ID: 1170392895

View in Genome Browser
Species Human (GRCh38)
Location 20:15894520-15894542
Sequence GGTCTGAGAGAGACACAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 386}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170392894_1170392895 -4 Left 1170392894 20:15894501-15894523 CCTTCTCTGTAGGCAGGTGGGTC 0: 1
1: 0
2: 2
3: 16
4: 177
Right 1170392895 20:15894520-15894542 GGTCTGAGAGAGACACAAGATGG 0: 1
1: 0
2: 0
3: 27
4: 386
1170392889_1170392895 7 Left 1170392889 20:15894490-15894512 CCAGGAACACGCCTTCTCTGTAG 0: 1
1: 0
2: 0
3: 13
4: 66
Right 1170392895 20:15894520-15894542 GGTCTGAGAGAGACACAAGATGG 0: 1
1: 0
2: 0
3: 27
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170392895 Original CRISPR GGTCTGAGAGAGACACAAGA TGG Intronic
900202752 1:1418602-1418624 GGTCAGAGAGAAACAGAACACGG + Exonic
901254110 1:7806207-7806229 GGACTGAGAGAGATACAGGCAGG - Intronic
902767319 1:18626038-18626060 GCTTAGAGAGAGACCCAAGACGG - Intergenic
902936763 1:19770042-19770064 GGCCTGAGAGCCACACCAGAGGG + Intronic
903122407 1:21225005-21225027 GGCCTGACAAAGACACAGGAAGG - Intronic
904573149 1:31483095-31483117 GGTCAGAGAGAAACAGAACAGGG + Intergenic
904858015 1:33514606-33514628 GGTCTGAGAGGGGCATAAGAAGG + Exonic
904892068 1:33787058-33787080 GGACAGAGAGACACACAGGAAGG + Intronic
905181765 1:36171523-36171545 GGCAGGAGAGAGACACAAGCTGG + Exonic
905947582 1:41916953-41916975 TGGCTGAAAGAGACACAGGAGGG + Intronic
906207670 1:43995831-43995853 TGGTTGGGAGAGACACAAGAAGG - Exonic
906498910 1:46325773-46325795 GGTCAGAGAGAAACAGAACAGGG + Intergenic
907457510 1:54585039-54585061 GGTCTGAGTGAGAGAAAAGTGGG - Intronic
907527745 1:55063649-55063671 GGGCTGAGAGAGGGACAAGTCGG - Exonic
908729862 1:67214978-67215000 GGTCAGAGAGAAACAAAACAGGG - Intronic
910338354 1:86157286-86157308 GGGATGAGAGAGAAGCAAGAGGG - Intergenic
910614496 1:89182384-89182406 GGTCAGAGAGAAACAGAACAAGG + Exonic
911078932 1:93909250-93909272 GGCCCGAGAGAGACCCGAGAGGG + Exonic
911358099 1:96846027-96846049 GGTGGGAGAGAGAGAAAAGAAGG - Intergenic
912517888 1:110227316-110227338 GGTCTGGGAAAGAAACTAGAAGG - Intronic
913510230 1:119554585-119554607 GATCTGAGAGAAGCAGAAGAAGG + Intergenic
913514054 1:119587699-119587721 GATCTGAGAGAAGCAGAAGAAGG + Intergenic
915706598 1:157849649-157849671 GTGCTGAGAGAGAGGCAAGAAGG + Intronic
916505479 1:165424782-165424804 GGTCTGAGAGGGATTCATGATGG - Intronic
917117312 1:171615657-171615679 GGTCAGAGAGAAACAGAACAGGG - Intergenic
917177985 1:172260856-172260878 AAGCTCAGAGAGACACAAGAAGG - Intronic
918231780 1:182540227-182540249 AATCTGAGAGAGAAAGAAGAAGG - Exonic
919334689 1:196217234-196217256 GGTCAGAGAGAAACAGAACAGGG + Intergenic
919411483 1:197249682-197249704 GGTGTGATAGAGATACAAGCAGG + Intergenic
919575053 1:199297794-199297816 GGTCGTAGACAGAGACAAGAGGG - Intergenic
919613085 1:199770965-199770987 GGAGTGAGAGAAACACAATAGGG + Intergenic
920040031 1:203089677-203089699 GCTCTGAGAGAAGAACAAGATGG - Intergenic
920335888 1:205244884-205244906 GGAGTGAGAGAGACAGGAGAGGG + Intronic
920449963 1:206052754-206052776 GGTCAGAGAGAAACAGAACAGGG - Exonic
920450609 1:206058666-206058688 GGTCAGAGAGAAACAGAACAGGG - Intronic
920524744 1:206658498-206658520 GGCCGGAGGGAGACACAAGGCGG + Intronic
921502296 1:215920138-215920160 GGTCTTTGAGAAACACAACAGGG - Intronic
921618237 1:217297159-217297181 GGACACAGAGAGACACAAGGAGG + Intergenic
921974046 1:221181940-221181962 GGACTGTGGGAGACAAAAGAGGG - Intergenic
922091938 1:222404054-222404076 GGAATGAGAGAGGCAGAAGATGG - Intergenic
922932026 1:229397278-229397300 GGTCTGAAAGAGACCCCAGTGGG + Intergenic
923409170 1:233690477-233690499 TGTGTGAGAGAGGCACAAGGAGG - Intergenic
1064254749 10:13734054-13734076 GGTCTGGGAGTGACAGATGAGGG - Intronic
