ID: 1170385078

View in Genome Browser
Species Human (GRCh38)
Location 20:15807424-15807446
Sequence GTGTGTGTATGTACTAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 383}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170385078 Original CRISPR GTGTGTGTATGTACTAAAGT AGG (reversed) Intronic
901693051 1:10986430-10986452 GTGTGTGTTTTTAGTAGAGTCGG + Intergenic
902276277 1:15342131-15342153 GTTTGTGTATGTATTGCAGTCGG + Intronic
904979664 1:34487673-34487695 GTGTGTGTGTGTACCAGAGGTGG - Intergenic
905076268 1:35273272-35273294 GTGTGTGTATGTATTTGTGTGGG - Intronic
905676406 1:39828457-39828479 GTGTGTGTGTGTGCTGAGGTGGG - Intergenic
905788972 1:40780108-40780130 GTGTGTGTGTGTACTGGTGTGGG - Intergenic
906145856 1:43560114-43560136 GTGTGTGTGTGTACAATAGGTGG + Intronic
907081691 1:51629460-51629482 TTGTGTGGATGTCATAAAGTGGG + Intronic
907244088 1:53096472-53096494 GTGTGTGAGTGTGCTAAGGTGGG - Intronic
907244210 1:53097407-53097429 GTGTGTGATTGTACCAAGGTGGG - Intronic
907244389 1:53098793-53098815 GTGTGTGAGTGTACTGAAGCAGG - Intronic
907244518 1:53099811-53099833 GTGTGTGAGTGTACCAAGGTGGG - Intronic
907244580 1:53100281-53100303 GTGTGTGAGTGTACCAAGGTTGG - Intronic
907244725 1:53101355-53101377 GTGTGTGAGTGTACCAAAGCGGG - Intronic
907244758 1:53101615-53101637 GTGTGTGAGTGTACTGAGGTGGG - Intronic
907789125 1:57644592-57644614 ATGTGTGTATGTACATATGTGGG - Intronic
908142736 1:61203962-61203984 GTGTGTGTATGAGCTGTAGTTGG + Intronic
910752752 1:90652002-90652024 GTGTGTGTATATTCAAGAGTAGG - Intergenic
910794154 1:91081226-91081248 GTTTGTGTATTTACTCAAGAGGG + Intergenic
910905572 1:92174082-92174104 GGGTGTGTATGAAATAAAATTGG + Intronic
910933902 1:92470571-92470593 GTGTGTGTATAGTATAAAGTAGG - Intergenic
911515602 1:98864995-98865017 GTGTGTGTAGCTATTTAAGTGGG + Intergenic
911953415 1:104205886-104205908 GTCTGTTTATGTATTAAATTAGG + Intergenic
913029173 1:114881042-114881064 GTGTGTGTATATACACAAATTGG - Intronic
914986681 1:152463821-152463843 GTGTGTGTGTGTAGGAAAGGGGG - Intergenic
916054547 1:161059401-161059423 GTGTGTGTGTGTGCTAAGTTGGG + Intronic
916283184 1:163075175-163075197 GTATGTGTATGTACTTACATGGG + Exonic
916365517 1:164022877-164022899 GTGGGTCTCTGTACTAAGGTAGG - Intergenic
918659357 1:187070920-187070942 GTGTGTGCATGTGCACAAGTGGG + Intergenic
919578760 1:199344621-199344643 GTGTGTGTGTGTAGTAGAGATGG - Intergenic
920628934 1:207632613-207632635 GTGTGTGTATTTAGTAGAGAAGG - Intronic
921139264 1:212290221-212290243 ATGTGTGTGTTTTCTAAAGTAGG + Intronic
922820284 1:228479991-228480013 GTGTGTGTGTGTACATAAGAGGG - Intergenic
922852335 1:228743844-228743866 GTGTGTATATGTATTATAGGAGG + Exonic
922915022 1:229250167-229250189 GTGTGTGTATGTGGTAGAGATGG + Exonic
923415441 1:233753564-233753586 GTAAGTGTAAGTACCAAAGTTGG + Intergenic
923771609 1:236942444-236942466 GTGTGTGTATTTTCATAAGTTGG + Intergenic
1063207469 10:3847679-3847701 GTGTGTGTTTTTACTAGAGATGG + Intergenic
1063557249 10:7092631-7092653 GTGTGTATAAGGTCTAAAGTAGG - Intergenic
1063605080 10:7516282-7516304 GTGTGTGTATTTGGTAAAGATGG + Intergenic
1063815607 10:9768048-9768070 GTGTGTGTGTGTGCAAATGTAGG + Intergenic
1067553935 10:47254596-47254618 GTGTGTGTGTGTATTAGAGAGGG - Intergenic
1067569810 10:47363249-47363271 GTGTGTATTTTTACTAAAGATGG + Intergenic
1070375194 10:75823747-75823769 GTGTGTGTGTGTATGTAAGTAGG - Intronic
1071091091 10:81919581-81919603 TTGTGTGTTTGTATTAAAGATGG + Intronic
1071213336 10:83369763-83369785 GTTTGTGTATGTATTAGAGAGGG - Intergenic
1071213358 10:83369987-83370009 GTTTGTGTATGTATTAGAGAGGG - Intergenic
1071271548 10:84012053-84012075 GTGTGTGTGTGTATTTAAGTAGG - Intergenic
