ID: 1170370799

View in Genome Browser
Species Human (GRCh38)
Location 20:15646057-15646079
Sequence AAACCCCGAGAAAAAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170370799_1170370800 -4 Left 1170370799 20:15646057-15646079 CCTGCTTCTTTTTCTCGGGGTTT No data
Right 1170370800 20:15646076-15646098 GTTTCTTTTGTGATTCACAGTGG No data
1170370799_1170370801 23 Left 1170370799 20:15646057-15646079 CCTGCTTCTTTTTCTCGGGGTTT No data
Right 1170370801 20:15646103-15646125 TCTCACTGTTCTGAGCTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170370799 Original CRISPR AAACCCCGAGAAAAAGAAGC AGG (reversed) Intronic