1065452267 10:25871189-25871211 GGTCTGATAGTCTCACAAGATGG + Intergenic
1065852954 10:29805927-29805949 GGTCCGTGCGAAACACAAGAAGG + Intergenic
1066390313 10:34972848-34972870 TGTCAGAGAGAGAGAAAAGATGG + Intergenic
1067204240 10:44199843-44199865 GGAATGATAGAGACAAAAGAAGG + Intergenic
1069320103 10:67159147-67159169 GGTCAGAGAGAAACAGAACAGGG - Intronic
1071288120 10:84167410-84167432 GGTCAGAGAGAAACAGAACAGGG + Intergenic
1071288624 10:84172211-84172233 GGTCAGAGAGAAACAGAACAGGG + Intergenic
1071992398 10:91112686-91112708 GGTAAGAGAGAGACAAAAGGAGG + Intergenic
1072688758 10:97555686-97555708 GGTCAGAGAGAAACAGAACAGGG + Intronic
1072773315 10:98163072-98163094 GGTCTGAGAATGACAGAAGATGG + Intronic
1073730064 10:106277476-106277498 GGTCTGAGAGAGACTGGTGACGG + Intergenic
1073857108 10:107689579-107689601 AGTGGGAGAGAGGCACAAGAAGG - Intergenic
1074133122 10:110601031-110601053 GAGCTGAGAGAGACAGAAGGGGG + Exonic
1074897711 10:117791464-117791486 GGTCAGAGGGAGACTGAAGAAGG - Intergenic
1076291860 10:129351664-129351686 GATCTGACACAGACAGAAGATGG + Intergenic
1077486663 11:2841868-2841890 CCTCTGAGAGAGGCCCAAGATGG - Intronic
1079329992 11:19525422-19525444 GGTCTGAGTGAAATAGAAGAGGG + Intronic
1079366212 11:19812436-19812458 GGTAGGAGAGAGAGACAAAATGG - Intronic
1079774968 11:24513799-24513821 GGTCAAAGAGAGACAAAAGGTGG - Intronic
1080392851 11:31864492-31864514 GGTCAGAGAGACACTGAAGATGG + Intronic
1084261223 11:67980024-67980046 TGTCAGAGAGAGAGAAAAGATGG - Intergenic
1084892106 11:72241654-72241676 GGGCTGAGAGACAGACAGGAGGG - Intronic
1086824681 11:91481920-91481942 GGTCAGAGAGAAACAGAACAGGG + Intergenic
1088087446 11:105997987-105998009 GGAGTGAGAAAGACACCAGAGGG + Intronic
1088435123 11:109804126-109804148 GTTGTGAGAGAGACCCAAGTAGG - Intergenic
1088704033 11:112445092-112445114 AGTCTGAGAAAGAAAGAAGAGGG - Intergenic
1089619757 11:119715318-119715340 GGTCTGGGAGAGGAACAAGTGGG + Intronic
1091356273 11:134940177-134940199 GGGCTGGGAGAGACACGAAAGGG + Intergenic
1091841283 12:3623046-3623068 GCTTTGAGAGAGAAGCAAGAAGG + Intronic
1092570204 12:9713155-9713177 GGTCAGAGAGAAACAGAACAGGG + Intergenic
1094292513 12:28867972-28867994 GTTCTGAGAAAGAAAAAAGATGG + Intergenic
1095147366 12:38747252-38747274 TGTGTGAAAGAGACACAAAATGG - Intronic
1097008851 12:55938362-55938384 GGACTGAGAGAGAGACAAAAAGG - Intronic
1100988432 12:100227310-100227332 GGGGTGAGAGGGAAACAAGAGGG - Intronic
1101538207 12:105640067-105640089 AGTATAAGAGAGACACAATAAGG - Intergenic
1101909126 12:108849766-108849788 GCCCTGAGAGAGACAAGAGATGG + Intronic
1102612149 12:114121723-114121745 GGTCAGGAAGAGACACAAGGTGG + Intergenic
1102621741 12:114201693-114201715 GGTCTGAAATAGACCCCAGATGG + Intergenic
1103624087 12:122205503-122205525 GGGCAGAGGGAGACACCAGAGGG + Intronic
1103784760 12:123423951-123423973 GGTAAGAGAAAGAAACAAGAGGG - Intronic
1103848968 12:123918675-123918697 GGTCTCAGAGAAACTCAAGCTGG + Exonic
1107997054 13:45871349-45871371 GGTCAGAGAGAAACAGAACAGGG + Intergenic
1108253795 13:48591662-48591684 GGTCAGAGAGAAACAGAACAGGG + Intergenic
1110551622 13:76816880-76816902 GGTCTGAGAATGAAACATGATGG + Intergenic
1111591363 13:90351587-90351609 GGTCTGCGATAGGCACTAGAAGG + Intergenic
1111998230 13:95186010-95186032 GGTTTGAGAGGGACCCAAGCAGG + Intronic
1114348402 14:21822730-21822752 GGACAGAGAGAGGAACAAGAGGG - Intergenic
1114378508 14:22175265-22175287 GGTCAGAGAGAAACAGAACAGGG - Intergenic
1115116562 14:29887300-29887322 GGTGTGACAGGTACACAAGAGGG + Intronic
1115635528 14:35287141-35287163 GATCTGAGAAAGACAAAAAAGGG + Intronic
1116057050 14:39876687-39876709 GGTCAGAGAGAAACAGAACAGGG + Intergenic
1116676154 14:47908397-47908419 GGTGAGAGAGAGACAAGAGAGGG + Intergenic