1072119197 10:92391362-92391384 GTGTGTGTGTGTTTTAGAGTTGG - Intergenic
1072712288 10:97723731-97723753 GTGTGTGTGTGTAGTAGAGATGG - Intergenic
1073001236 10:100287533-100287555 GTGTGTGTATGTACTGGCATCGG - Intergenic
1073629038 10:105129652-105129674 GTGTGTGTGTGTATTTGAGTGGG - Intronic
1073744365 10:106448621-106448643 GTGTGAGTACGTCCTAGAGTGGG - Intergenic
1073942169 10:108711882-108711904 GTGTGTGTTTTTACTAGAGATGG - Intergenic
1073972649 10:109061689-109061711 GTTTGTGTAAGTACTAATGCAGG - Intergenic
1075332870 10:121586031-121586053 GTGTGTGTATGTGCTCAGGGGGG - Intronic
1077936063 11:6786808-6786830 CTGTGTGTTTGTGCTAAAGATGG + Intergenic
1079344831 11:19642788-19642810 GTGTGTGTGTGTGTTAATGTGGG + Intronic
1080597142 11:33783116-33783138 GTGTGTGTGTGCACTAAATCTGG - Intergenic
1080764680 11:35284557-35284579 GTGTGTGTGTGTATTAAACATGG + Intronic
1081334269 11:41844402-41844424 GTGTGTGTGTGTACAAATTTTGG + Intergenic
1081909278 11:46690202-46690224 GTGTGTGTTTTTAGTAAAGACGG - Intronic
1082902903 11:58275538-58275560 TTGGGTGTATGTATTAAAATGGG + Intergenic
1083873688 11:65508328-65508350 GTGTGTGTGTGTAGTAGAGACGG - Intergenic
1086446180 11:86873451-86873473 GTGTGTGTTTTTAGTAGAGTCGG + Intronic
1087274095 11:96143151-96143173 GGGTGTGTGTTTTCTAAAGTTGG + Intronic
1087756603 11:102061062-102061084 TTTTGTGTATGTACTAACATGGG - Intronic
1088762431 11:112944872-112944894 GTGTGTGTGTGTTTTAAAGTAGG + Intergenic
1088902304 11:114127484-114127506 GTGTGTGTGTGTACTGGGGTGGG - Intronic
1088945345 11:114506182-114506204 GGGTGTATATGTATTTAAGTTGG - Intergenic
1091954251 12:4624816-4624838 GTGTGTGTGTATATAAAAGTGGG + Intronic
1092089954 12:5796455-5796477 GTGTGTGTATGTGCAAGAGTGGG - Intronic
1093691122 12:22110217-22110239 GTGTCTTTATGTTCTAAAGATGG + Intronic
1094180205 12:27584486-27584508 GAGTGTGAAGGTACTAATGTGGG + Intronic
1094375745 12:29785404-29785426 GTGTGTCTAGATATTAAAGTCGG - Intergenic
1097379393 12:58877023-58877045 GTATGTGCATGTACTTAGGTTGG - Intronic
1097426401 12:59450149-59450171 GTTTGTGTGTGTATTAAAGTAGG + Intergenic
1097631900 12:62074146-62074168 GTGTGTGTGTGTTCTAACTTTGG - Intronic
1097771755 12:63594481-63594503 GTGTGTGTGTGTATGAAACTTGG + Intronic
1098139152 12:67433869-67433891 GTTTGTGTGTGTACTAAGTTAGG - Intergenic
1098225558 12:68318729-68318751 GTGTGTGTATGTTGTTGAGTTGG - Intronic
1098259903 12:68657715-68657737 GTGTGTGTGTGTTTTAAATTAGG - Intronic
1098259911 12:68657815-68657837 GTGTGTGTGTGTTTTAAATTAGG - Intronic
1100162173 12:91873042-91873064 GTGTGTGTGTGTGCAAAATTTGG + Intergenic
1100494804 12:95114433-95114455 GTGTGTGTGTGTAGTAGAGATGG - Intronic
1100681721 12:96930799-96930821 GTATGTGTATGTAGAAAAGCAGG - Intronic
1101058650 12:100947594-100947616 GTGTGTGTGTTTACTGCAGTTGG - Intronic
1101566314 12:105909256-105909278 GTGAGTGTATATACTAATTTGGG - Intergenic
1102476603 12:113192663-113192685 GTGTGTGTGTGTGTTAAGGTGGG + Intergenic
1102823846 12:115929655-115929677 GTGTGTGTGTGTATTAGAGACGG - Intergenic
1104257088 12:127148390-127148412 TTGGGTTTATGTACTAAATTAGG - Intergenic
1104308440 12:127632013-127632035 GTGTGTGTGTGTATTTATGTGGG + Intergenic
1105037172 12:132934084-132934106 GTGTGTGTGTTTAATAGAGTTGG - Intronic
1105655477 13:22432759-22432781 GTTTGTGTATCTACTAAGTTAGG - Intergenic
1106139145 13:26996860-26996882 GTGTGTGTGTGTATTAAATGAGG + Intergenic
1106173126 13:27306332-27306354 GTGTGTGTGTGTACACATGTGGG + Intergenic
1106292009 13:28372398-28372420 GTGTGCATATGTACAAATGTGGG - Intronic
1106710730 13:32328886-32328908 GTGTGTGTATTTAAAAAACTAGG + Intronic
1106782690 13:33075404-33075426 GTGTGTGTGTGTAGGTAAGTCGG - Intergenic
1107022097 13:35762655-35762677 GTGTGTGTATGTATGAATGTAGG - Intergenic
