ID: 1170395452

View in Genome Browser
Species Human (GRCh38)
Location 20:15921078-15921100
Sequence CTCTCACCTGGCTGTTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 251}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170395452_1170395455 -8 Left 1170395452 20:15921078-15921100 CCCACAAAACAGCCAGGTGAGAG 0: 1
1: 0
2: 1
3: 24
4: 251
Right 1170395455 20:15921093-15921115 GGTGAGAGAGAACCCACCCATGG 0: 1
1: 0
2: 2
3: 18
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170395452 Original CRISPR CTCTCACCTGGCTGTTTTGT GGG (reversed) Intronic
900218782 1:1496009-1496031 CCCTCACCTGGCTCTGCTGTGGG - Exonic
900226136 1:1534450-1534472 CCCTCACCTGGCTCTGCTGTGGG - Exonic
903866253 1:26400492-26400514 CTCTCCCCTGTCTGTTTGGTGGG - Intergenic
903876362 1:26476593-26476615 CACAGACCTGGCTGTATTGTTGG + Intergenic
904438489 1:30514735-30514757 CTCTAACCTGCCTGCTGTGTAGG - Intergenic
905006236 1:34712490-34712512 TTCTGACCTGGCTGTTCTGGAGG - Intergenic
906020839 1:42628040-42628062 CTCCCTCCTGGCTGTTTCATGGG - Intronic
910225854 1:84935309-84935331 CTCTCACCAGGCTGATATATTGG - Intronic
911717507 1:101150893-101150915 AACTCACCTGGCTGATATGTGGG - Intergenic
913366142 1:118041359-118041381 CTCTCAGCTAGCTGTTATGAGGG - Intronic
915100958 1:153499833-153499855 TCCTCACCAGGCTGTTTTGGCGG - Intergenic
915171529 1:153981494-153981516 CTCTTCCCTAGCTGTTCTGTTGG - Intergenic
916015523 1:160746387-160746409 CTATAGCTTGGCTGTTTTGTTGG + Intronic
917894595 1:179475350-179475372 CTCCCACCTGGCTGCTTTCATGG - Intronic
919905665 1:202076694-202076716 CTCTCACTGGGCTGTGTTCTGGG + Intergenic
920500522 1:206482323-206482345 CTCTCTACTGGTTGTTTTATTGG - Intronic
922160132 1:223073588-223073610 CTCTAACGTGGCTGCTGTGTGGG - Intergenic
924531588 1:244898485-244898507 CACTTACCTGGGGGTTTTGTGGG - Intergenic
1063083446 10:2790590-2790612 CTCTGGCTTGTCTGTTTTGTGGG - Intergenic
1069362281 10:67656358-67656380 CTCCCACCTAGCTTTTTGGTAGG + Intronic
1070643380 10:78184865-78184887 CTGCCACCCGGCTGCTTTGTGGG + Intergenic
1071252781 10:83838068-83838090 CTCTCACCTATCTGTTTGGCTGG + Intergenic
1071384662 10:85107175-85107197 CTCTTTCCTGGATGTTTTCTGGG - Intergenic
1071427592 10:85574811-85574833 CATTCACATGGCTGTTTTGGTGG - Intergenic
1071654894 10:87437097-87437119 CTCTCTTCTGGCTGTAGTGTAGG + Intergenic
1071796323 10:89010133-89010155 CTATCACCTGGCCATTTTCTTGG + Intronic
1074214329 10:111369555-111369577 CTCTCAGATGGCTGTTTCCTGGG + Intergenic
1075049325 10:119171004-119171026 AGCTCACCTGCCTGTCTTGTAGG - Intronic
1076850647 10:133090892-133090914 CTCTCAAAAGGCTGGTTTGTCGG + Intronic
1078065428 11:8075934-8075956 CTCTCACTGGGCTGTTTTTGTGG + Intronic
1078454298 11:11463029-11463051 CTCCCACCTGCCTGTCCTGTAGG - Intronic
1082954912 11:58859342-58859364 CTCTCACCTGTGTGGTTTATGGG + Intronic