1116943398 14:50812610-50812632 TGCCTGAGAGAGACAAAAGCTGG + Intronic
1117038700 14:51751096-51751118 TGTCAGAGAGAGACATAAGATGG + Intergenic
1118447665 14:65866510-65866532 GGTTTCAGAGTCACACAAGATGG - Intergenic
1119099244 14:71864917-71864939 GGTCTGAGAAAGTAAAAAGATGG + Intergenic
1119659247 14:76438743-76438765 AGTTTGAGGGTGACACAAGATGG - Intronic
1120020949 14:79529260-79529282 GGTCAGAGAGAAACAGAACAGGG + Intronic
1120045489 14:79801164-79801186 GGTCTGAAAGACACAAAGGAAGG + Intronic
1121349939 14:93165347-93165369 GGTCAGAGAGAAACAGAACACGG - Intergenic
1121426775 14:93857891-93857913 AGACAGAGAGAGACCCAAGAAGG + Intergenic
1121701431 14:95957306-95957328 GGTCAGAGAGAAACAGAACAGGG - Intergenic
1122365861 14:101194538-101194560 GGCCTGCGAGAGACACAGAAGGG + Intergenic
1123193967 14:106599084-106599106 TGTGTGAGAGAGAGAGAAGAAGG + Intergenic
1123199587 14:106650058-106650080 TGTGTGAGAGAGAGAGAAGAAGG + Intergenic
1124392425 15:29271618-29271640 GGTCAGAGAGAAACAGAACAGGG - Intronic
1126192249 15:45889855-45889877 GGACAGCCAGAGACACAAGATGG + Intergenic
1127841660 15:62837194-62837216 GGTCAGAGAGGGACTCAAGAGGG - Intronic
1128349418 15:66879088-66879110 GTTCTGAGAGAGAGAAAAGCAGG - Intergenic
1129167253 15:73785686-73785708 GGTCAGAGAGAAACAGAACAGGG + Intergenic
1130740582 15:86595577-86595599 GGAATGAGAGAGACAGGAGAGGG - Intronic
1130932442 15:88439216-88439238 GGTCAGTGGGAGACACAGGATGG - Intergenic
1131860580 15:96649004-96649026 TGGCTGAGAGAGACAGAAAAAGG + Intergenic
1132855946 16:2044569-2044591 GGCCTGAGAGAGACCTCAGAAGG - Intronic
1133131755 16:3680453-3680475 GGATTGAGAGAGCCACCAGAGGG - Intronic
1133323480 16:4929320-4929342 GGTCTGGGAGAGGAAGAAGAGGG - Intronic
1134502531 16:14780405-14780427 GGGGTGAGAGAGAGACAGGAAGG + Intronic
1134578034 16:15348490-15348512 GGGGTGAGAGAGAGACAGGAAGG - Intergenic
1134724556 16:16409056-16409078 GGGGTGAGAGAGAGACAGGAAGG + Intergenic
1134942875 16:18302803-18302825 GGGGTGAGAGAGAGACAGGAAGG - Intergenic
1136040190 16:27572546-27572568 GTTCTGAGAGACAGAGAAGAGGG - Intronic
1136064394 16:27749066-27749088 CGTCTGAGTCAGCCACAAGAGGG - Intronic
1136350998 16:29707722-29707744 GGTCAGAGAGAAACAGAACAGGG - Intergenic
1137661609 16:50211941-50211963 GGTCTGAGAGAGATGAAAAATGG - Intronic
1137704496 16:50525120-50525142 TGCCTGAGAAAGATACAAGAGGG - Intergenic
1137790498 16:51170880-51170902 GGCCAAAGAGAGACACAAGCTGG + Intergenic
1138579557 16:57931904-57931926 AGTCAGAGAGAGACAAAAGCTGG + Intronic
1138913644 16:61435201-61435223 GGTCTGTGAGAGAAAAGAGAAGG + Intergenic
1139474074 16:67193776-67193798 GGTATGATAGAGGCACAAGGGGG + Intronic
1142144487 16:88487233-88487255 GGTCCGAGAGAGACAGCAGCAGG + Intronic
1143328514 17:6117479-6117501 GGTCTCACAGAGACACACGGTGG + Intronic
1143794821 17:9327982-9328004 GGAAAGAGAGAGACAAAAGAAGG - Intronic
1144716138 17:17437137-17437159 GGCCTGAGAGAGACCCTTGAGGG - Intergenic
1146465508 17:33083272-33083294 GGGCTGAGAGAGGCAAAAGAAGG + Intronic
1148987075 17:51632415-51632437 TATCTGAGAGAGAAAAAAGAAGG + Intronic
1152513051 17:80803321-80803343 GGTCACAGAGAGTCACACGAGGG + Intronic
1152528258 17:80902063-80902085 GGGCTGAGTGAGAAACAAGCAGG - Intronic
1153085173 18:1278126-1278148 AGTCTCAGAGGGAGACAAGATGG + Intergenic
1155252417 18:23965106-23965128 GGTCAGAGAGAAACAGAACAGGG - Intergenic
1155833444 18:30547346-30547368 GATCAAAGAGAGACACAAGCTGG + Intergenic
1156228515 18:35131886-35131908 AGTCTGAGGGAGAAACAACAGGG - Intronic
1157101098 18:44730689-44730711 GGTCTAAGAGAGACATCAAAAGG + Intronic
1157918429 18:51692418-51692440 GGTCTTAGAGAGAGAAAACATGG + Intergenic
1158103896 18:53862301-53862323 AGACAGAGGGAGACACAAGAAGG + Intergenic
