ID: 1170380486

View in Genome Browser
Species Human (GRCh38)
Location 20:15754744-15754766
Sequence TAGGGTATACATAATGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170380486_1170380491 20 Left 1170380486 20:15754744-15754766 CCCTGGCCATTATGTATACCCTA 0: 1
1: 0
2: 0
3: 16
4: 81
Right 1170380491 20:15754787-15754809 TAATCTATGTTAGAATCACCTGG 0: 1
1: 0
2: 1
3: 35
4: 279
1170380486_1170380493 24 Left 1170380486 20:15754744-15754766 CCCTGGCCATTATGTATACCCTA 0: 1
1: 0
2: 0
3: 16
4: 81
Right 1170380493 20:15754791-15754813 CTATGTTAGAATCACCTGGAGGG 0: 1
1: 0
2: 8
3: 73
4: 332
1170380486_1170380492 23 Left 1170380486 20:15754744-15754766 CCCTGGCCATTATGTATACCCTA 0: 1
1: 0
2: 0
3: 16
4: 81
Right 1170380492 20:15754790-15754812 TCTATGTTAGAATCACCTGGAGG 0: 1
1: 0
2: 9
3: 78
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170380486 Original CRISPR TAGGGTATACATAATGGCCA GGG (reversed) Intronic
908506342 1:64804941-64804963 TAGGTTATATCTTATGGCCATGG + Intronic
908988654 1:70057464-70057486 TAGGCTAGACATAATGGGAATGG + Intronic
909137484 1:71819890-71819912 TAGCACATACATAATGGCCTTGG - Intronic
911127244 1:94351972-94351994 AAGGGTATACATCATGTTCATGG - Intergenic
912848533 1:113100750-113100772 TAGGGTATACATAAAGCATAAGG - Intronic
913109669 1:115646675-115646697 TAGGGTACCCATAATGTCCTAGG + Intronic
916189389 1:162164446-162164468 TGGGGTATACATAGTGGTGATGG - Intronic
916980575 1:170131924-170131946 TAGAGTTTACATAATAGACAAGG - Intergenic
919136636 1:193517385-193517407 GATGGTATACATGATGGCCAGGG + Intergenic
1062765468 10:59567-59589 TAGGTAATTCATAATGACCAAGG - Intergenic
1065899623 10:30194067-30194089 TAGGATTTTCAGAATGGCCAAGG - Intergenic
1066292022 10:34022964-34022986 GAGGGTATTCAGAATGGCTAAGG + Intergenic
1073234100 10:101998803-101998825 TAGAGTATACTTAATGCCTAAGG + Intronic
1073732426 10:106305689-106305711 CAGAGTCTACATAATGTCCATGG + Intergenic
1074843700 10:117378136-117378158 TAGGCTATACAATATGGCCCAGG + Intergenic
1075355446 10:121768771-121768793 TAGGGCATACATACAGACCATGG - Intronic
1080660252 11:34290292-34290314 TAAGGTTTACATTGTGGCCACGG + Intronic
1087885762 11:103480626-103480648 ATGGGTATACATAATGTCTAGGG + Intergenic
1097423056 12:59405137-59405159 TTGGGCATACATACTGACCAGGG + Intergenic
1097501755 12:60411839-60411861 TAGTGCATAGAAAATGGCCATGG - Intergenic
1097776689 12:63655483-63655505 TAGGAAATACATAATGGGCATGG + Intronic
1097777153 12:63661112-63661134 TAGTGTGTAAATAATGGCCAGGG - Intronic
1098599696 12:72316364-72316386 TAGGGTATAGCTAATGCTCATGG + Intronic
1104344876 12:127987011-127987033 TAGGGTATCAATCATGGCCTGGG - Intergenic
1106741800 13:32652314-32652336 TATGTTTTAAATAATGGCCATGG - Intronic
1110403203 13:75118434-75118456 TAGGGAAAAAATAATGGACATGG + Intergenic
1110426326 13:75371284-75371306 TAGAGAATACATAATGGTGAAGG + Intronic
1111671901 13:91341977-91341999 TAGGGTATAGAAAATAGCCTAGG - Intergenic
1112773791 13:102822264-102822286 GAGGGTTTACATAATGTCCCAGG - Intronic
1115670475 14:35606300-35606322 TAGGATATACCTGATAGCCAAGG - Intronic
1119462708 14:74821966-74821988 TAGAGTATACAGAATCTCCAGGG + Intronic
1121370487 14:93353960-93353982 TAGGGTATGGAAAATAGCCATGG + Intronic
1124122878 15:26906549-26906571 AAAGGTATACATAATGAACAAGG - Intronic
1125671493 15:41476680-41476702 TAGGGAATGGAAAATGGCCAAGG - Intronic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1133972760 16:10579462-10579484 TTGGGTATACATAGTGGCAATGG - Intronic
1138144930 16:54599974-54599996 TTGGGTATAGATAATGGTGATGG - Intergenic
1146533745 17:33632210-33632232 TAGGTTCTACATACTAGCCAAGG - Intronic
1151022862 17:70639523-70639545 TAGTTTATACATAATGGAGAAGG + Intergenic
1153714287 18:7830488-7830510 TAGGCTATACCAAATGGCCTAGG - Intronic
1163258759 19:16173789-16173811 CAGGGTATACAGAAGGGCTATGG + Intergenic
925030380 2:646170-646192 TTGGGAATACAAAATGGCAATGG - Intergenic