1107331449 13:39305658-39305680 GTGTGTGTATTTTCTTCAGTGGG - Intergenic
1107704742 13:43090364-43090386 GTTTGTGTAAGTACTAAGTTAGG + Intronic
1107829748 13:44363989-44364011 GTGTGTGTATGTAAGGAAGGGGG - Intergenic
1108045820 13:46383508-46383530 GTGTGTGTGTGTAGAAAATTTGG - Intronic
1108070898 13:46627619-46627641 GTGTGTGCATGCACTAAGGTAGG - Intronic
1108539535 13:51426547-51426569 GTGTGTGGGAGTACTAAAGCAGG - Intronic
1109529744 13:63626158-63626180 GCATGTGTATGTACTAAGTTAGG + Intergenic
1110080449 13:71303558-71303580 GTGTGTGTTTGTAGTAGAGATGG - Intergenic
1110858036 13:80318495-80318517 GTGTGTGTATTTAGTAGAGACGG + Intergenic
1111097710 13:83536156-83536178 GTTTGTATATTTACTACAGTTGG + Intergenic
1111498129 13:89080869-89080891 GTGTGTGTGTGTAGTGAATTTGG + Intergenic
1111721729 13:91955202-91955224 GTGTGTTTATGTATTTAAATTGG + Intronic
1112950501 13:104990040-104990062 GTTTGTTTATGTGCTAAATTAGG - Intergenic
1115251899 14:31357852-31357874 ATGTGTGTGTGTTCTAAAGCAGG + Intronic
1116336528 14:43664920-43664942 TTGTGTGTATACACAAAAGTTGG + Intergenic
1116553555 14:46273945-46273967 GTGTGTGTGTGTAGTTAAGAAGG + Intergenic
1117540093 14:56738579-56738601 GTGTGTTTGTGTATTAAAGAAGG + Intergenic
1117732279 14:58735445-58735467 GTGTGTGTGTGTAGGAAAGAGGG - Intergenic
1117782198 14:59244726-59244748 GTGTGTGTGTGTATTTAGGTTGG + Intronic
1117808926 14:59524651-59524673 CTGGTAGTATGTACTAAAGTTGG + Intronic
1119729330 14:76940999-76941021 GTGTGTGTGTTTAGTAAAGATGG - Intergenic
1120584741 14:86298343-86298365 GTGTGTGTGTATACTACAGTAGG + Intergenic
1121546164 14:94765295-94765317 GTGTGTATACGTGTTAAAGTGGG - Intergenic
1122567994 14:102675968-102675990 GTATATGGATGTACTACAGTTGG + Intronic
1122708627 14:103638816-103638838 GTGTGTGTATGTATGAACATAGG + Intronic
1127817292 15:62622312-62622334 GTGTGTGTATCTGTAAAAGTTGG + Intronic
1128024183 15:64420702-64420724 GTGTGTGTTTTTACTAGAGATGG + Intronic
1128386911 15:67156135-67156157 ATGTGTGTATGTACCAGTGTGGG + Intronic
1128387039 15:67157181-67157203 GTGTGTGTATTCAATAAAATAGG + Intronic
1129088767 15:73126238-73126260 GTGTGTGTATGTGGTAATGATGG + Intronic
1130005503 15:80093135-80093157 GTGTGTGTTTTTAGTAGAGTCGG + Intronic
1130557442 15:84932611-84932633 GTGTAGGTATGTACTAGCGTAGG - Intronic
1132612924 16:826402-826424 GTGTGTGTGTTTACTAGAGATGG - Intergenic
1133418773 16:5627425-5627447 GTGTGTGTGTGTCCCAAAGGGGG + Intergenic
1134907124 16:17989566-17989588 GTGTGTGTGTGTACCACAGGTGG - Intergenic
1135432522 16:22397860-22397882 GTATGTTTATGTACTAGAGATGG + Intronic
1135665075 16:24328899-24328921 ATGTGTGTATGTGATGAAGTCGG - Intronic
1138535029 16:57655323-57655345 GTGTGTGTGTGTGCTAGGGTGGG + Intronic
1138945764 16:61847870-61847892 GTGTGTGTGTGTAGGATAGTTGG - Intronic
1139839106 16:69863924-69863946 CTATGTGTATGTACCACAGTTGG + Intronic
1140172771 16:72624457-72624479 GTGTATGTATGTATAATAGTGGG - Intergenic
1140550673 16:75862376-75862398 GTGTGTGTGTGTCCTCAGGTAGG + Intergenic
1140678386 16:77358185-77358207 GTGTGTGTGTATAATAATGTTGG + Intronic
1140964230 16:79948853-79948875 GTGTTTGGATGTACTAAAAATGG + Intergenic
1141168920 16:81678886-81678908 GTGTGTGTATATACACACGTGGG + Intronic
1141237993 16:82238064-82238086 GTATGTGTATGTACTTGAGTTGG + Intergenic
1141498224 16:84425073-84425095 GTGTGTGTATGTATTGAGGGGGG - Intronic
1141809621 16:86366533-86366555 GTGTGTGTGTGTCCTAAAAATGG - Intergenic
1143321139 17:6070166-6070188 GTGTGTGTGTGTATCAGAGTGGG + Intronic
1143380395 17:6492396-6492418 GTGTTTGTATTGACTAAAATAGG - Intronic
1143641070 17:8197849-8197871 GGGTGTGTGTGTAATAAAGGTGG + Intergenic
1143866480 17:9927276-9927298 GTGTGTGTATGTAGTAGAGATGG - Intronic