1159953240 18:74500891-74500913 GGTCAGAGAGAAACAGAACAGGG + Intronic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1162159406 19:8700212-8700234 GGGCTCAGTGAGATACAAGAAGG + Intergenic
1163348260 19:16758675-16758697 GGTCTGAGACAGACACTATAGGG - Intronic
1163934164 19:20426348-20426370 GGTCAGAGAGAAACAGAACAGGG + Intergenic
1167250529 19:48396440-48396462 GGTCTGGGAGAGGCAGAGGAGGG + Intronic
1167533234 19:50031981-50032003 GGTCTGACGGAGAGACACGAGGG - Intronic
1168425214 19:56234673-56234695 GGTCAGAGAGAAACAGAACAGGG - Intronic
925357706 2:3253792-3253814 GTGCTGAGACAGACACAGGAGGG + Intronic
925714381 2:6771346-6771368 GATTTCAGAGAGACAGAAGAAGG - Intergenic
926008296 2:9389583-9389605 GGTCTGTGAGACACCCAGGACGG - Intronic
926704811 2:15829452-15829474 GGTCTGAGAGCAGGACAAGATGG + Intergenic
926722643 2:15972807-15972829 GCTTACAGAGAGACACAAGAAGG + Intergenic
927812898 2:26189994-26190016 GGTCTGAGAGAGCCTGAAGCCGG - Intergenic
928768559 2:34677416-34677438 GGTCAGAGAGAAACAGAACAGGG - Intergenic
930042825 2:47141294-47141316 GGTCTGAGAAATAAACAACATGG + Intronic
931690046 2:64827922-64827944 CGTCTGAGAGGGACGAAAGAGGG - Intergenic
931962608 2:67498999-67499021 GGCATGAGAGAGACTGAAGATGG + Intergenic
932882824 2:75519527-75519549 GCTCTGAGAGTGACAGGAGAAGG + Intronic
933129382 2:78654634-78654656 GTTCTGAGAGAGAACCTAGATGG - Intergenic
933836697 2:86251606-86251628 GGCCTGGGAGAAACAGAAGAGGG - Intronic
936025433 2:109027851-109027873 GCTCTGGGAGAGACAGAAGTAGG - Intergenic
936152557 2:110029783-110029805 GGTCTGAGTGAGACAGAGGTGGG + Intergenic
936192123 2:110341629-110341651 GGTCTGAGTGAGACAGAGGTGGG - Intergenic
936784817 2:116081875-116081897 GGACTGAAAGAGACACAAACAGG - Intergenic
937724559 2:125146628-125146650 TGTCTGGGATAGACACAAAAAGG - Intergenic
938086308 2:128404402-128404424 GGACTGAGAGACACAGCAGATGG - Intergenic
938757728 2:134396177-134396199 GGTTTGAGTGGGACACAACAAGG + Intronic
941071242 2:160956676-160956698 GCTCTGAGAGAGCCAGGAGATGG + Intergenic
944445112 2:199781132-199781154 GGTCTGAGTAAGAGACATGATGG - Intronic
948368513 2:237473654-237473676 GGCCGGAGAGAGGCACATGAGGG - Intergenic
948884819 2:240877330-240877352 GGTCTGGGAGAGACAGAGGAGGG - Intronic
1169252567 20:4071815-4071837 ACTCTTAGAGAGACATAAGAGGG + Intronic
1169763910 20:9128199-9128221 GGACTGAGAGAGAGAGAAGAGGG - Intronic
1170051302 20:12148574-12148596 GGTCTGAGGGAGACAGGAGCAGG + Intergenic
1170392895 20:15894520-15894542 GGTCTGAGAGAGACACAAGATGG + Intronic
1172042333 20:32054174-32054196 GGACTGAGAGTGATACAAGGTGG - Intronic
1172229800 20:33329031-33329053 GGACTTAGAGTGACACTAGAGGG + Intergenic
1172626336 20:36349595-36349617 GGTTTGACAGAGAAACAGGAAGG + Intronic
1173097368 20:40048456-40048478 GGTTAGAGAGAGACAGAAAAGGG + Intergenic
1174565683 20:51463050-51463072 GGCCTGATACAGAGACAAGAAGG - Intronic
1174891263 20:54397761-54397783 AGTCTAAGAAAGACAAAAGATGG + Intergenic
1174945790 20:54983879-54983901 GGTCAGAGAGAAACAGAACACGG + Intergenic
1175231101 20:57473829-57473851 GGACTGAGGGAGAGACAATAGGG + Intergenic
1176984094 21:15416165-15416187 GGTCAGAGAGAAAAACAAAAAGG + Intergenic
1177701004 21:24639147-24639169 GGTCAGAGAGAAACAGAACAGGG - Intergenic
1180832784 22:18914583-18914605 GGGTTGAGGAAGACACAAGATGG - Intronic
1181067037 22:20311669-20311691 GGGTTGAGGAAGACACAAGATGG + Intergenic
1181174329 22:21027311-21027333 GGTCTGGGAGAGAGAGCAGAGGG + Exonic
1181460995 22:23085872-23085894 GGATTGAGAGAGAAACAAAAAGG - Intronic
1182056482 22:27359361-27359383 GGTTTGAGAGAGAGAAAAGTGGG + Intergenic
1183311139 22:37110009-37110031 GGCCTGAGAGAGAGAAAAGGAGG + Intergenic
1183877925 22:40799822-40799844 TGTCTGAGAGAGACAGAAAGAGG - Intronic
1184429558 22:44433882-44433904 ATTTAGAGAGAGACACAAGAAGG + Intergenic
