ID: 1170383971

View in Genome Browser
Species Human (GRCh38)
Location 20:15795800-15795822
Sequence CCAACGGATGTTCCCACAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 65}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170383971_1170383975 23 Left 1170383971 20:15795800-15795822 CCGACTGTGGGAACATCCGTTGG 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1170383975 20:15795846-15795868 CACATTTCAATCAGCCCAAAAGG 0: 1
1: 0
2: 3
3: 42
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170383971 Original CRISPR CCAACGGATGTTCCCACAGT CGG (reversed) Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
900476788 1:2879805-2879827 CCCAGGGATCTTCCCACAGGTGG - Intergenic
900773653 1:4565327-4565349 CCAATGGAAGGTCACACAGTTGG - Intergenic
901989437 1:13100802-13100824 CTCAGGGATCTTCCCACAGTGGG + Intergenic
901992376 1:13125962-13125984 CTCAGGGATCTTCCCACAGTGGG - Intergenic
902837170 1:19054593-19054615 ACAAAGGCTGTTCCCACTGTGGG - Intergenic
902930816 1:19730254-19730276 TCAACGTATGTTTCCTCAGTAGG - Intronic
903461675 1:23525017-23525039 CCCAGGGAGGTGCCCACAGTGGG + Intronic
904316499 1:29669594-29669616 CCCAGGGCTGTTCCCACACTAGG - Intergenic
910484608 1:87699520-87699542 TCAAGAGATGTTGCCACAGTTGG - Intergenic
911672503 1:100622722-100622744 CCAACAGCTGTTCCCAGGGTAGG + Intergenic
1066145035 10:32548641-32548663 ACATCGGATGTTCTCACTGTAGG - Intronic
1067104148 10:43354485-43354507 CCAATGGATGATATCACAGTGGG - Intergenic
1076131783 10:128018568-128018590 CCAACAGCTGTTCCCAGAGGAGG + Intronic
1077368251 11:2169929-2169951 CCCACAGCTGGTCCCACAGTCGG + Intronic
1084575585 11:69986145-69986167 CCCAGGGAAGTCCCCACAGTCGG + Intergenic
1089821536 11:121231783-121231805 CCAAAGGCTGTTCCTTCAGTCGG + Intergenic
1091023917 11:132125130-132125152 CAAACGGATGGGCTCACAGTGGG + Intronic
1091354294 11:134923793-134923815 CCCGGGGATGTTCCCTCAGTAGG + Intergenic
1096280531 12:50249008-50249030 CCAATTGATGTTTGCACAGTGGG - Intronic
1104218661 12:126760448-126760470 CCAACAGATATTTACACAGTGGG - Intergenic
1106292272 13:28374971-28374993 CCAATGCATGATCCCTCAGTTGG + Intronic
1106924358 13:34598500-34598522 CCAAATAGTGTTCCCACAGTTGG - Intergenic
1115390403 14:32848005-32848027 ACAAACGATGTTCCCACAGCAGG - Intergenic
1143273360 17:5692110-5692132 CCATCAGAGGTTCCTACAGTGGG - Intergenic
1143873821 17:9976685-9976707 CCTAAGGATGATCCCTCAGTGGG + Intronic
1145273228 17:21415560-21415582 CCAGCGGATGTCCACACAGGTGG - Exonic
1145311421 17:21703004-21703026 CCAGCGGATGTCCACACAGGTGG - Exonic
1149543354 17:57485106-57485128 CAAATGGGTGTTCCCAGAGTGGG + Intronic
1150855560 17:68749042-68749064 GCACCGCATGTTCTCACAGTGGG - Intergenic
1153832003 18:8932084-8932106 CAAACTGATTTTCCCACAGTGGG + Intergenic