1146410376 17:32578447-32578469 CTGTGGGTATGTCCTAAACTCGG - Intronic
1147211541 17:38875077-38875099 GTGTGTGTGTGTGAGAAAGTGGG + Intronic
1147352852 17:39865423-39865445 GTGTGTATATATATTCAAGTGGG + Intergenic
1147570720 17:41568897-41568919 GTGTGTGTATGTTTGAAAGGTGG - Intronic
1147920400 17:43913105-43913127 GTGAGTGTGTGTACTCAAATGGG - Intergenic
1148888757 17:50792684-50792706 GTGTGTGTATTTAGTAGAGATGG - Intergenic
1151099455 17:71540076-71540098 GTGTGTGTATGTATGTGAGTAGG - Intergenic
1151981487 17:77512582-77512604 GGGTGTGTATCTAATAAAGTTGG + Intergenic
1152090581 17:78244645-78244667 GTGTGTGTGTGTATTAAAGAGGG - Intergenic
1153800541 18:8664090-8664112 GTGTGTGTGTGTTCTAATATAGG + Intergenic
1154937549 18:21076658-21076680 GTGTGTGTATGTACCAAGAGGGG - Intronic
1156058582 18:33044093-33044115 GTGTATGTATGTATAAAACTTGG + Intronic
1156092051 18:33483097-33483119 GTGTGTGTATGTGGAAAAGTTGG - Intergenic
1157268561 18:46250481-46250503 GTGTGTGTGTGTACGAATGGAGG - Intronic
1157716867 18:49893991-49894013 GTGTGTATATTTATAAAAGTTGG - Intronic
1159546688 18:69848002-69848024 GTGTGAGCATGCACTAAGGTTGG - Exonic
1159582891 18:70252515-70252537 GTGTTTTTATGTACTAAATCTGG - Intergenic
1159778993 18:72639562-72639584 GTGTGTGTTTGTACTGATTTGGG - Intergenic
1160061093 18:75529419-75529441 GTGTGTGTGTGTGTTAAAATTGG - Intergenic
1160154966 18:76426587-76426609 GTATTTTTATGTACTAAATTTGG + Intronic
1160468932 18:79108812-79108834 GTGTGTGTCTCAACTGAAGTTGG - Intronic
1161772677 19:6239669-6239691 GTGTGTGTTTGTACACAGGTAGG - Intronic
1163014214 19:14443881-14443903 GTGTGTGCATGTACAGATGTGGG - Intronic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1165263998 19:34645487-34645509 GTCTGTGTATGCACATAAGTGGG - Intronic
1166885022 19:45954882-45954904 GTGTGTGTGTGTACTTGAGCAGG + Intronic
1166969673 19:46557530-46557552 GTGTGTGTATTTCCTATGGTGGG - Intronic
925049252 2:798376-798398 GTGTGTATAAGAATTAAAGTTGG - Intergenic
927888766 2:26735198-26735220 GTGTGTGTGTGTTGGAAAGTTGG - Intergenic
929561332 2:42958272-42958294 GTGTGTGTATGTAAAATACTTGG - Intergenic
929672829 2:43891269-43891291 GTGTGTGTTACTACTAAATTAGG - Intronic
931158550 2:59662981-59663003 GTGTGTGTGTGTAGCAGAGTGGG - Intergenic
931166048 2:59749700-59749722 GTGTGTGTGTGTCCAAAGGTAGG + Intergenic
931327516 2:61242444-61242466 GTGTGTGTATGTATTATCTTTGG - Intronic
932121448 2:69104325-69104347 GTCTGTTTAACTACTAAAGTGGG - Intronic
932725441 2:74176073-74176095 GTGTGTGTGTGTAGTAGAGGCGG - Intronic
933641151 2:84761761-84761783 GTGTGTGTATGTAATGCTGTTGG - Intronic
935120718 2:100181307-100181329 GTGTGTGTATGTACATGTGTTGG + Intergenic
935324768 2:101926004-101926026 GTGTGAGAATGGACTAATGTAGG + Intergenic
935595649 2:104875198-104875220 TTGTGTGTATTTACTACATTTGG + Intergenic
936702426 2:115028941-115028963 GTGTGTGTTTATAGTAAGGTAGG + Intronic
938046856 2:128129320-128129342 CTTTGTGTATGTAATAAAGTAGG + Intronic
938721472 2:134070943-134070965 GTGTGTGTGTGTACAGAATTGGG + Intergenic
938734162 2:134171344-134171366 CTGTGTGTATATATTAATGTAGG + Intronic
939811492 2:146838338-146838360 GTGTGTGTGTGAACAAAAGAAGG - Intergenic
940684820 2:156834335-156834357 GTGTGTGCATGCACAAAAATAGG - Intergenic
940780798 2:157931750-157931772 GTGTGTGTGTGTACTGAATTAGG - Intronic
941268267 2:163391631-163391653 GTGTGTGTGTGTAGTAGAGATGG + Intergenic
941598553 2:167509438-167509460 GTGTGTGTGTGTAATAAATAAGG + Intergenic
941850396 2:170174343-170174365 GTGTGTGTGTGTGATAAAGCAGG + Intergenic
943420776 2:187666292-187666314 GTTTGTGTATGGTCTAAGGTAGG - Intergenic
944190256 2:196995356-196995378 GTAAGTGTAACTACTAAAGTTGG - Intronic
944274470 2:197819914-197819936 GTGTGTGTATGTAGTAGGGTTGG + Intronic