1184519004 22:44981343-44981365 GGTCTGAGGGGGTCACGAGAAGG - Intronic
1185297874 22:50063080-50063102 GCTCTTAGAGACACAGAAGAGGG - Intronic
1203282869 22_KI270734v1_random:139887-139909 GGGTTGAGGAAGACACAAGATGG - Intergenic
949093868 3:62586-62608 AGTCAGAGATAGACACAAAACGG + Intergenic
949654209 3:6198513-6198535 AGCCTGAGAGAAAAACAAGAAGG + Intergenic
949658703 3:6252209-6252231 TCTCTGAGAGAGGCACAATAAGG - Intergenic
950095805 3:10329663-10329685 GGGATGAGAGAGACACATGAGGG + Intronic
950428375 3:12936912-12936934 GGTCTGAGAGAGGAAAAACATGG - Intronic
952734460 3:36674992-36675014 GGTCAGAGAGAAACAGAACAGGG - Intergenic
952872842 3:37917202-37917224 GGACAGAGACAAACACAAGAGGG + Intronic
953008891 3:39005083-39005105 GGTCAGAGAGAAACAGAACAGGG + Intergenic
953215687 3:40915619-40915641 AGACTGACAGAGACACGAGATGG + Intergenic
953482416 3:43262794-43262816 GGTGAGAGAGAGAGAAAAGAAGG + Intergenic
954279639 3:49567561-49567583 GAGATGAGAGACACACAAGAGGG + Intronic
954300858 3:49700060-49700082 GGTCTGACTGAGGGACAAGAAGG - Intronic
955485099 3:59427110-59427132 GTTCTGGGTGAGACACAAGCAGG - Intergenic
955506774 3:59640384-59640406 GGTATGAGAGAGACTGATGAAGG + Intergenic
956740529 3:72272241-72272263 GGTCTCAGAGGGATAGAAGAAGG - Intergenic
956817733 3:72923761-72923783 GGTCTGAGAGAGATCATAGAAGG + Intronic
957076291 3:75605591-75605613 TGTCAGAGAGAGAGAAAAGATGG - Intergenic
957237204 3:77609150-77609172 AGTCTCAGAGAGACAAATGAAGG - Intronic
958532884 3:95357064-95357086 GGTCAGAGAGAAACAGAACAGGG - Intergenic
958790141 3:98642952-98642974 GGTCAGAGAGAAACAGAACAGGG + Intergenic
959360605 3:105386157-105386179 AGTATAAGAGAGACACAAGTAGG + Intronic
959591459 3:108086577-108086599 GAAATGAGAGAGAAACAAGATGG + Intronic
959711866 3:109393670-109393692 GGTCAGAGAGAAACAGAACAGGG - Intergenic
959970794 3:112407329-112407351 GGTCAGAGAGAAACAGAACAGGG + Intergenic
960504658 3:118478430-118478452 AGTCTGAGTGAGACACCAGATGG + Intergenic
961260395 3:125596967-125596989 GGTCAGAGAGAAACAGAACAGGG - Intergenic
961570962 3:127798560-127798582 GGTCTGGGAGTGACAGCAGAGGG - Intronic
962769324 3:138597638-138597660 GGTCAGAGAGAAACAGAACAGGG + Intergenic
963542496 3:146610941-146610963 TGTCTGAGAGAGAGAGATGAAGG + Intergenic
963787925 3:149553967-149553989 GAGCTGAGAGAGACACAAGGAGG - Intronic
964982934 3:162709143-162709165 GGTCAGAGAGAAACAGAACAGGG + Intergenic
966631998 3:182086523-182086545 GGTCAGCTAGAGACAGAAGAGGG + Intergenic
966643020 3:182211051-182211073 GGTGAGAGAGTGACACAAAATGG - Intergenic
967090850 3:186133578-186133600 GGTCTGAGAGAGACAGAACTGGG + Intronic
967216361 3:187213831-187213853 GAACTGAGGGAGACTCAAGATGG - Intergenic
967829710 3:193908828-193908850 GGGCTGAAAGAAGCACAAGAGGG - Intergenic
968133520 3:196206960-196206982 GGTTCGGGAGAGACAGAAGACGG - Intronic
968148658 3:196320334-196320356 GGCCTGTGGGAGACACAAGGAGG - Intronic
969467465 4:7366244-7366266 GGACTGAGAGAGAGAGAGGAAGG - Intronic
969734116 4:8975522-8975544 TGTCAGAGAGAGAGAAAAGATGG + Intergenic
969847319 4:9929644-9929666 GGTGTGAGGGGGACACTAGAAGG + Intronic
971027106 4:22599480-22599502 TGTCAGAGAGAAACACAACAGGG - Intergenic
971210983 4:24616044-24616066 AGACTGTGAGAGACAGAAGAGGG + Intergenic
974324750 4:60398959-60398981 GGCCTGAGACAGCCACATGAGGG + Intergenic
974484055 4:62484110-62484132 GGCATGAGAGATACACAAGTTGG - Intergenic
974949443 4:68570298-68570320 GGTCAGAGAGAAACAGAACAGGG + Intronic
974950034 4:68576440-68576462 GGTCAGAGAGAAACAGAACAGGG + Intronic
974987765 4:69051093-69051115 GGTCAGAGAGAAACAGAACAGGG - Intronic
974988343 4:69057092-69057114 GGTCAGAGAGAAACAGAACAGGG - Intronic
976532161 4:86168123-86168145 AGTCTGAGCGACACAGAAGACGG + Intronic
976778372 4:88731248-88731270 GATCTGACAGAAAAACAAGAGGG + Intronic
