ID: 1170379715

View in Genome Browser
Species Human (GRCh38)
Location 20:15743681-15743703
Sequence CTCAAACACAAGTGCAGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170379715 Original CRISPR CTCAAACACAAGTGCAGCGA GGG (reversed) Intronic
900343781 1:2201214-2201236 TTCCAACACAGGGGCAGCGAGGG - Intronic
904036487 1:27561835-27561857 CACAAACACAAAAGCAGAGACGG + Intronic
908909385 1:69055469-69055491 CTCTAACACATGTGCAGTTAAGG + Intergenic
914862175 1:151396033-151396055 CTCACATACTAGTGCAGCCATGG + Intergenic
916383628 1:164242115-164242137 CTCTATCACAAGAGCAGCAAGGG - Intergenic
917962970 1:180159004-180159026 CCCACTCACAAGTGCAGGGAGGG - Intronic
1066041341 10:31551080-31551102 CTCAAACCCCAGGGCAGAGATGG - Intergenic
1067315285 10:45155683-45155705 CTCAAAGACAAGTGCATTGGAGG - Intergenic
1067877747 10:50020078-50020100 CACAAACACAAGTGGAGTGAGGG - Intergenic
1067877765 10:50020145-50020167 CACAAACACAAGTGGAGTGAGGG - Intergenic
1071292069 10:84195349-84195371 CCCCAACCCAAGTGCACCGAGGG - Intronic
1075118127 10:119644232-119644254 CTCAAACATAAGTGAATCAACGG - Intergenic
1078119397 11:8490823-8490845 CTCCAACACACCTGCAGCTAAGG + Intronic
1078730563 11:13970411-13970433 CTCAACCACAACTGTAGAGAGGG - Intronic
1078799128 11:14624989-14625011 CTCAAGCCCAACTGCAGCAATGG + Intronic
1079746927 11:24144590-24144612 TTGAAACACAAGTGAAGTGAGGG + Intergenic
1084194674 11:67517766-67517788 CTCAATCCCCAGTGCAGCAACGG + Intergenic
1086148641 11:83583373-83583395 CTCAACCAAAAGTACAGTGAAGG - Intronic
1089443046 11:118531929-118531951 CCCAAACAGAAGTGCAGACAGGG - Intronic
1089783189 11:120888949-120888971 ATCAAAAACAAGTCCAGGGAAGG - Intronic
1090805500 11:130199684-130199706 CTCCCTCACAAATGCAGCGAGGG - Intronic
1091220758 11:133928673-133928695 CTCAAACAGGAGTGTAGGGAGGG + Intronic
1093564225 12:20582779-20582801 CTCAAAAACAAGTGCACTGGTGG + Intronic
1095805238 12:46312286-46312308 CTCCAACACACCTGCAGCTAAGG - Intergenic
1101272613 12:103163456-103163478 CTCAAACACAAGGGCAGTCCTGG - Intronic
1112135977 13:96578129-96578151 CTCCCACACAAGTCCAGCAATGG + Intronic
1112498223 13:99922347-99922369 TTCAAACATAAATGCAGCGCAGG + Intergenic
1115667357 14:35566199-35566221 GTAAGAAACAAGTGCAGCGAAGG + Intronic
1116369224 14:44108766-44108788 CTTTAACACATGTGCAGCAAGGG + Intergenic
1117049571 14:51846828-51846850 CTCACACAAAAGTGGAGGGAAGG - Intronic
1121123109 14:91388754-91388776 CTCAAGCACACTTGCAGCGAGGG + Intronic
1121603411 14:95222947-95222969 CTAAAACAGAGGTGCAGCAACGG - Intronic
1125302473 15:38270637-38270659 CTCTATCACAAGAACAGCGAGGG + Intronic
1126669517 15:51103345-51103367 CTCAAACATTATTGCAGAGAAGG + Intronic
1127358638 15:58225836-58225858 CTCAAACTCCAGTGCAGTCATGG + Intronic
1135085713 16:19473042-19473064 CTCACACAAAAGTGCAGCACAGG + Intronic
