exonic
942809619 2:179982397-179982419 GTTTTTATACTGGAGGTGATGGG + Intronic
942975974 2:182018219-182018241 GTTTCTATGCTGGATGTGTTAGG + Intronic
943556649 2:189414033-189414055 GTTTGGGTGGTGGAGGTGGCCGG - Intergenic
944852053 2:203729695-203729717 TTTTGGGTGCTGGTGGTGGTTGG + Exonic
946173739 2:217910333-217910355 GTTTAGATGGTGCAGGGGGTGGG - Intronic
1170370627 20:15644253-15644275 GTTTAGATGCTGGAGGTGGTGGG - Intronic
1171262636 20:23747574-23747596 GTTTAATTGCAGGAGGTGGGGGG + Exonic
1172486845 20:35303643-35303665 ATGTAGTTGCTGGAGGGGGTTGG + Exonic
1172690356 20:36785553-36785575 GTTTACATCCTGCAGCTGGTCGG - Exonic
1173152498 20:40579585-40579607 GTTTAGATGGTGGAGATGGCAGG - Intergenic
1174243404 20:49157161-49157183 ATTTTGAGGCTGGACGTGGTGGG - Intronic
1177771065 21:25516353-25516375 TTTTAGATGTGGGATGTGGTAGG - Intergenic
1177968587 21:27760011-27760033 GGAGAGATGCTGGAGGTGGAAGG + Intergenic
1179510909 21:41872952-41872974 GTTCTGTTGCTGGTGGTGGTAGG + Intronic
1180709725 22:17831612-17831634 GTTTAGAAACTGGAAGTGGAAGG - Intronic
1180760651 22:18200285-18200307 GTTTGGAAGGTGGAGGTGGGTGG + Intergenic
1180770965 22:18384582-18384604 GTTTGGAAGGTGGAGGTGGGTGG + Intergenic
1180775017 22:18424411-18424433 GTTTGGAAGGTGGAGGTGGGTGG - Intergenic
1180808092 22:18735466-18735488 GTTTGGAAGGTGGAGGTGGGTGG - Intergenic
1181071016 22:20340431-20340453 GTTTGGAAGGTGGAGGTGGGTGG - Intergenic
1181194088 22:21169380-21169402 GTTTGGAAGGTGGAGGTGGGTGG - Intergenic
1181215354 22:21323398-21323420 GTTTGGAAGGTGGAGGTGGGTGG + Intergenic
1181373753 22:22439973-22439995 CTTTTGATGCTGAAGGTGGGTGG + Intergenic
1184475069 22:44715889-44715911 TTTGAGAGGCTGGAGGTGGGAGG - Intronic
1184985620 22:48131341-48131363 ATTTAGAGGCTGGGCGTGGTGGG - Intergenic
1203232799 22_KI270731v1_random:125754-125776 GTTTGGAAGGTGGAGGTGGGTGG + Intergenic
949266266 3:2160211-2160233 TTTTGAATGCTGGAGGTGGAAGG + Intronic
952307450 3:32158804-32158826 GTATGGATGCCAGAGGTGGTGGG - Intronic
952567423 3:34675722-34675744 GTTTATGTGCTGGGGGTGGGAGG - Intergenic
953287861 3:41630264-41630286 GTCTGGAGGCTGGAGGTGGAGGG + Intronic
953915360 3:46916432-46916454 GTTCAGAGGTAGGAGGTGGTTGG - Intergenic
955068028 3:55549183-55549205 GATCAGATGCTCGAGGTGATAGG - Intronic
955560881 3:60189224-60189246 ATTTAGAAGCTGGGGGTGGGGGG + Intronic
956176499 3:66478099-66478121 GTGGAGATGGTGGAGGTGATAGG - Intronic
956714416 3:72065764-72065786 GTTTATATTCTAGTGGTGGTGGG + Intergenic
957296787 3:78343152-78343174 CTTAGGATGTTGGAGGTGGTAGG + Intergenic
957723273 3:84031934-84031956 GGTCAGATGCTGGTGGAGGTGGG - Intergenic
958564862 3:95797040-95797062 GTTTAGGTGCTGGTTGTGATTGG - Intergenic
959060679 3:101613499-101613521 GTTTTGTTGTTGGTGGTGGTGGG + Intergenic
959214745 3:103437347-103437369 GTGGAGCTGCTGAAGGTGGTGGG - Intergenic
960339053 3:116453063-116453085 CTTTAGATTCTGGAGGAGGGAGG + Intronic
961054632 3:123777777-123777799 GTCTGGATGCTAGAGGTGGCAGG - Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961501507 3:127339698-127339720 TTTTAGATGCTAGAGCTGGTAGG - Intergenic
961656574 3:128445715-128445737 GTGGTGGTGCTGGAGGTGGTGGG + Intergenic
962901841 3:139768298-139768320 TTTGAGATGCTTGATGTGGTGGG + Intergenic
