ID: 1170394210

View in Genome Browser
Species Human (GRCh38)
Location 20:15908481-15908503
Sequence GGGTGTAAAAAGTTTAATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170394210_1170394216 5 Left 1170394210 20:15908481-15908503 CCCATATTAAACTTTTTACACCC 0: 1
1: 0
2: 2
3: 10
4: 209
Right 1170394216 20:15908509-15908531 AATGTGTCCTGCTTCCTGCTGGG 0: 1
1: 1
2: 1
3: 22
4: 226
1170394210_1170394220 30 Left 1170394210 20:15908481-15908503 CCCATATTAAACTTTTTACACCC 0: 1
1: 0
2: 2
3: 10
4: 209
Right 1170394220 20:15908534-15908556 CATGACTAGTCTCTTCTAGTTGG 0: 1
1: 0
2: 0
3: 9
4: 69
1170394210_1170394215 4 Left 1170394210 20:15908481-15908503 CCCATATTAAACTTTTTACACCC 0: 1
1: 0
2: 2
3: 10
4: 209
Right 1170394215 20:15908508-15908530 GAATGTGTCCTGCTTCCTGCTGG 0: 1
1: 1
2: 1
3: 24
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170394210 Original CRISPR GGGTGTAAAAAGTTTAATAT GGG (reversed) Intronic
908111813 1:60905311-60905333 GGGTGTTAAAGGTAGAATATGGG + Intronic
910346138 1:86240817-86240839 AGTTGTTAAAAGTATAATATGGG + Intergenic
911680936 1:100714394-100714416 GGGAGTAATAATTTTCATATTGG + Intergenic
912069621 1:105793597-105793619 TGGTGTAAAATGTTTGATATAGG - Intergenic
915672468 1:157501921-157501943 GGTTGTAAAATGTTTCTTATTGG + Intergenic
917631086 1:176892076-176892098 GGGTAGAAAGAGTTAAATATTGG + Intronic
918139782 1:181710514-181710536 GGGTGTAAAAACCTTGATACAGG + Intronic
918288602 1:183083645-183083667 AGGTGTAAAAATTTTAATATAGG + Intronic
918775130 1:188618794-188618816 GGTTTTAAAGGGTTTAATATAGG + Intergenic
919052990 1:192534201-192534223 GGATGTAAAAATTTTAGTACAGG - Intergenic
919705077 1:200668746-200668768 GGTTGTAAATTGTTTTATATTGG - Intronic
920832085 1:209474637-209474659 GGCTGTTAAAAAGTTAATATGGG - Intergenic
922585516 1:226731974-226731996 GTGTGTAAAAATTTTAGTTTGGG - Intronic
923706656 1:236349717-236349739 GGTTGTAAAATGTTTCTTATCGG + Intronic
1063711297 10:8481593-8481615 GGCTGTAAAAAGTTTGCAATTGG + Intergenic
1064336922 10:14451815-14451837 GTGTGAAAACAGATTAATATAGG + Intronic
1068708092 10:60099642-60099664 GGGTGAAAAAAGTGACATATAGG - Intronic
1069185734 10:65420327-65420349 GGTTGTAAAATGTTTCTTATGGG - Intergenic
1069266792 10:66468494-66468516 AGGTGTACAAAGTTTCATTTAGG + Intronic
1069450870 10:68516651-68516673 GGGTGTAAAAAGTAAAGTAGAGG - Intronic
1071355681 10:84791217-84791239 TGGTGTAAAAAGTTAACAATAGG - Intergenic
1072064694 10:91855036-91855058 AGGTGTTCAAAGTTAAATATGGG - Exonic
1073370195 10:102981390-102981412 AGAGGTAAAAAATTTAATATAGG - Intronic
1074376483 10:112945061-112945083 AGGTGAAAAAAGTTTCATCTAGG - Intergenic
1074744229 10:116515370-116515392 GGGTGTTAGGATTTTAATATAGG - Intergenic
1081041108 11:38214578-38214600 AGCTGTAAAAACTTTAATAAAGG + Intergenic