1135387373 16:22055091-22055113 CTCAAAAACAAATGGAGAGAAGG - Intronic
1140864810 16:79050608-79050630 CTCAAATACAAGTGCAGTCTTGG - Intronic
1146205466 17:30901403-30901425 TTCAAACTCAAGTGTAGCCAAGG + Intronic
1150682248 17:67293429-67293451 CTCCAAGACAAGAGCAGCGGAGG - Intergenic
1152465966 17:80466358-80466380 CTCTCAGACAAGTGCAGGGAAGG + Intergenic
1153693533 18:7616980-7617002 ATCAAACAGAAGTACAGAGAGGG + Intronic
1156026619 18:32662195-32662217 CTCTGACACAAATGCAGTGATGG - Intergenic
1156947994 18:42858280-42858302 TTCATACAGAAGTGCAGAGATGG - Intronic
1157264678 18:46208030-46208052 CATAAATACAAGTGCAGAGAAGG - Intronic
1157740480 18:50088416-50088438 CTTAAATACAAGTGCAGCACTGG + Intronic
1166603327 19:44117656-44117678 CTCCACCAGAAGTGCAGTGATGG - Intronic
926795790 2:16617819-16617841 CTTAAAGACAAGTTCAGAGATGG + Intronic
930688974 2:54339618-54339640 CACAAACACTAGGGCAGCTAAGG - Intronic
933229669 2:79791815-79791837 TTCAAACCCATGTGCAGCAAGGG + Intronic
933880512 2:86664566-86664588 CTCCAACAGAACTGCAGCTAAGG + Intronic
935963433 2:108449215-108449237 CGCAAACAGAAGTGCAGCGGTGG + Exonic
938015355 2:127862666-127862688 CTCCCACACAAGTCCAGCAATGG - Exonic
943645708 2:190406850-190406872 CTAAAACTCAAGTGGAGCAAAGG + Intergenic
948647069 2:239412013-239412035 CTCAGCCACCAGTCCAGCGATGG + Intergenic
948891024 2:240907165-240907187 CTCCCACAAATGTGCAGCGATGG - Intergenic
1169462160 20:5805155-5805177 CTCAAAAACAACAGCAGCAAAGG - Intronic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1179587549 21:42383324-42383346 CTCTAAGACAAGTGCTGCAAGGG + Intronic
1179647918 21:42786402-42786424 CCCCAACACAGCTGCAGCGATGG - Intergenic
1181802009 22:25353952-25353974 CTGACACACAGGTGCAGCGCAGG + Intronic
1181911278 22:26240222-26240244 GTCAAACACAAGAGGAGAGAGGG - Intronic
953193695 3:40712785-40712807 CTCCAGCACAAGTGCAGCTGAGG - Intergenic
953500934 3:43433413-43433435 CTCAAACTGAAGTGCAGCACAGG - Intronic
955633559 3:61000857-61000879 CTCTACCACTAGGGCAGCGATGG + Intronic
957711193 3:83861169-83861191 CTCTATCACAAGAGCAGCAAGGG + Intergenic
959364148 3:105435702-105435724 CTAATACACAAGTGAAGCAATGG - Intronic
959739847 3:109705384-109705406 CTCTATCACAAGAGCAGCAAGGG + Intergenic
961078668 3:124005370-124005392 CTCAAACAGAAGTACAGCCCTGG + Intergenic
961304801 3:125951071-125951093 CTCAAACAGAAGTGCAGCCCTGG - Intergenic
962742445 3:138371770-138371792 GTTAAACACAGGTGCAGCTAGGG - Intronic
974719972 4:65725562-65725584 CTCCAACAGACCTGCAGCGAGGG + Intergenic
976391357 4:84507859-84507881 CACAAACAAAAGTGCAAAGAAGG - Intergenic
977492983 4:97737125-97737147 CTCCAACACACCTGCAGCGGAGG + Intronic
978659553 4:111108347-111108369 CTCAATCACAAGAACAGCAAGGG + Intergenic
980368102 4:131832474-131832496 CTCAAACCCAGGTGCTGCTATGG - Intergenic