964884324 3:161464292-161464314 GCTTTGCTGCTGGAGGAGGTGGG + Intergenic
965233355 3:166082675-166082697 GTTTTGTTTCTGGAGGTGTTGGG - Intergenic
965460150 3:168952196-168952218 GTCTAGGTGCTGGTGGGGGTTGG + Intergenic
966212680 3:177469404-177469426 GGTTTGAGGCTGGTGGTGGTGGG + Intergenic
967869497 3:194218344-194218366 GTTTTGTTGGTGGAGGTGGCAGG + Intergenic
968542175 4:1173160-1173182 GTCTACATGCTGGAAGTGGCTGG + Intronic
968702322 4:2062898-2062920 CTTTGGCTGCTGGAGGTGGCTGG + Intronic
968736824 4:2301663-2301685 CTTTTGCTGCTGGGGGTGGTGGG - Intronic
969099610 4:4759008-4759030 GTGAAGAAGCTGGAGGAGGTTGG + Intergenic
973067100 4:45808709-45808731 CTTTACAAGCTCGAGGTGGTTGG + Intergenic
975936066 4:79582418-79582440 GTTTAGATGTAGAAGTTGGTGGG - Intergenic
977753277 4:100634840-100634862 CTCTAGATGCTGGAGGAGGGAGG + Intronic
977943491 4:102883206-102883228 GGTTAGATAAAGGAGGTGGTTGG - Intronic
979190406 4:117849828-117849850 GTGTAGCTGCTGGCTGTGGTAGG - Intergenic
983040127 4:162915134-162915156 GTTTAGGTGCTGGCTGTGATGGG - Intergenic
986038550 5:3964071-3964093 TTTTAGGTGCTGGAGGGAGTGGG + Intergenic
986400288 5:7372620-7372642 GTGGTGATGGTGGAGGTGGTAGG - Intergenic
986652595 5:9979431-9979453 GTGGAGAGGCAGGAGGTGGTGGG - Intergenic
986899516 5:12414214-12414236 GTTTAGATCCTTTAGGTAGTAGG + Intergenic
988858275 5:35250581-35250603 GGTTAGAGGTTGGAGGAGGTTGG + Intergenic
991975996 5:72184088-72184110 GTATTTATGCTGGGGGTGGTGGG + Intronic
992502287 5:77354929-77354951 GTGAAGATGATGGCGGTGGTTGG - Intronic
995137521 5:108696079-108696101 GATTAGTTGGTGGAGGTGGGGGG - Intergenic
995281151 5:110337117-110337139 GTTTAGAAGATGGAAGAGGTAGG + Intronic
997625113 5:135326407-135326429 GTTTAGAGGCAGGAAGAGGTAGG - Intronic
1000770481 5:165347244-165347266 GATTAGATACTGCAGGTGGCGGG - Intergenic
1001122406 5:168991546-168991568 GGTTTGCTGCTGGGGGTGGTGGG - Intronic
1002393655 5:178936611-178936633 GTTTGGAGGCTGGAGGAGGATGG - Intergenic
1006114806 6:31769908-31769930 ATCTAGGTGCTGAAGGTGGTGGG + Intronic
1006639959 6:35484810-35484832 CTCTAGGTCCTGGAGGTGGTAGG - Intronic
1006955930 6:37871910-37871932 ATTTAGCTGCTGATGGTGGTGGG - Intronic
1006998506 6:38285503-38285525 TGTTAGATGGTGGCGGTGGTGGG + Intronic
1007458172 6:41996989-41997011 GCCTAGTTGCTGGAGGGGGTGGG - Intronic
1008495480 6:52128934-52128956 GTAGATATGGTGGAGGTGGTGGG + Intergenic
1010941648 6:81926129-81926151 GTAGAGATGGTGGAGGTGGAGGG + Intergenic
1012741458 6:103020813-103020835 GTTTCCATGGTGGAAGTGGTGGG + Intergenic
1013681659 6:112530778-112530800 GTTTAGCTGGTGGAGGTGAATGG + Intergenic
1016425869 6:143935124-143935146 CTGCAGATGCTGGTGGTGGTGGG + Intronic
1017317340 6:153047040-153047062 TATTAGATGCTGAAGATGGTGGG + Intronic
1017664401 6:156705539-156705561 GTTTAGAAGTTGGAGGTAATGGG - Intergenic
1018670730 6:166174729-166174751 GTTTAGAAAAGGGAGGTGGTGGG + Intergenic
1019300249 7:299430-299452 GTGTGGATGCTGGAAGCGGTCGG - Intergenic
1020124681 7:5526852-5526874 GTGCAGATGCTTGAGGAGGTGGG - Intergenic
1020914728 7:14178121-14178143 GACCAGCTGCTGGAGGTGGTCGG - Exonic
1020985494 7:15129004-15129026 GTTTGAATGCGGGTGGTGGTGGG + Intergenic
1021034272 7:15778174-15778196 GTTTAGGTACTAGAGATGGTTGG + Intergenic