1156887394 18:42151158-42151180 TCAACAGATGTTTCAACAGTTGG + Intergenic
1157369302 18:47095653-47095675 CCCAAGGATGTTCCAACAGAAGG - Intronic
1161951631 19:7470923-7470945 GCCACTGATGTTCCCTCAGTGGG - Exonic
1163551890 19:17969912-17969934 CCAGCGGATGTTCAGGCAGTGGG + Intronic
1166518604 19:43464658-43464680 CGGAAGGATGTGCCCACAGTTGG - Intronic
934332600 2:92084586-92084608 CCAACGGATATTTGCATAGTTGG + Intergenic
948314662 2:237018167-237018189 GCCACGGATGTTCCCACTGTTGG - Intergenic
1169913804 20:10668282-10668304 CCAATGTATCTTCCAACAGTTGG + Intronic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
1171936455 20:31278993-31279015 CAAATTGATGTTTCCACAGTGGG + Intergenic
1173770149 20:45649266-45649288 CCAGCAGATGTTTCCACAATAGG + Exonic
1175323597 20:58107232-58107254 CCAACGGATGGTCCCATATGAGG + Intergenic
1179194309 21:39151287-39151309 CCAACTGACGCTCCCACAGTAGG - Intergenic
1179391026 21:40991006-40991028 CAAACGGATGTTTCTACAGGGGG + Intergenic
1179494183 21:41761265-41761287 CCAACCGGTGTTCCCAGAGGAGG - Intronic
1202727019 2_KI270716v1_random:11194-11216 CCAACGGATATTTGCATAGTTGG + Intergenic
953011472 3:39029499-39029521 CAAACAGATTTTCCCATAGTGGG + Intergenic
958653484 3:96970642-96970664 CCATAGGATGTTCCCACAACAGG - Intronic
960094652 3:113677622-113677644 CCAACGGATGGTCCCCAAGAGGG + Intronic
961330460 3:126135243-126135265 CCAAGGGATGCTTCCAAAGTGGG - Intronic
966418018 3:179708973-179708995 CCACTGCATGTTCCCAAAGTCGG - Intronic
983590603 4:169406677-169406699 CTTATGGATGTTCCCACCGTAGG - Exonic
985994774 5:3591810-3591832 CCAAAGGCTGGTCCCACAGACGG + Intergenic
986616968 5:9627678-9627700 ACAACTGATCTTCCCACAGCTGG + Intergenic
989829679 5:45899926-45899948 ACAATGGATGTTCACACAGAGGG - Intergenic
990701434 5:58478993-58479015 CCACAGGATGTTCCAACAGTTGG + Intergenic
994208446 5:97061767-97061789 TCAACTGATGTTCCCCCAGCAGG + Intergenic
1018552717 6:165016664-165016686 ACACCGCATGTTCTCACAGTGGG - Intergenic
1018674040 6:166203528-166203550 CCATCTGATGTTACCACAGTTGG + Intergenic
1022172057 7:27840311-27840333 CCAACGGATGGCCCTACAGATGG - Intronic
1038629855 8:29231293-29231315 AGAAGGGATTTTCCCACAGTAGG + Intronic
1039899650 8:41742148-41742170 CCAATGGAATTTCTCACAGTTGG - Intronic
1048867450 8:138771240-138771262 CCAAAGGAAGCTCCCACAGCAGG + Intronic
1058884261 9:109311488-109311510 GCACCGGATGATCCCACAGGTGG + Intronic
1190824232 X:54002189-54002211 CCAACAGATGGTCTCAAAGTTGG + Exonic
1192631479 X:72781091-72781113 CCCACGGGTGCTCCCAGAGTGGG - Intronic
1192650230 X:72939710-72939732 CCCACGGGTGCTCCCAGAGTGGG + Intronic
1195109061 X:101627183-101627205 GCAAGGAATGTTCACACAGTAGG + Exonic
1200699548 Y:6390520-6390542 CCCACTTATGGTCCCACAGTGGG - Intergenic
1201034563 Y:9774178-9774200 CCCACTTATGGTCCCACAGTGGG + Intergenic