926240061 2:11078583-11078605 TTGGGTATAGATAATGGTCATGG + Intergenic
937380130 2:121368911-121368933 TTGGGTATACATAGTGGTGATGG - Intronic
937565302 2:123278617-123278639 TAGGATATACAAAATGTCAAGGG + Intergenic
938123423 2:128651145-128651167 TAGGCTGTACCTTATGGCCAGGG + Intergenic
943086649 2:183319904-183319926 AAGGGTATACATAATGATAAAGG - Intergenic
943282679 2:185957467-185957489 TATGTTATATATAATGCCCAGGG - Intergenic
945414904 2:209558981-209559003 TAGGGGATACTTCAAGGCCATGG + Intronic
947898641 2:233699904-233699926 TAGGATATACGTAGAGGCCAAGG + Intronic
1170196633 20:13695485-13695507 TACAGACTACATAATGGCCAAGG - Intergenic
1170380486 20:15754744-15754766 TAGGGTATACATAATGGCCAGGG - Intronic
955167810 3:56531676-56531698 TAGGGCCCACCTAATGGCCAAGG + Intergenic
958424768 3:93967434-93967456 TAGGATATACACTAAGGCCAAGG - Intronic
961073884 3:123963800-123963822 AAAGGTTTACATAATGGACAAGG - Intergenic
965454920 3:168887650-168887672 TAAGAGATAAATAATGGCCAAGG - Intergenic
965848721 3:172995083-172995105 AAGGGGATACTTAATGGACAAGG + Intronic
966905098 3:184516916-184516938 TTGGGTATAGATAATGGTGATGG + Intronic
967758805 3:193200919-193200941 AAGGGTATACATAATGGTAAAGG - Intergenic
978060634 4:104333281-104333303 TAGAGCATACATAATGGTAAAGG + Intergenic
978407066 4:108391428-108391450 TGGGGTGTTCTTAATGGCCAGGG - Intergenic
979403581 4:120281445-120281467 TTGGGTTTACAAAATGGCAAGGG - Intergenic
983075910 4:163326426-163326448 TAAGGTAAATATCATGGCCAAGG + Exonic
984425564 4:179580875-179580897 TTGGGTAGACATAATGGCTATGG - Intergenic
984652393 4:182284571-182284593 TAGGGTATACAAAATAATCAGGG - Intronic
988432873 5:31139930-31139952 TAGTGTTTACATTTTGGCCAAGG - Intergenic
989102077 5:37832924-37832946 TAGGACAAACATAAAGGCCAAGG + Intronic
989281566 5:39649801-39649823 AAGGGGAGACACAATGGCCATGG + Intergenic
991954882 5:71984725-71984747 TAGTGTCTTCATAATGGCCTTGG - Intergenic
993516236 5:88838689-88838711 GAGGGTAAGGATAATGGCCAGGG - Intronic
994292313 5:98042412-98042434 TAGGTGAAAGATAATGGCCAGGG + Intergenic
995783293 5:115800999-115801021 GTGGGTATACATAGTGGCGATGG - Intergenic
1000232679 5:159330748-159330770 CTGGGTTTACATCATGGCCAAGG + Exonic
1000527289 5:162373246-162373268 TAGATTATAAATTATGGCCATGG + Intergenic
1002967452 6:1980452-1980474 AAGGGCATACATAATGGTAAAGG + Intronic
1007846444 6:44761149-44761171 TGTGGTATAGATAGTGGCCATGG - Intergenic
1014175225 6:118324827-118324849 TGGGTTACACAAAATGGCCAAGG + Intergenic
1014978113 6:127914508-127914530 TAGGCTATACCTGATGGCCTAGG - Intronic
1020704445 7:11526502-11526524 TAGTGCATACTTAATGGGCAGGG + Intronic
1022361257 7:29660656-29660678 TAGTGTGTAAATAATGGCCAGGG + Intergenic
1022361729 7:29666303-29666325 TAGGAAATACATAATGGGCACGG - Intergenic
1022699661 7:32747421-32747443 TAGGAAATACATAATGGGCATGG + Intergenic
1022700550 7:32755040-32755062 TAGTGTGTAAATAATAGCCAGGG - Intergenic
1022936069 7:35178786-35178808 TAGTGTGTAAATAATGGCCAGGG - Intergenic
1025257874 7:57397904-57397926 AAAGGCATACATTATGGCCAGGG - Intergenic
1029831565 7:103265868-103265890 TAGGAAATACATAATGGGCATGG + Intergenic
1029832037 7:103271502-103271524 TAGTGTGTAAATAATGGCCAGGG - Intergenic
1030893869 7:115032256-115032278 TAGGGTATACATGATGACTGTGG + Intergenic
1043400271 8:79877619-79877641 AAGGGTATACAAAATGGCTTGGG + Intergenic
1045137625 8:99238410-99238432 TAGGGGAAAACTAATGGCCATGG + Intronic
1050439512 9:5646591-5646613 TAGGGTATACCTTATAGCCAAGG + Intronic
1051468176 9:17404479-17404501 TAGGGAATCCAAAATGGCCAGGG - Intronic
1053338246 9:37298085-37298107 TAGTGTAAGCATAATGGACAGGG + Intronic
1061618299 9:131794290-131794312 TAGGGAATGCTTAATGCCCACGG - Intergenic
1189977025 X:46472038-46472060 TAGGGTACACAGAATTTCCATGG - Intronic
1194887138 X:99330581-99330603 CAGGGTTTATTTAATGGCCATGG + Intergenic
1195859188 X:109362965-109362987 TAGGCTATACATTATAGCCTAGG - Intergenic
1196051638 X:111312079-111312101 AGGGGTATACATGGTGGCCAAGG + Intronic