1021312815 7:19113979-19114001 ATTTAGAAAATGGAGGTGGTTGG + Intronic
1022981355 7:35607683-35607705 GCAAAGATGCTGGAGCTGGTGGG - Intergenic
1023639909 7:42247095-42247117 GTTTAGATGCAGGAGGAAGAAGG + Intergenic
1023737567 7:43248400-43248422 GTCTAGATGAAGGATGTGGTGGG - Intronic
1028165737 7:87536820-87536842 GTTTAGATTCTAGAGATGGAAGG + Intronic
1030137578 7:106270948-106270970 GGTCAGATGTTGGAGGTGATTGG - Intronic
1031226966 7:119051680-119051702 GTATACATGGTGGGGGTGGTGGG - Intergenic
1032844673 7:135742210-135742232 CTGGAGAGGCTGGAGGTGGTGGG + Intronic
1036794133 8:11743120-11743142 GATCTGAAGCTGGAGGTGGTGGG + Intronic
1037939737 8:22942500-22942522 GTAGAGATGGTGGGGGTGGTGGG - Intronic
1038204440 8:25452474-25452496 GTTCAGATGCTGCAGGTGACAGG - Intronic
1038828175 8:31030662-31030684 GTTTTAATTCTGGAGGGGGTGGG - Intronic
1039108792 8:34019237-34019259 GTTTCCATGCTGGAGATGATTGG + Intergenic
1041057957 8:54007083-54007105 CTTTGGAAGCTGGAGGTGGGTGG - Intronic
1041919913 8:63169216-63169238 GTTTAAAGGCTGGGGGTGGTTGG + Intronic
1043263411 8:78230325-78230347 GATTAGGGGCTGGAAGTGGTTGG + Intergenic
1043503916 8:80884367-80884389 GTTTATATGGAGGAGGTGGTGGG - Intergenic
1044035272 8:87294465-87294487 GTTCTAATGCTGCAGGTGGTGGG - Intronic
1044632227 8:94291045-94291067 TTTTATCTTCTGGAGGTGGTTGG - Intergenic
1045233655 8:100330176-100330198 GTTAAGATGCTAGAGAAGGTTGG - Intronic
1046527117 8:115394986-115395008 GTTTAGAGGGTGGAAGTGGTGGG - Intergenic
1047217644 8:122889824-122889846 GTATAGATGATGGAGGTTGGGGG + Intronic
1048678129 8:136807830-136807852 TTTTAGGTACTGGAGGGGGTGGG + Intergenic
1049924954 9:399988-400010 GTGGAGGTGGTGGAGGTGGTGGG - Intronic
1050484686 9:6121743-6121765 GTTTAGAGCCTGGAGGTAGTAGG + Intergenic
1050615650 9:7399155-7399177 ATTTAGATTCTGTAGGTGGTGGG + Intergenic
1057581103 9:96288610-96288632 GTAGAGATGGTGGTGGTGGTGGG - Intronic
1061255892 9:129454076-129454098 GTGGAGGTGGTGGAGGTGGTGGG + Intergenic
1061255903 9:129454107-129454129 GTGGAGGTGGTGGAGGTGGTGGG + Intergenic
1061255920 9:129454152-129454174 GTGGAGGTGGTGGAGGTGGTGGG + Intergenic
1061255935 9:129454191-129454213 GTGGAGGTGGTGGAGGTGGTGGG + Intergenic
1061255946 9:129454222-129454244 GTGGAGGTGGTGGAGGTGGTGGG + Intergenic
1061256032 9:129454452-129454474 GTGGAGGTGGTGGAGGTGGTGGG + Intergenic
1061307975 9:129743324-129743346 GTTTGGAGCCTGGAGGTGGGAGG - Intronic
1062575660 9:137206066-137206088 GTTTAGCACCTGGAGGAGGTTGG + Intronic
1203768004 EBV:36461-36483 GTGAAGGTGGTGGAGGTGGTGGG - Intergenic
1186253339 X:7692898-7692920 GTTTAGATGCTTTATGTGGGAGG + Intergenic
1189225990 X:39413799-39413821 GTTGGGATGTTGGAGGTGGTCGG + Intergenic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1191995252 X:67088739-67088761 GTTTGGGTGCTGGTGGTGGTGGG + Intergenic
1194800246 X:98264166-98264188 GTTTTGTTGCTGGAGGATGTGGG - Intergenic
1195111888 X:101657916-101657938 ATTTAGATGCTGGAAGTTGTAGG - Intronic
1197840813 X:130744203-130744225 ATTGGGATGCTGGTGGTGGTAGG + Intronic
1199742060 X:150745123-150745145 GTTTAGATGTTGGAGATGAGGGG - Intronic
1201165019 Y:11201250-11201272 GTTTAGAAGCTGTTGGTGGGAGG - Intergenic
1201470141 Y:14324220-14324242 GTTTAGATGCTTCATGTGGAAGG + Intergenic