1085194277 11:74658824-74658846 CTCTCTCCTGGCTGCTTTCATGG + Intronic
1085588265 11:77732067-77732089 CTCCCTCCTGGCTGTTTTCATGG - Intronic
1085643407 11:78207608-78207630 CACTCACCTGGCTGTGTTCTAGG - Exonic
1086587967 11:88478030-88478052 CTCTCACCTGGCTCTGCTGGTGG - Intergenic
1088325756 11:108599099-108599121 CTCACACCTGGCTGGCTTCTGGG + Intergenic
1088719687 11:112581147-112581169 ATCTCACAGGGTTGTTTTGTGGG - Intergenic
1090499800 11:127250408-127250430 CTTTCACATGTGTGTTTTGTCGG - Intergenic
1091900339 12:4139549-4139571 CTTTCATCTGGATGTTTTTTAGG + Intergenic
1095138955 12:38639506-38639528 CTCTCACCTGACTCTTTTGAAGG + Intergenic
1095213932 12:39526677-39526699 CTCCCTCCTGGCTGTTTTCATGG + Intergenic
1098340287 12:69444220-69444242 CACTCACCTGTTTGATTTGTGGG + Intergenic
1099098997 12:78413123-78413145 GTCTCACCAGCCTGTTTTGTTGG - Intergenic
1099277944 12:80602048-80602070 CTCTCCCCTGGATGTTTTCTTGG + Intronic
1099507823 12:83500551-83500573 CTCCCTCCTGGCTGTTTTCATGG - Intergenic
1101013336 12:100473645-100473667 TTCTCCTCTGGCCGTTTTGTGGG - Intergenic
1101720056 12:107343167-107343189 ACCACACCTGGCTGTTTTTTTGG + Intronic
1102584311 12:113912436-113912458 CTCTCTGCTGCCTGTTTTCTTGG - Intronic
1102653752 12:114462695-114462717 CTCTCACTTGCCTATTTTATGGG + Intergenic
1105898851 13:24740258-24740280 CTCGCTCCTGTCTGTTGTGTGGG + Intergenic
1106075473 13:26457233-26457255 CTCTAACCTGTCTGCATTGTTGG + Intergenic
1109086056 13:57972904-57972926 CTCCCACCTGGCTGCTTTCATGG + Intergenic
1110103031 13:71633745-71633767 AACTCACCTGGCTGTTTGATGGG + Intronic
1111687178 13:91516529-91516551 CTCTCTCCTGGCTGCTTTCATGG + Intronic
1114212001 14:20623440-20623462 TTCCCACTTGGCTGTTTTCTTGG - Intergenic
1114498030 14:23147387-23147409 CCATCACCTCGTTGTTTTGTGGG - Intronic
1115002694 14:28441287-28441309 TTCTCATCTTGCTGTGTTGTGGG - Intergenic
1115095983 14:29636283-29636305 CTCTCACCTGATGGTTCTGTTGG + Exonic
1116396454 14:44452872-44452894 CTCTCTCCTGGCTGAGTTCTGGG + Intergenic
1117182011 14:53200757-53200779 CTCCCTCCTGGCTGTTTTCACGG - Intergenic
1121396945 14:93633637-93633659 CTCTCACTGGGCTGGTTGGTAGG + Intronic
1121902685 14:97708379-97708401 CTGTCCCCTGGCTGTTTTATTGG + Intergenic
1122661008 14:103294627-103294649 GTCTCAGCTGGCTTCTTTGTAGG + Intergenic
1127109429 15:55651746-55651768 CTCTGACCTGGCTCTTTTCAAGG - Intronic
1127585010 15:60370141-60370163 ATCTCAGCTGGCTGTTTGCTTGG - Intronic
1128855468 15:71009167-71009189 CCCTCACCTGCCTTTTTGGTGGG + Intronic
1129557606 15:76529196-76529218 CTCACACCTGGCTAATTTTTTGG + Intronic
1130415878 15:83694283-83694305 CTCTCTCCTGGGTGCTTTGGTGG + Intronic
1131537196 15:93247406-93247428 ATTTCACCAGGCTGTTTTTTTGG + Intergenic
1131620198 15:94060244-94060266 CTGTCACCTGGGTGCTTTGTTGG + Intergenic