1081163429 11:39780524-39780546 ATGTGTGAAAAGTTGAATATGGG + Intergenic
1081267949 11:41050018-41050040 GGGGGTAAATAGTATGATATAGG + Intronic
1083065412 11:59918297-59918319 GCAGGTAAAAAGTTTAATGTAGG - Intergenic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1086319101 11:85626789-85626811 CGGTGTAAAAAGTTTAGTTGTGG - Intronic
1086767898 11:90721911-90721933 TCATTTAAAAAGTTTAATATTGG - Intergenic
1087389113 11:97512291-97512313 GTTTGTAAAAAGTTTCTTATTGG + Intergenic
1087390262 11:97522053-97522075 GGTTGTAAAATGTTTCTTATTGG + Intergenic
1088421707 11:109655629-109655651 GGGTGTGAAAAGTTGATGATGGG + Intergenic
1091086856 11:132729376-132729398 GTGTGTAAAATCTATAATATGGG - Intronic
1091141212 11:133236476-133236498 GGGTGTAAAAAGTAAAGTAGAGG + Intronic
1092730871 12:11533275-11533297 GGCTGGAAAATGTTTAATAATGG + Intergenic
1093206465 12:16257409-16257431 GGTTGAAAAAATTTTAATAATGG - Intronic
1094647133 12:32336642-32336664 GAATGTAACAAGTTTATTATAGG - Intronic
1097997069 12:65899335-65899357 GGGAGAAAAAAGTTAAATGTAGG - Intronic
1098599404 12:72312566-72312588 GGGTGTTAAAAAGGTAATATTGG + Intronic
1100261472 12:92936156-92936178 GGTTGTAAAATGTTTCTTATTGG - Intergenic
1100529597 12:95451444-95451466 GGGTGTCCAAAGTTTAACTTGGG + Intergenic
1104125497 12:125842017-125842039 GGGTGTAAAAGGTATAATCATGG - Intergenic
1106119794 13:26850648-26850670 GGTTGTAAAATGTTTCCTATCGG - Intergenic
1107362894 13:39639084-39639106 GGTTGTAAAATGTTTCTTATGGG - Intergenic
1107901597 13:45020997-45021019 GGATGTAAATATTTAAATATGGG + Intronic
1109067843 13:57722907-57722929 GGGTATCAGAAGTTCAATATTGG - Intronic
1109428508 13:62199952-62199974 GGGTGTTAAATGTTAAGTATGGG - Intergenic
1113016600 13:105835169-105835191 GGGTGGAAAAAGGGGAATATTGG + Intergenic
1114387541 14:22270471-22270493 GTGTGTAAATAGTTTATTATAGG - Intergenic
1116966895 14:51024344-51024366 GGGAATCAAAAGTTTAACATGGG + Intronic
1119029681 14:71182080-71182102 GGGTTTAAAAGGTTTAATGATGG - Intergenic
1120237473 14:81909178-81909200 GGGTATAAGAATTATAATATTGG - Intergenic
1123765705 15:23476765-23476787 AGATGTAAAAAGATTAACATCGG + Intergenic
1124055396 15:26237177-26237199 GGCTGCAAAAAGTTTAGGATGGG + Intergenic
1126645032 15:50867390-50867412 GGTTGTAAAATGTTTCTTATTGG + Intergenic
1128903686 15:71448866-71448888 GGTGGTGAAAAGTTAAATATAGG + Intronic
1130171142 15:81515945-81515967 GAGTATAAAAAGTCTGATATTGG + Intergenic
1131138325 15:89956277-89956299 GGGAAAAAAAAGTTTAAAATTGG + Intergenic
1131793232 15:95987604-95987626 GGGAGTAGAAAATTAAATATTGG + Intergenic
1133645881 16:7764075-7764097 GGTTGTAAAATGTTTCTTATGGG - Intergenic
1135034606 16:19066667-19066689 GGATATACAACGTTTAATATTGG - Intergenic
1137367028 16:47869460-47869482 GGGTCTAAGAAGGTCAATATTGG + Intergenic