976989911 4:91353340-91353362 GGTCAGAGAGAAACAGAACAGGG + Intronic
976990524 4:91359180-91359202 GGTCAGAGAGATACAGAACAGGG + Intronic
977135696 4:93300886-93300908 GGTCAGAGAGAAACAGAACAGGG + Intronic
978290541 4:107133745-107133767 GATCTGAGAAAGACTCAAGGAGG - Intronic
979428023 4:120592141-120592163 GGTATGAGAGAGAAAGAAGAAGG - Intergenic
980719322 4:136673068-136673090 GGTTTGAGAGGGATACATGAGGG + Intergenic
982605308 4:157508713-157508735 GGTTTGGAAGAGACACAAAAAGG - Intergenic
983449917 4:167896281-167896303 GGTCAGAGAGAAACAGAACAGGG + Intergenic
984800624 4:183713027-183713049 GCTCTGAAAGAGACACATGGGGG - Exonic
984951319 4:185009840-185009862 GGAGTGAGACAGACACAGGAAGG - Intergenic
986202240 5:5589233-5589255 GGTCTGACAGAGTCACAATAAGG + Intergenic
986461429 5:7976520-7976542 TGTCCGAGAGAGCCACAGGAAGG + Intergenic
987402099 5:17488572-17488594 TGTCTTAGAGAGACACAAGCAGG + Intergenic
987490767 5:18578040-18578062 GGTCTAAGAGAGAAAAGAGAAGG + Intergenic
987855885 5:23420308-23420330 GGTCAGAGAGAAACAGAACAGGG + Intergenic
988095534 5:26603898-26603920 GTTCTGGGAGAGAGACAAAAAGG + Intergenic
988287575 5:29240104-29240126 GGTCAGAGAGAAACAGAACAGGG + Intergenic
988964479 5:36402632-36402654 GGTATGAGAGAGAAAGAACAAGG - Intergenic
989339499 5:40357459-40357481 CTTATGAGAGAGAAACAAGAGGG + Intergenic
989418182 5:41205300-41205322 AGTGTGAGAGACACAGAAGATGG + Intronic
989490133 5:42041049-42041071 CCTCTGAGAAAGACACAAGAGGG - Intergenic
989557375 5:42813403-42813425 GGTCAGAGAGAAACAGAACAGGG - Intronic
989750570 5:44888055-44888077 GGGCTGAGAGAGAGATAACAGGG + Intergenic
990006201 5:50946487-50946509 GGACTGAGAGAGAGAGAAGGGGG - Intergenic
990325401 5:54670634-54670656 GGTGTGAGAGAGACAGAGAAGGG - Intergenic
992308921 5:75474161-75474183 GGTCAGAGAGAAACAGAACAGGG - Intronic
992360247 5:76030645-76030667 GCCCTGAGAGAGACAGAATACGG - Intergenic
994040482 5:95254111-95254133 AGTTTGAGAGAAATACAAGAGGG - Intronic
995223850 5:109682153-109682175 CTGCTGAGAGAGACATAAGAAGG - Intergenic
996128727 5:119755128-119755150 GGTCAGAGAGAAACAGAACAGGG - Intergenic
996582212 5:125044038-125044060 GGTCTCCCAGAGACTCAAGAGGG + Intergenic
997275872 5:132588830-132588852 CTTGTGAGAGAGAGACAAGAAGG + Exonic
998115124 5:139531322-139531344 GGTCAGAGAGAAACAGAACAGGG - Intronic
999249411 5:150173189-150173211 TGAATGAGAGAGGCACAAGATGG - Intronic
999755624 5:154662350-154662372 AGTATGAGAGAGACAGAAAAAGG + Intergenic
1000605116 5:163319268-163319290 GGTCAGAGAGAAACAGAACAGGG + Intergenic
1001967441 5:175921171-175921193 GGTCTGAGAGTCATACAAGCTGG - Intronic
1005092233 6:22069724-22069746 TATCTGAGAGAGAAACTAGAAGG - Intergenic
1005339977 6:24834625-24834647 GGTCTCTGAGAGACACAGAAAGG + Intronic
1005472754 6:26178056-26178078 GGTCAGAGAGAAACAGAACAGGG - Intergenic
1005562244 6:27052541-27052563 GGTCAGAGAGAAACAGAACAGGG + Intergenic
1005601985 6:27435929-27435951 TGATTAAGAGAGACACAAGATGG - Intergenic
1006032364 6:31186515-31186537 GGTCAGAGAGAAACAGAACAGGG + Intergenic
1006247783 6:32755453-32755475 GCAGTGAAAGAGACACAAGAAGG + Intergenic
1006355809 6:33557084-33557106 GATGTGAGAGAGACACATGGAGG + Intergenic
1007735650 6:43980697-43980719 GGCCTGGAACAGACACAAGATGG + Intergenic
1007822829 6:44573577-44573599 AGTATGGCAGAGACACAAGATGG + Intergenic
1007876045 6:45102314-45102336 AGTTTAAGAGAGACACAAAAGGG + Intronic
1008276849 6:49551862-49551884 GGTCCTAAAGAGAAACAAGAGGG - Exonic
1009292817 6:61905293-61905315 GGTATGAGAGAGAGAGAATATGG + Intronic
1009357282 6:62766422-62766444 GGTCAGAGAGAAACAGAACAGGG - Intergenic
1009749945 6:67869967-67869989 TGGCTGTGAGAGACAGAAGATGG + Intergenic
1010317558 6:74468376-74468398 GGTCAGAGAGAAACAGAACAGGG - Intergenic