944508054 2:200435245-200435267 TTGTGTGTATATACAAAATTGGG + Intronic
944511238 2:200468337-200468359 GTGTGTGTGTGTAGTATACTGGG - Intronic
945265571 2:207888340-207888362 GTGTGTGTATGAAGAAAAGCAGG - Intronic
945551547 2:211227285-211227307 TTGTATGTATGTACTACATTTGG + Intergenic
1168888909 20:1281012-1281034 GTGTTTGTATGTTTTAAGGTGGG + Intronic
1168946605 20:1765101-1765123 GTGTGTGTATGCATTATAGATGG - Intergenic
1169848925 20:10028830-10028852 GTGTGTGTATGTATTAAGAAAGG + Intronic
1170210994 20:13846180-13846202 GTGTGTGTTTTTAGTAAAGACGG - Intergenic
1170385078 20:15807424-15807446 GTGTGTGTATGTACTAAAGTAGG - Intronic
1170530579 20:17287451-17287473 GTGTGTGTGTGTGTTAAAATGGG + Intronic
1170656901 20:18295802-18295824 GTGTGTGTATGCACCAAATCTGG + Intronic
1173302277 20:41814781-41814803 GTGTGTGCAGGTACTAGACTGGG - Intergenic
1173313872 20:41925775-41925797 GTGTGTGTATGTGGCCAAGTAGG + Intergenic
1175474437 20:59260980-59261002 GTGTGTGTATGTATGTAAGGAGG - Intergenic
1177122047 21:17149982-17150004 GTGTGTGTTTTTACTAGAGATGG - Intergenic
1177413171 21:20757964-20757986 CTTTGTGTGTGTACTAAAATGGG - Intergenic
1177492791 21:21849062-21849084 GTGTGTGTGTGTATTTAAGGGGG + Intergenic
1177785576 21:25667816-25667838 ATGTGTTTATGTACTGAAGGTGG - Intronic
1179022792 21:37655530-37655552 GTGTGTGTATGTATTTGAGAAGG + Intronic
1179226883 21:39461735-39461757 GTTTGTTTATGTACTAAGCTAGG + Intronic
1180069384 21:45428571-45428593 GCGTGTGAATGTTCTAGAGTTGG - Intronic
1183765897 22:39874436-39874458 ATGTGTGTCTCTCCTAAAGTTGG - Intronic
1184215195 22:43062046-43062068 GTGAGAGTAGGTACTAAGGTAGG + Intronic
1184491695 22:44813379-44813401 GTGGGTGTATGTACTGTAGGTGG - Intronic
1184491702 22:44813450-44813472 GTGGGTGTATGTACTGTAGGTGG - Intronic
1185037461 22:48487162-48487184 GTGTGTGTTTGTCCTAAGGATGG + Intergenic
1185281837 22:49973284-49973306 GTGTGTGTATGTGGTATGGTGGG + Intergenic
949110918 3:259326-259348 GTGTGTGTGTGTGATATAGTGGG + Intronic
949503565 3:4705030-4705052 GTGTGTGTATGTTTTTAAATGGG + Intronic
949615768 3:5752269-5752291 GTGTGTGTATGTGAGAAGGTGGG - Intergenic
949669514 3:6382354-6382376 GTGTGTGTTTGTATTAACATCGG - Intergenic
950314597 3:11989496-11989518 GTGTGTGTGTGTTTTAAACTGGG + Intergenic
950965354 3:17142226-17142248 GTGTGTGGATGTACCATAGCTGG - Intergenic
951420603 3:22479691-22479713 GTGTGTGTATTTACTATATAAGG - Intergenic
952182064 3:30927734-30927756 GTGTGTCTATATATTAATGTAGG - Intergenic
956929481 3:74026677-74026699 GTGTGTGTGTGTTTTAATGTAGG - Intergenic
957215068 3:77309552-77309574 GTATTTTTATGTACTAAACTTGG - Intronic
957245559 3:77711731-77711753 GTGTGTGTGTGTACATAAGGGGG + Intergenic
957743694 3:84308907-84308929 TTGTGTGTATATAGTAAAGATGG + Intergenic
958182355 3:90076398-90076420 GTGTGTGTCTATACCAAAGTAGG + Intergenic
958415550 3:93868999-93869021 GTGTGTGTGTGTACAAAACCAGG - Intergenic
959261240 3:104083600-104083622 GTGTGTGTGTGTTTTAAACTTGG + Intergenic
959384151 3:105680883-105680905 GTGTGTGTATATGTTGAAGTTGG - Intronic
962187165 3:133272303-133272325 GTGTGTGTGTTTCCTAAAGGAGG + Intronic
963676476 3:148317580-148317602 GTGTGTGTGTGTCCTGTAGTCGG + Intergenic
964489451 3:157219736-157219758 GTGTGTGTATGAAATAAAGTAGG - Intergenic
965241388 3:166203616-166203638 GTGTGTGTTTGTACTACAATGGG + Intergenic
965455905 3:168900340-168900362 GTGTGTGTGTGTACTCTAGAGGG + Intergenic
966489507 3:180511987-180512009 GTGTGTGTGTGTATTAAACGTGG - Intergenic
966668616 3:182501235-182501257 GTGTGTGTGTGTAAATAAGTTGG + Intergenic
967905345 3:194495006-194495028 GTGTGTGTGTGTACTGGAATGGG + Intronic
970738380 4:19201404-19201426 GTGTGTGTATGTGACAAAGGAGG - Intergenic
970806737 4:20045424-20045446 GTGTGTGTGTGTACTTAATCAGG + Intergenic