1137597776 16:49736262-49736284 AGGTCAAAAAAGTTGAATATTGG + Intronic
1137884467 16:52087697-52087719 GGTTGTAAAATGTTTCTTATCGG - Intergenic
1140349670 16:74250343-74250365 AGGTGCAAACATTTTAATATAGG + Intergenic
1143406774 17:6682937-6682959 GGGTGGAAATAGCTTAATTTGGG + Intergenic
1143420530 17:6788156-6788178 GGTTGTAAAATGTTTCTTATTGG + Intronic
1147495404 17:40910901-40910923 GGGAAGAAAAAGTTTAAGATGGG - Intergenic
1149253184 17:54793936-54793958 GGGTGGAAAAAGTTGGATCTAGG - Intergenic
1150898878 17:69247456-69247478 TGGTTTAAAAAGTTTTTTATTGG - Exonic
1158017566 18:52802453-52802475 GGGAGTAAAAAGTTATATATGGG - Intronic
1162221471 19:9180512-9180534 GAGTGTAAAAAATTTAATATCGG - Intergenic
1164748509 19:30633872-30633894 GGGTGTTTAAAATCTAATATTGG - Intronic
1168329254 19:55557027-55557049 GGGTGTTAAAAGTTAAAAATAGG - Intergenic
925703909 2:6666151-6666173 GTGTGGAAAAAGACTAATATAGG - Intergenic
925800250 2:7591944-7591966 GGTTGTAAAATGTTTCTTATGGG + Intergenic
928762688 2:34603358-34603380 GGGTGTAAGAAGTATAATTATGG - Intergenic
931059077 2:58505965-58505987 GGGTGTAAAAAGTCCAGAATGGG - Intergenic
932249562 2:70230878-70230900 GGGTGAATAAAGCTTAAAATTGG - Intronic
933362478 2:81305294-81305316 GGGATGAAAAACTTTAATATGGG + Intergenic
933514469 2:83283335-83283357 GGTTGTAAATTGTTTTATATCGG - Intergenic
934870233 2:97857981-97858003 GGTAATAAAAAGTTTAATTTTGG - Intronic
938363301 2:130711117-130711139 AGATGTAAAAAGGTTAACATAGG + Intergenic
938574915 2:132594889-132594911 AGGATTAAACAGTTTAATATTGG + Intronic
938658206 2:133457529-133457551 GAGTGTAAAATATTTAAGATGGG + Intronic
940209920 2:151245802-151245824 GGTTGTAAAATGTTTCTTATTGG + Intergenic
940335335 2:152520798-152520820 GGGTGAAACAAGTTTAACAGAGG - Intronic
947983654 2:234430364-234430386 GAGTGAAAAAAGATTAATGTGGG - Intergenic
1169491601 20:6076026-6076048 GGGAGAAAAAAGTCTATTATTGG + Exonic
1170173369 20:13440021-13440043 GGGTCTAAAAACTTTCAAATGGG + Intronic
1170259929 20:14393061-14393083 GGGTCTAAAAAGCTTACTGTTGG - Intronic
1170394210 20:15908481-15908503 GGGTGTAAAAAGTTTAATATGGG - Intronic
1171056214 20:21909395-21909417 GGGTGAAAAAAGTACCATATTGG + Intergenic
1174386117 20:50189568-50189590 GGGTGAAAAAAGTTGAACCTCGG + Intergenic
1174882834 20:54299521-54299543 GGGTTTCAAAAGTTAAATGTAGG - Intergenic
1175349352 20:58307909-58307931 GTGTGTAAAGAGTTTAAGACTGG + Intergenic
1177435561 21:21048126-21048148 GGTTGTAAAATGTTTCTTATTGG - Intronic
1178968866 21:37152726-37152748 GGGTGTAAAATGCTTACTTTTGG + Intronic
1183464106 22:37970767-37970789 AGTTCTAAAAAGTTTAATACAGG + Intronic
950901855 3:16505133-16505155 TGGTGTAAAATGGTTAATGTGGG - Intronic
952091227 3:29888921-29888943 GGGAGTAAAAAGCTTAGTGTAGG - Intronic