1010653409 6:78481370-78481392 GGTCTGAGAGAGAAGCAGAAAGG - Intergenic
1011212626 6:84970387-84970409 GCTCTAAGAGAGGCCCAAGAGGG + Intergenic
1011668210 6:89656480-89656502 GGTCGGGGAGAGACACAGGCAGG + Intronic
1011950851 6:92961820-92961842 GGACTTAGAGACACACTAGAAGG - Intergenic
1012179285 6:96131018-96131040 GGTTTGAGAATGACACAAGATGG + Intronic
1012487922 6:99742949-99742971 GGACGGAGGGAGACACAAGTGGG - Intergenic
1013558867 6:111284395-111284417 GGTCAGAGAGAAACAGAACAGGG + Intergenic
1013559506 6:111290369-111290391 GGTCAGAGAGAAACAGAACAGGG + Intergenic
1014138941 6:117918857-117918879 GGTATGAGAGAGAGAGAAGAGGG + Intronic
1018732269 6:166660417-166660439 TGTGTGAGAGAGAGAGAAGAAGG + Intronic
1018769528 6:166958503-166958525 GGTCAGAGAGAAACAGAACAGGG + Intergenic
1019040247 6:169097997-169098019 GGTGTGAGCGAGGCACAAGAGGG + Intergenic
1019321088 7:415547-415569 GGTCAGAGAGAGGCACCAGCCGG + Intergenic
1020067744 7:5202191-5202213 GGTCTTAGAGAAAAACAAGATGG + Intronic
1020245198 7:6424229-6424251 GGACTGAGGAAGACAGAAGAGGG + Intronic
1021081323 7:16369304-16369326 GGTCAGAGAGAAACAGAACAGGG + Intronic
1021169604 7:17382823-17382845 GGTCAGAGAGAAACAGAACAGGG + Intergenic
1021792215 7:24217199-24217221 GATCTGCTAGAGACACATGAAGG - Intergenic
1021961935 7:25881643-25881665 GGACTGGGAGATACACAAGGCGG + Intergenic
1022955466 7:35376289-35376311 GCTCAGAGAGGGACAGAAGAAGG + Intergenic
1023028416 7:36072657-36072679 GGCCTGAGGGAGAAGCAAGAAGG - Intergenic
1023248205 7:38229800-38229822 GGGCTGTGACAGACACACGAAGG - Intronic
1023364664 7:39451767-39451789 AGAGTGAGAGAGAGACAAGAAGG - Intronic
1023454346 7:40322228-40322250 GGAGAGAGAGAGACACAAGATGG - Intronic
1024382086 7:48708641-48708663 GGTCTGAGAGACAAACAAGGAGG - Intergenic
1026210508 7:68299922-68299944 GGTCACAGAGAGACATCAGATGG - Intergenic
1026387416 7:69863959-69863981 GGTCTGTCAGAGAGACAGGAAGG - Intronic
1026400068 7:70001127-70001149 TGTCTGAGAAAGAAACAAAAAGG - Intronic
1027350262 7:77304878-77304900 GGTCAGAGAGAAACAGAACAGGG + Intronic
1029078281 7:97952863-97952885 TGTCAGAGAGAGAGAAAAGATGG - Intergenic
1031356112 7:120789115-120789137 GTTTTGAGAAAGACAAAAGAAGG - Intronic
1032526281 7:132580372-132580394 GGGCTAAGGGAGACACAAGTAGG + Intronic
1032553311 7:132805842-132805864 GGACTGAGAGAATCACAGGATGG + Intronic
1033046483 7:137967054-137967076 AGACTGAGAGAGAGAGAAGAAGG - Intronic
1033761607 7:144442076-144442098 GGTTTAAGAGAGAAACAGGAGGG + Intergenic
1034042105 7:147888867-147888889 AGTCTGAGATAGAAAAAAGAGGG + Intronic
1037767390 8:21780557-21780579 GGTCTGAGCGAGACTGAGGAAGG - Intronic
1040021062 8:42741738-42741760 GGTCAGAGAGAAACAGAACAGGG + Intergenic
1040359644 8:46652874-46652896 ATTTTGAGAGAGCCACAAGAGGG - Intergenic
1040609529 8:48969018-48969040 GGCCTGAGAGAGACTGGAGAAGG - Intergenic
1042293171 8:67191034-67191056 GATTTCAGAGAGGCACAAGAAGG + Intronic
1042355684 8:67824959-67824981 GGTCAGAGAGAAACAGAACACGG - Intergenic
1044001565 8:86888301-86888323 TGTCTCAGAGAGAGAGAAGAAGG + Intronic
1044142761 8:88675112-88675134 GGTCAGAGAGAAACAGAACAGGG - Intergenic
1044323260 8:90830374-90830396 TGACTGAGAGATACACAGGAAGG + Intronic
1045175976 8:99725204-99725226 AATCTAGGAGAGACACAAGATGG - Intronic
1045238859 8:100380193-100380215 GGTCTGACAGAGATTCAAGATGG - Intronic
1045702551 8:104883342-104883364 GATCTGAGAAAGACCCAAGGAGG - Intronic
1045834132 8:106500414-106500436 GGTCAGAGAGAAACAGAACAGGG - Intronic
1047315063 8:123725398-123725420 GTTCTGAGAGAGATAGGAGATGG - Intronic
1047621769 8:126615057-126615079 GGTGAGAAAGAGACACAAAAGGG - Intergenic
1048025749 8:130585088-130585110 GGATTGAGGGAGACAAAAGAAGG + Intergenic
1048215669 8:132492307-132492329 GGTCAGAGAGAGGAACAACAAGG + Intergenic