971168285 4:24206659-24206681 GTGTGTGTATTTAGTAGAGGTGG - Intergenic
971314470 4:25555883-25555905 GTGTGTGTGTGTGTTTAAGTCGG + Intergenic
971465126 4:26949704-26949726 GTGTGTGTATTAACTTAAGCAGG + Intronic
971730059 4:30367232-30367254 TTGTGTGTATATTCTTAAGTAGG - Intergenic
971884881 4:32431545-32431567 GTGTGTAGATGTACAAATGTAGG - Intergenic
972876731 4:43371487-43371509 GTGTGTGTCTGTGCTAAAAGAGG + Intergenic
973773874 4:54228601-54228623 GTGTGTGTGTGTACAAGACTGGG - Intronic
974655176 4:64809988-64810010 GTGTGTGTGTGTTTTAAACTTGG + Intergenic
976397063 4:84567482-84567504 GTGTGTGTTTTTACTAGAGATGG - Intergenic
976506979 4:85859154-85859176 GTGTGTGTGTGCACAGAAGTGGG - Intronic
977061696 4:92266402-92266424 GTGTGTGTATTTATTTATGTGGG - Intergenic
978051963 4:104212154-104212176 CTGTGGGTATGTAGTATAGTGGG - Intergenic
978792001 4:112672403-112672425 GTGTGTGTTTTTAGTAAAGGCGG - Intergenic
979076775 4:116280910-116280932 GTGTGGGAATGTAGTAAAGTAGG + Intergenic
979403613 4:120281748-120281770 ATTTGTGTAAGTACTAAACTGGG - Intergenic
980200565 4:129651656-129651678 GTGTGTGTGTGTACCCAATTGGG + Intergenic
980297044 4:130934492-130934514 GTGTGTGTTTTTAGTAAAGACGG + Intergenic
981469101 4:145109598-145109620 ATTTCTTTATGTACTAAAGTTGG - Intronic
981955732 4:150470830-150470852 GTGTGTGTGTGTAGTAATGAGGG - Intronic
982553162 4:156827714-156827736 GTGTATGTATGTACGTATGTGGG - Intronic
982712071 4:158768347-158768369 GTGTGTGTATGTTTTAAAGGGGG + Intergenic
983531754 4:168816862-168816884 GTGTGTGTGTGTAGAAAAGGGGG + Intronic
984231054 4:177099553-177099575 ATGTGTGTATGTATATAAGTAGG - Intergenic
984443305 4:179800661-179800683 GTGTGTGTGTGTTTTAAAGCAGG + Intergenic
984540498 4:181031750-181031772 GTGTGTGTATATACGTAGGTGGG - Intergenic
984575488 4:181442905-181442927 GTATTTGTTTGTACTAAATTAGG + Intergenic
985907120 5:2847979-2848001 TTGTGTGTGTGTATTAATGTTGG - Intergenic
985984714 5:3504875-3504897 GTGTGTGTATGTATTTGTGTTGG + Intergenic
986884301 5:12215085-12215107 GATTGGGTATTTACTAAAGTAGG + Intergenic
987051612 5:14151402-14151424 GTGTGTGTATGTATGTATGTAGG + Intronic
987770941 5:22304350-22304372 GTGTGTGCACGTACTTATGTTGG + Intronic
987935027 5:24452466-24452488 GTGTGTTCATATACTATAGTAGG + Intergenic
988848382 5:35153707-35153729 GTGTGTGTGTGTACAATGGTGGG - Intronic
989737625 5:44727962-44727984 GTGTGTGTGTGAAATAAGGTTGG + Intergenic
990637445 5:57745005-57745027 GTGTGTGTATGTAAGAAAGGAGG - Intergenic
991265880 5:64716797-64716819 GTGTGTGTATGAAATCATGTAGG + Intronic
993589128 5:89772152-89772174 GTGTGTGTGTGTACGCATGTGGG - Intergenic
994914350 5:105954494-105954516 GTGTGTGTGTGTGATACAGTAGG - Intergenic
995454975 5:112341385-112341407 GTGTGTGTATGTATTGTATTCGG + Intronic
996445361 5:123542878-123542900 GTGTGTGTGTTTACCAAATTTGG + Intronic
998034519 5:138903288-138903310 ATGTGTTTATGTGCTTAAGTTGG + Intronic
998234800 5:140389113-140389135 GTGTGTGTGTGTAGTAGAGACGG - Intergenic
998846602 5:146316384-146316406 GTGTGTGGTAGTAATAAAGTTGG - Intronic
998897539 5:146815715-146815737 GTGTGTGTGTGTGGAAAAGTGGG - Intronic
999105909 5:149070943-149070965 GTTAGTTTATGTACTAAATTAGG - Intergenic
999468185 5:151826810-151826832 CTGTTTGTATGGACTAAAATGGG - Intronic
999920925 5:156320123-156320145 GTGTGTGTGTGTACAATTGTTGG + Intronic
1000438181 5:161239170-161239192 GTGTGTGTATGTATGTATGTGGG - Intergenic
1000571147 5:162915512-162915534 GTGTGTGTGTGTATAAAATTAGG - Intergenic
1002595557 5:180319900-180319922 GTGTGTGTGTGTAAGAAACTAGG - Intronic
1003532606 6:6950280-6950302 GTGTGTGTGTGTGGTAGAGTAGG + Intergenic
1004481310 6:16021871-16021893 GTGTGTGTACGTACACATGTTGG - Intergenic