953578727 3:44134436-44134458 GGGTGCAAAAAGTTTTCTGTGGG + Intergenic
954854677 3:53633779-53633801 GGTTGTAAAAAGTGTAAGACTGG + Intronic
957451118 3:80384212-80384234 GGGTTTAAAAAATTTACTACAGG - Intergenic
957599302 3:82312276-82312298 TGGTGTAAAATATTTAGTATAGG + Intergenic
959588086 3:108044889-108044911 GGGAGTAAAAAGCATATTATGGG + Intronic
962577185 3:136765307-136765329 GGGATTAAAAAGTTAATTATTGG - Intergenic
963197160 3:142545027-142545049 GAGTGCAAGAACTTTAATATTGG - Intronic
964289194 3:155156880-155156902 GGGTGAAAAAAATTTATTCTAGG + Intronic
964827203 3:160841678-160841700 GGCAGTAATAAGTTTAATAGCGG - Intronic
965018576 3:163194558-163194580 GGGTTTTAAAAGTTTGAAATAGG - Intergenic
965820421 3:172679420-172679442 GGGTGTAAAAAGTAAAGTAGAGG - Intronic
966800371 3:183758055-183758077 GAGTATAAAATGTTTAATGTTGG + Intronic
967636326 3:191806258-191806280 GGCTGTAAAATGTTTCTTATTGG - Intergenic
967755399 3:193162815-193162837 GGTTGTAAAATGTTTTTTATCGG - Intergenic
968157428 3:196393986-196394008 TTGTGTAAAAAGTTTACTATCGG + Intronic
971412871 4:26393802-26393824 GGGTGCAGAGAGTTTAAAATTGG + Intronic
972523994 4:39890487-39890509 GGGTGTAAAAATTTTAGTCAGGG - Intronic
974246743 4:59329871-59329893 TGGGGGAAAAAGTCTAATATGGG + Intergenic
974681519 4:65170017-65170039 GGAGATAAAAAGTTAAATATGGG + Intergenic
975412291 4:74067636-74067658 GGCTTTAAAATGTCTAATATGGG - Intergenic
976267644 4:83199641-83199663 GGGTTTAAATAATTTAACATTGG - Intergenic
976873529 4:89825876-89825898 TGATGTAAAATGTTTATTATGGG - Intronic
977077213 4:92470309-92470331 GGGCGTAAAACATATAATATTGG + Intronic
978566892 4:110092356-110092378 GCCTGTAAGAAGTTTCATATGGG + Intronic
981281397 4:142963943-142963965 GGGAGTAAAAAGTTTAGGTTTGG + Intergenic
981292775 4:143095818-143095840 GGTTGTAAAATGTTTCTTATGGG - Intergenic
981406001 4:144369850-144369872 GGGAATAAATATTTTAATATTGG + Intergenic
982872507 4:160600684-160600706 GGGTTTAAAAAGTTTTATTAAGG - Intergenic
983943458 4:173560652-173560674 AGTTGTAAAACATTTAATATAGG - Intergenic
988365590 5:30294421-30294443 GGTTGTAAAATGTTTCTTATTGG - Intergenic
991234598 5:64379062-64379084 GGTTGTAAAATGTTTCTTATCGG - Intergenic
991259022 5:64646724-64646746 GGGAGTAGAAATTTTAATTTGGG - Intergenic
991468789 5:66945073-66945095 GGGTTTTAAAACTTTTATATGGG + Intronic
992049968 5:72932871-72932893 GGGTGTTCAAAGTTTAACTTGGG - Intergenic
992138997 5:73776927-73776949 GGGTTTTAATACTTTAATATTGG + Intronic
992720828 5:79559789-79559811 GGTTGTAAAATGTTTCTTATCGG - Intergenic
993020722 5:82587092-82587114 GGGTGTAAAAAGTTATTTAAGGG + Intergenic
993586689 5:89739512-89739534 GGGAGTAAAAGGTCTAAAATGGG + Intergenic
995630250 5:114125174-114125196 GGGTACAAAAAGTTAAATTTGGG - Intergenic