1048391674 8:133972737-133972759 GTTCTGAAAAAGACACAACATGG + Intergenic
1048509330 8:135048355-135048377 GGACTGGGAGAGCCACCAGATGG - Intergenic
1048999634 8:139816464-139816486 GGGCTGGGAGAGACGCAAGGGGG + Intronic
1050011257 9:1187678-1187700 GGCCTGAGTGACACACAAGATGG - Intergenic
1050284300 9:4085411-4085433 GGTCTGAGAGATACTACAGAAGG - Intronic
1050491083 9:6188504-6188526 GGTCTCAGAGAAAGACCAGAAGG + Intergenic
1052661876 9:31443941-31443963 GGTCAGAGAGAAACAGAACAGGG - Intergenic
1053563854 9:39226452-39226474 GGTGAGAGAGAGACAAAAGTAGG + Intronic
1053792080 9:41693772-41693794 GTGCTGAGGGACACACAAGAGGG - Intergenic
1053829641 9:42064349-42064371 GGTGAGAGAGAGACAAAAGTAGG + Intronic
1054133294 9:61392618-61392640 GGTGAGAGAGAGACAAAAGTAGG - Intergenic
1054180487 9:61905792-61905814 GTGCTGAGGGACACACAAGAGGG - Intergenic
1054472868 9:65552197-65552219 GTGCTGAGGGACACACAAGAGGG + Intergenic
1054600920 9:67123105-67123127 GGTGAGAGAGAGACAAAAGTAGG - Intergenic
1054657104 9:67675350-67675372 GTGCTGAGGGACACACAAGAGGG + Intergenic
1054711207 9:68512593-68512615 GGACCCAGAGACACACAAGAAGG - Intronic
1055468997 9:76592915-76592937 AGGCTGAGAGAGAAACAAGAAGG + Intergenic
1058887414 9:109331735-109331757 GGTCTGAGAGAGAGAGAGAAAGG + Intergenic
1059409701 9:114124292-114124314 GGTAAGAGAGTGACACAAGCAGG - Intergenic
1060222061 9:121769659-121769681 TGGCTGTGAGAGACACAGGAGGG + Intronic
1060318915 9:122537225-122537247 GGTCAGAGAGAAACAGAACAGGG + Intergenic
1060340857 9:122775848-122775870 GGTCAGAGAGAAACAGAACAGGG - Intergenic
1060536419 9:124392538-124392560 GCTCTGAGGGTTACACAAGATGG + Intronic
1061262382 9:129487453-129487475 GGACTGGGAGAGCCACAGGAAGG + Intergenic
1061630780 9:131870869-131870891 GGTCTGACAGAGACACCGGTGGG + Intronic
1062719853 9:138034337-138034359 GGTCTGAGAGAGAGCCAAGTGGG - Intronic
1185895957 X:3859138-3859160 GGTCAGAGAGAAACAGAACAGGG - Intergenic
1185901076 X:3897562-3897584 GGTCAGAGAGAAACAGAACAGGG - Intergenic
1185906190 X:3936001-3936023 GGTCAGAGAGAAACAGAACAGGG - Intergenic
1186013362 X:5163142-5163164 GGTCAGAGAGAAACAGAACAGGG - Intergenic
1186260976 X:7779131-7779153 GGTCAGAGAGCAACACAAAATGG + Intergenic
1189248371 X:39580901-39580923 TGGCTGGGAGAGAGACAAGAGGG - Intergenic
1190246565 X:48694868-48694890 GATCTGAGAGGGAGACAAAAGGG - Intergenic
1190639786 X:52473149-52473171 GGTCAGAGAGAAACAGAACAGGG - Intergenic
1190768858 X:53498589-53498611 GGTCTGAAAGACTCATAAGAAGG + Intergenic
1191175904 X:57501727-57501749 GGGCTGAAAGAAACACTAGAGGG + Intergenic
1192074991 X:67985023-67985045 GGTCAGAGAGAAACAGAACAGGG - Intergenic
1192300748 X:69899214-69899236 GTTCTGTGAGAGACACAATGAGG + Intronic
1193186058 X:78514098-78514120 GGTCAGAGAGAAACAGAACAGGG + Intergenic
1193538824 X:82745994-82746016 GGTCAGAGAGAAACAGAACAGGG - Intergenic
1195850051 X:109273126-109273148 GGGCTGAAAAAGACACCAGAAGG + Intergenic
1196182852 X:112713932-112713954 GGTCTGACAGAGATACTAGCTGG - Intergenic
1196252093 X:113473158-113473180 AGTCAGAGAGAAACAGAAGAGGG + Intergenic
1197114239 X:122813722-122813744 GGTCAGAGAGAAACAGAACAGGG + Intergenic
1197544792 X:127811615-127811637 GGACTCAGAAAGAGACAAGAAGG + Intergenic
1197745897 X:129932179-129932201 GGACTTAGAGAGGGACAAGAAGG - Intergenic
1198745417 X:139885152-139885174 TGTGTGAGAGAGACAGAGGAAGG - Intronic
1199018541 X:142848023-142848045 TGACAGAGAGAGACACCAGATGG - Intergenic
1199162851 X:144634618-144634640 GGTCAGAGAGAAACAGAACAGGG - Intergenic
1200664696 Y:6006068-6006090 TGTGTGACAGAGAGACAAGATGG - Intergenic
1201338856 Y:12909505-12909527 AGTCTGAAAGAGGCACAGGAGGG - Intronic
1201372677 Y:13282530-13282552 GGTCAGAGAGAAACAGAACAAGG - Intronic
1201390682 Y:13493849-13493871 GGTCAGAGAGAAACAGAACAGGG + Intergenic