983377560 4:166949567-166949589 CTCCAACAGACGTGCAGCTAAGG - Intronic
984839493 4:184054904-184054926 ATCAAACACAAGTTCAGACAAGG - Intergenic
986357968 5:6947548-6947570 CAGAAACACAAGTGCTGTGATGG - Intergenic
987524651 5:19031505-19031527 CTCAAACACAACTCCAGTAAAGG + Intergenic
993775257 5:91986784-91986806 CTCAAACAAACCTGCAGAGAGGG - Intergenic
994204539 5:97019669-97019691 CTAAAACACAAAGGCAGCAATGG - Intronic
998133985 5:139665209-139665231 CTCACACACAGGCGCAGAGAGGG - Intronic
998420216 5:141978445-141978467 CTCAGAAAAAAGTGCAGAGAAGG + Exonic
1000886251 5:166751137-166751159 CACAAACACAATTCCAGCTAGGG - Intergenic
1002216502 5:177638768-177638790 CTCCAACAGAACTGCAGCTAAGG - Intergenic
1007320734 6:41027390-41027412 CTGAAACACAGGTGCAGAGCGGG + Exonic
1011163766 6:84422409-84422431 CTCAACCACTGGTGCAGAGAAGG + Intergenic
1014913659 6:127120283-127120305 CACAGACACTAGAGCAGCGAGGG - Intronic
1016402609 6:143696811-143696833 AGCAAACACAAGTGGAGAGAGGG - Intronic
1017274549 6:152550898-152550920 ATCACACAGAAGTGCAGGGATGG + Intronic
1020248352 7:6447940-6447962 CTCAAGCGCAAACGCAGCGAGGG + Exonic
1020818717 7:12939334-12939356 CTCCAACAGACGTGCAGCTAAGG - Intergenic
1021521183 7:21540658-21540680 CTCAGAGGCAAGTCCAGCGAAGG - Intergenic
1035684779 8:1515216-1515238 CTGAAACTCAAGTGCAGGGTGGG - Intronic
1036061531 8:5327334-5327356 GTCAAACACAAGTTCTGTGAAGG + Intergenic
1038902201 8:31856840-31856862 CTCCAACAGAAGTGCAGCTGAGG - Intronic
1039113857 8:34070515-34070537 CTTAAACACAAGAGCAGGGTTGG + Intergenic
1039310504 8:36313491-36313513 CTCCATCACAAGAGCAGCAAGGG + Intergenic
1041109787 8:54473418-54473440 CTAAAGAAGAAGTGCAGCGATGG - Intergenic
1041626489 8:60034713-60034735 CTGAAACACAAGTGGAGGGCTGG - Intergenic
1042037953 8:64557646-64557668 CTCAAACACAAGGCCAGAAAAGG + Intergenic
1043707876 8:83376712-83376734 CTCAAAAAGAAGTACAGCAATGG - Intergenic
1046552959 8:115739573-115739595 CACAAACACAGGGACAGCGAAGG + Intronic
1049365401 8:142234547-142234569 CCCAACCACAAGTTCAGGGAAGG + Intronic
1052122054 9:24730407-24730429 CTCCATCACAAGTCCAACGAAGG - Intergenic
1055338611 9:75258923-75258945 CTCCAACAGACCTGCAGCGAAGG - Intergenic
1057310529 9:93940307-93940329 CTCAGACACACGGGCAGAGATGG + Intergenic
1057997457 9:99831138-99831160 CTTAAACACAAATGTAGGGAAGG + Intronic
1189047068 X:37604671-37604693 CTCAAAATCAAGAGCAGGGATGG + Intronic
1189867436 X:45345880-45345902 CTCAAATAAAAGTGCAGCATTGG + Intergenic
1193705469 X:84815934-84815956 CTCAGACAGAAGTGCAGATAAGG + Intergenic
1193791187 X:85816748-85816770 CCCAAACAGAAGTGCAGGTAAGG - Intergenic
1195456735 X:105078260-105078282 CTCCAACACACCTGCAGCTAAGG - Intronic
1197168609 X:123406775-123406797 TTCCAACACCAGTGCAGAGAGGG + Intronic
1198367163 X:135952441-135952463 CTCAAATTCAAATGCAGAGATGG - Intergenic