1004487813 6:16083944-16083966 GTGTGTGTGTGTATTCTAGTTGG - Intergenic
1004946271 6:20616830-20616852 GTGTGTGTGTGTGGTAGAGTCGG - Intronic
1005528157 6:26672982-26673004 GTGTGTGTGTTTATAAAAGTGGG - Intergenic
1005529320 6:26686869-26686891 GTGTGTGTGTTTATAAAAGTGGG - Intergenic
1005541476 6:26814777-26814799 GTGTGTGTGTTTATAAAAGTGGG + Intergenic
1005542638 6:26828657-26828679 GTGTGTGTGTTTATAAAAGTGGG + Intergenic
1006965455 6:37979488-37979510 GTGTGTGTGTGTTTAAAAGTGGG + Intronic
1007140340 6:39567037-39567059 ATGAGTGTATGTTCTAAAGAGGG + Intronic
1008371093 6:50731439-50731461 GTGTGTGTGTGTATGAAAGTGGG - Intronic
1008435223 6:51467960-51467982 GGGATTCTATGTACTAAAGTGGG + Intergenic
1008585710 6:52947133-52947155 GTGTGTGTGTGTTGTAAAGATGG - Intergenic
1009010696 6:57838792-57838814 GTGTGTGTGTTTATAAAAGTGGG + Intergenic
1009013455 6:57870770-57870792 GTGTGTGTGTTTATAAAAGTGGG + Intergenic
1010174947 6:73017307-73017329 GTGTGGATATGTCCTAAAGTGGG - Intronic
1012622018 6:101356773-101356795 GTGTGTGTGTGTACTTGAATGGG + Intergenic
1013564577 6:111344994-111345016 GTGTGTGTATGTACTTGTGTAGG + Intronic
1013755668 6:113458878-113458900 GTGTGTAAATGGACTAAAGCAGG - Intergenic
1014394111 6:120902852-120902874 GTGTGTGTATATATGAAAGGTGG - Intergenic
1014433335 6:121394931-121394953 GTGTGTGTATTTTCTTAAGGTGG - Intergenic
1015836656 6:137427278-137427300 GTGTGTGTGTGTACATAAATTGG - Intergenic
1015914591 6:138203172-138203194 GTGTGTTTAAGAACTAAAATGGG + Intronic
1019028101 6:168989089-168989111 GTGTGCTTAAGTACTAAATTAGG + Intergenic
1019487199 7:1294797-1294819 GTGTGTGTGTGTGCTTATGTGGG + Intergenic
1019849032 7:3536236-3536258 GTGTGTGTTTTTACTAGAGACGG + Intronic
1021280202 7:18707893-18707915 GTGTGTGTCTGTATTTGAGTTGG + Intronic
1022366422 7:29723856-29723878 GTGTGTGTGTGTATGAAACTTGG - Intergenic
1022366426 7:29723903-29723925 GTGTGTGTGTGTATGAAACTTGG - Intergenic
1022646289 7:32231306-32231328 GTGTGTGTGTGTATTTATGTTGG - Intronic
1022931315 7:35118160-35118182 GTGTGTGTGTGTATGAAACTTGG + Intergenic
1023098361 7:36686886-36686908 GTGTGTGTGTGTCCTTAAGAAGG + Intronic
1023646662 7:42324458-42324480 TGGTGTTTATGTACTAAATTGGG - Intergenic
1024246716 7:47476290-47476312 GTGTGAGCATGGACTAGAGTTGG - Intronic
1024734748 7:52292780-52292802 GTGTGTGTGTGGTATAAAGTAGG + Intergenic
1026080306 7:67212361-67212383 TTGTGTGGATGTACCACAGTTGG + Intronic
1026696784 7:72601641-72601663 TTGTGTGGATGTACCACAGTTGG - Intronic
1026797299 7:73374562-73374584 GTGTGTATTTGTACTAGAGACGG - Intergenic
1027152188 7:75740383-75740405 GTGTGTGTGTGTTGTAAATTTGG + Intergenic
1027154336 7:75755877-75755899 GTGTGTGTGTGTAGTAGAGATGG - Intergenic
1027738723 7:81971496-81971518 GTTTCTGTTTGTGCTAAAGTAGG - Intronic
1027869286 7:83686121-83686143 GTGTGTGTGTGTAGTAGAGACGG - Intergenic
1029100235 7:98123690-98123712 GTGTGTGTATATATGAAAATTGG - Intronic
1029827216 7:103210678-103210700 GTGTGTGTGTGTATGAAACTTGG + Intergenic
1029852137 7:103473610-103473632 ATGTGTGTATGTACATATGTGGG - Intronic
1030649105 7:112097704-112097726 GTGTGTGTATGAACAGAACTTGG + Intronic
1031031675 7:116742051-116742073 CTGTGTGCATGTAGAAAAGTTGG + Intronic
1031123404 7:117746625-117746647 GTGTGTGTATGTTTAAAAGATGG + Intronic
1032880101 7:136080059-136080081 GTGTGTGCATGTAATTATGTGGG - Intergenic
1034362399 7:150511902-150511924 GTGTGTGTGTGCACAAAACTCGG - Intergenic
1037310223 8:17547814-17547836 GTGTGTGTGTTTACAAAATTTGG + Intronic
1037335702 8:17789599-17789621 GTGTGTGTAGTTACGCAAGTTGG + Intronic
1037352366 8:17974846-17974868 GTGTGTGTGTGCCTTAAAGTGGG - Intronic
1037804603 8:22052053-22052075 GTGTGTGTGTGTGCTAGAGCAGG - Intronic
1038159139 8:25020185-25020207 GTTTGTTTATGTACTAAGTTAGG + Intergenic