995823295 5:116263557-116263579 GGCTGTAAAATGTTTCTTATCGG - Intronic
996350091 5:122530418-122530440 TTCTGTAAAAAGTTTAATATTGG + Intergenic
996940484 5:128999610-128999632 GGGTGTAAAAAGTTGGACTTTGG - Intronic
998066705 5:139165113-139165135 GGTTGTAAAATGTTTCTTATCGG - Intronic
1001054178 5:168435706-168435728 GGGTGAAAAAAGTTTTAGGTCGG - Intronic
1002826889 6:782105-782127 GGGTGTCAGAAGTTTGAGATGGG + Intergenic
1002961557 6:1919742-1919764 TGGAGAAATAAGTTTAATATAGG - Intronic
1006413644 6:33890662-33890684 GGTTGTAAAATGTTTCTTATCGG - Intergenic
1006524244 6:34590250-34590272 AGGGGGAAAAAGTTTAAAATGGG - Exonic
1007866309 6:44973650-44973672 GTGTGAAAACAGATTAATATAGG - Intronic
1008132736 6:47737460-47737482 GGAGGTCAAAAGTTTAAAATGGG + Intergenic
1008354921 6:50541461-50541483 AGGTGTAAAAATGTTCATATTGG + Intergenic
1010012905 6:71069882-71069904 AAATATAAAAAGTTTAATATAGG - Intergenic
1011440592 6:87383087-87383109 GGGTCTAAACAATTTAATAACGG - Intronic
1013033560 6:106359652-106359674 GGGTGTGAAAAGTTTTTTAATGG - Intergenic
1014033489 6:116737960-116737982 GGTTGTTAAATGTTTAATTTGGG + Intronic
1015167539 6:130214855-130214877 GGGTTTATAAAGTTGAATACTGG - Intronic
1016298664 6:142604595-142604617 GGTAGTTAAAAGTTTAATGTTGG - Intergenic
1017349166 6:153419336-153419358 GGTTGTAAAACGTTTCTTATCGG + Intergenic
1019102441 6:169642230-169642252 GGGTGTGTAACGTTTAATAGTGG - Intronic
1020553431 7:9637947-9637969 GGCTATAAATAGATTAATATGGG - Intergenic
1020610514 7:10390851-10390873 GGTTGTAAAATGTTTCTTATTGG - Intergenic
1022769368 7:33452718-33452740 GAGGGTAAAAAGGTTATTATGGG + Intronic
1022817475 7:33927662-33927684 GGGGGTAAAGAGTTTAAAAGTGG - Intronic
1024043310 7:45571457-45571479 GGGTGTCAAAAGTTGAATTGTGG - Intergenic
1027567337 7:79812451-79812473 GGGGGAAAAAAGTATAGTATAGG - Intergenic
1028840689 7:95426946-95426968 GTGTTTGAAAAGTTTAATATGGG + Intronic
1030118085 7:106078875-106078897 GGTTGTAAAATGTTTCTTATAGG - Intergenic
1030396327 7:108990997-108991019 GGTTGTAAATTGTTTTATATTGG + Intergenic
1030527128 7:110667739-110667761 GGATGTCAAAAGTCCAATATGGG - Intronic
1031674691 7:124595223-124595245 GGTTGTAAAAAGTTTAGGACGGG - Intergenic
1036040514 8:5075202-5075224 GGGGGCAACAAGTTTACTATGGG - Intergenic
1036296847 8:7544250-7544272 GGTTGTAAAATGTTTCTTATTGG + Intergenic
1036325720 8:7776769-7776791 GGTTGTAAAATGTTTCTTATTGG - Intergenic
1040651469 8:49453745-49453767 GGGTCAAAAAGATTTAATATTGG - Intergenic
1040762216 8:50862840-50862862 GTGTGTAAAAACTTTATTCTGGG - Intergenic
1043535294 8:81196636-81196658 GGTTGTAAAATGTTTCTTATCGG - Intergenic
1043574360 8:81640874-81640896 GGATGTAAAATATTTAATAGAGG + Intergenic
1045794864 8:106030760-106030782 GGGTGGAAAAAGATCAAGATAGG - Intergenic
1048624382 8:136168857-136168879 GGGTGGAAAAAGTATAATTATGG - Intergenic
1051291489 9:15550189-15550211 GGATATAAAGAGTTGAATATTGG + Intergenic
1051577654 9:18635119-18635141 GGGAGTAAATAGTATAATTTAGG + Intronic
1051782677 9:20707458-20707480 GGGAGTAAAAAGTTACATACAGG - Intronic
1052442024 9:28510243-28510265 GGGAGTGAAAAGTTTTATGTGGG - Intronic
1054857985 9:69921800-69921822 GGTTGTAAAATGTTTCTTATGGG - Intergenic
1055254044 9:74344831-74344853 GGGTGTAAAAGGTTACATGTAGG - Intergenic
1055351581 9:75394286-75394308 AAGTGTAAAAAGATTAATAAGGG - Intergenic
1057126189 9:92617932-92617954 GGGTGTAAGAAGTTTAAATGTGG + Exonic
1057349316 9:94281915-94281937 GGTTGTAAAATGTTTCTTATGGG + Intronic
1060133211 9:121125457-121125479 TGCTGTAAAAAGTTTAATTTCGG - Intronic
1060310688 9:122458380-122458402 GGGTTCAAAAAGTTTTTTATGGG + Intergenic
1060956128 9:127641502-127641524 GGGCTTGAAAACTTTAATATTGG - Intronic
1061742662 9:132718379-132718401 GGTTGTAAAATGTTTCTTATCGG - Intergenic
1062258516 9:135644038-135644060 GGTTGTAAAATGTTTCTTATGGG + Intergenic
1185513959 X:684545-684567 GGGTGTAAAAAGTAAAATAGAGG - Intergenic
1185660643 X:1726173-1726195 GGCTGTAAAATGTTTCTTATCGG + Intergenic
1185930721 X:4200407-4200429 GGGTCTCAAAAATTTAACATGGG + Intergenic
1186012899 X:5156737-5156759 GGTTGTAAAATGTTTCTTATGGG - Intergenic
1187753280 X:22491188-22491210 GTGTTTAAAAAGTTTGAAATGGG - Intergenic
1188169629 X:26908837-26908859 AGCTGTAAAAATATTAATATAGG + Intergenic
1188390286 X:29611216-29611238 GGTTGTAAAATGTTTCTTATTGG - Intronic
1188439621 X:30202510-30202532 GGTTGTAAAATGTTTCTTATAGG - Intergenic
1188698459 X:33227965-33227987 GGATAAAAAAAGTTTTATATTGG + Intronic
1188803879 X:34563296-34563318 GGTTGTAAAACGTTTCTTATAGG + Intergenic
1188872494 X:35390095-35390117 GGGTGTAAAAAGATGAGTCTAGG + Intergenic
1188876017 X:35431107-35431129 GGTTGTAAAATGTTTCTTATTGG + Intergenic
1188881573 X:35497972-35497994 GGTTGTAAAATGTTTCTTATTGG - Intergenic
1189826897 X:44928142-44928164 GAGTGAAGAAATTTTAATATAGG + Intronic
1192382469 X:70632757-70632779 AGGTGTTAAAAGGATAATATGGG + Intronic
1192802915 X:74484501-74484523 GGTTGTAAAATGTTTCTTATCGG + Intronic
1193809644 X:86036488-86036510 GGTTGTAAAATGTTTCCTATTGG + Intronic
1194289245 X:92049109-92049131 GGTTGTAAAATGTTTCTTATTGG + Intronic
1194718053 X:97309399-97309421 GGGTATAAAAAATGTAAAATTGG - Intronic
1195509740 X:105701117-105701139 GAGTTTAAAAATTTTAATAAAGG + Intronic
1197160302 X:123315357-123315379 GTGTGTGAAGAGTTTGATATGGG - Intronic
1198343063 X:135733531-135733553 AGGTGTACAAAATATAATATTGG - Intergenic
1198344926 X:135749764-135749786 AGGTGTACAAAATATAATATTGG + Intergenic
1200606762 Y:5273683-5273705 GGTTGTAAAATGTTTCTTATTGG + Intronic
1201407029 Y:13659879-13659901 GGGTGTCAAAAGTTTAACTCGGG + Intergenic