1041146614 8:54882801-54882823 GTGTGTGTATTTACTACACTTGG + Intergenic
1041707968 8:60866416-60866438 GTGTGTGTATGCACGAGTGTGGG - Exonic
1043208148 8:77474207-77474229 GTATGTGATTGTCCTAAAGTAGG - Intergenic
1044071885 8:87771373-87771395 GTGTGTGTGTGTACTAAGTATGG - Intergenic
1044106579 8:88215151-88215173 GTGTGTGTTTTTAGTAAAGATGG - Intronic
1044122991 8:88420851-88420873 GTGTGTGTGTGTTCTAATGTTGG + Intergenic
1046338146 8:112817067-112817089 TTGTGAGTATGCACTAACGTTGG - Intronic
1047707925 8:127520436-127520458 GTGTGTGTATGTACTGTATATGG + Intergenic
1048730059 8:137429119-137429141 GTATGTGTAAGAACTACAGTTGG + Intergenic
1048964450 8:139605148-139605170 GTGTGTGTATGGACACAAGAAGG - Intronic
1050233559 9:3554816-3554838 GTGTGTGTGTGTTGGAAAGTTGG - Intergenic
1050824162 9:9923142-9923164 GTGTGTGTATGTACAGAAAAAGG + Intronic
1050916549 9:11142469-11142491 GTGTGTGTGTGTATTAACTTTGG - Intergenic
1051459991 9:17301197-17301219 GTGTATGTCTTTACTAAATTGGG + Intronic
1051512460 9:17893791-17893813 GTGTCTCCATTTACTAAAGTGGG - Intergenic
1052502673 9:29312290-29312312 GTGTGTGTATTTAGTAGAGAGGG - Intergenic
1054841044 9:69740205-69740227 GTGTGTGTATGTATGTATGTAGG + Intronic
1055197137 9:73609979-73610001 GTGTGTGTATTCAGTGAAGTTGG + Intergenic
1055913791 9:81379700-81379722 GTGTGTGTGTGTGTTAAAGTTGG - Intergenic
1057709016 9:97420303-97420325 GTGTGTGTATGAACCAGAGAGGG + Intronic
1058230900 9:102423065-102423087 GTGTGTATGTGTACTAAACGGGG + Intergenic
1059834350 9:118133945-118133967 GTGTGTGTATATACAAATTTGGG + Intergenic
1060139588 9:121198010-121198032 GTGTGTGTGTGTTTGAAAGTGGG - Intronic
1060391708 9:123283158-123283180 GTGTGTGTTTGTCCTTAATTGGG - Intergenic
1061150292 9:128824298-128824320 GTGCGTGTGTGTACTAAGGTAGG + Intronic
1186045341 X:5530518-5530540 GTGTGTGTATGTAATTGAGAAGG - Intergenic
1187487462 X:19718125-19718147 GTGTGTGTATTTATAAAATTGGG - Intronic
1188704588 X:33311154-33311176 GTGTATCTATATATTAAAGTAGG - Intronic
1189260325 X:39674047-39674069 GTGTGTGTATGTGGACAAGTGGG - Intergenic
1189892624 X:45621071-45621093 GTGTGTGTGTGTACTGGACTTGG - Intergenic
1192161828 X:68794162-68794184 GAGTGTTCATGTACTACAGTGGG - Intergenic
1192185084 X:68941288-68941310 GTGTGTGTATGTAGTGTGGTGGG + Intergenic
1194025367 X:88745109-88745131 GTATGTTTATGTACTAAATCTGG - Intergenic
1194073149 X:89352288-89352310 GTGTGTCTGTGTGCTATAGTGGG + Intergenic
1194265329 X:91746048-91746070 GTGTGTTTATGTACGTTAGTGGG - Intergenic
1194295955 X:92126727-92126749 GTGTGTGTGTGTATTAGATTGGG + Intronic
1195272744 X:103249213-103249235 GTGTCTGTGTGTTCTGAAGTAGG + Intergenic
1195554673 X:106209014-106209036 GTGTGTGTGTGTATTAAATTTGG - Intergenic
1195770245 X:108343198-108343220 GTGTGTGTATGTACAAAGGCTGG + Intronic
1195990166 X:110674448-110674470 GTGTGTGTGTGTGGTAAAGGGGG - Intronic
1196307229 X:114118407-114118429 GTGTGTGTATGTATTAAGGGGGG + Intergenic
1196481451 X:116154983-116155005 GTGTGTGTGTGTACTATGTTAGG + Intergenic
1196644682 X:118104407-118104429 GTCTGTGTATGCTCTATAGTGGG - Intronic
1197195242 X:123693286-123693308 GTGTGTGTTTTTAGTAGAGTTGG - Intronic
1197387210 X:125816086-125816108 GTGTGTGTGTGTATTATGGTCGG + Intergenic
1200293754 X:154896496-154896518 GTGTGTGTGTGTACGAAATGGGG - Intronic
1200582480 Y:4966510-4966532 GTGTGTTTATGTACGTTAGTGGG - Intergenic
1200727382 Y:6688034-6688056 GTGTGTCTGTGTGCTATAGTGGG + Intergenic
1200728534 Y:6703809-6703831 GTGTGTCTGTGTGCTATAGTGGG + Intergenic
1201597821 Y:15691877-15691899 GTGTGTGTAGGTACTACATGAGG + Intergenic
1201780780 Y:17720028-17720050 GTGTGTGTGTTTAGTAGAGTTGG - Intergenic
1201820773 Y:18185962-18185984 GTGTGTGTGTTTAGTAGAGTTGG + Intergenic