1131980234 15:97987441-97987463 CTCTCTCCTGGCTGCTTTCATGG - Intergenic
1132433229 15:101777249-101777271 CCCTTACCTGGCTGTGGTGTTGG - Intergenic
1132624886 16:886958-886980 TTGTCTCCTGGCTGTTTTATTGG - Intronic
1134116630 16:11553550-11553572 CTCTGACCTGGCTGTCCTGCGGG - Exonic
1134628001 16:15736662-15736684 CCCTGGCCTGGCTCTTTTGTCGG - Intronic
1137037291 16:35577595-35577617 ATTTCCCCTGGCTTTTTTGTGGG - Intergenic
1137598207 16:49738694-49738716 CTCTCACCTGGCAGTGTTCCTGG - Intronic
1137608975 16:49806252-49806274 CTTTCATCTGGCGGTTGTGTGGG - Intronic
1139546322 16:67651499-67651521 CTCTCACCTGGATGTCCTGGCGG - Exonic
1139787335 16:69404482-69404504 CTGTCACATGGCTAATTTGTTGG + Intronic
1140808946 16:78558633-78558655 CTTACACCTAGCTGTTGTGTTGG + Intronic
1141037764 16:80643330-80643352 CTCTCTCCTGGCTGCTTTCATGG + Intronic
1144202082 17:12950648-12950670 CTCCCACCCTGCTGTTGTGTGGG - Intronic
1146697428 17:34920262-34920284 CTCCCTCCTGGCTGCTTTCTTGG - Intergenic
1148325788 17:46782759-46782781 CGCTCACCTGGCTGCTTGGCAGG + Intronic
1151295674 17:73184515-73184537 ATCACACCTGGCTATTTTTTTGG - Intergenic
1151849651 17:76682892-76682914 CCCACACTTGGCTGTTCTGTGGG - Intronic
1152786986 17:82253474-82253496 GCCTCACCTCTCTGTTTTGTGGG - Intronic
1156711965 18:39958005-39958027 CCCGCTCCTGGCTGTTTTGACGG - Intergenic
1159134932 18:64326451-64326473 CTCCCACCTGGCTGTCTCATCGG + Intergenic
1160898597 19:1415264-1415286 CTGTTACCTGGCTGTTGGGTGGG + Intronic
1161569755 19:5024106-5024128 CCATCACCTGGCTGTTTCTTGGG + Intronic
1164339307 19:24371929-24371951 CTCTGAAATGGCTGCTTTGTGGG + Intergenic
1164768758 19:30791939-30791961 CTCTTACCTGGGTGCCTTGTTGG + Intergenic
1164851112 19:31485074-31485096 CTCCCTCCTGGCTGTTTTCATGG + Intergenic
1165713820 19:38030989-38031011 CTCTCTCCTGGATGTTTAGTGGG + Intronic
1166719158 19:44987620-44987642 CTCTCCCCAGGCTGTTCTGTTGG + Intronic
924974161 2:157652-157674 CTGTCACCTGACTCTTTTGAAGG - Intergenic
924975509 2:170998-171020 CTCTCACCTAGGTATTTTCTGGG + Intergenic
925986616 2:9221183-9221205 ATCTCAGCTGGCTTTTTTGCAGG - Intronic
927941038 2:27102889-27102911 CACTCACTGGGCTGTTTTCTTGG - Intronic
928476434 2:31632038-31632060 CTCTCACCTGACTCTATTGAAGG + Intergenic
929015140 2:37486358-37486380 TTATCACCTGGATGTCTTGTAGG + Intergenic
930658916 2:54034522-54034544 CTATCACCTGGATGTGTAGTAGG + Intronic
932574301 2:72954434-72954456 TTCCCTCCTGGCTGTCTTGTTGG - Intronic
933047641 2:77558529-77558551 CTCCCACCTGGCTGCTTTCATGG - Intronic
933175278 2:79166846-79166868 CTGTCACCTGACTCTTTTGAAGG - Intergenic
935537498 2:104311023-104311045 CTCTCAGCAGGGTGGTTTGTAGG - Intergenic
936092546 2:109510659-109510681 CACACAAGTGGCTGTTTTGTTGG - Intergenic
936890649 2:117366140-117366162 CTCTCACCTGGCTGCTTTCATGG + Intergenic
937059585 2:118971329-118971351 CAAGCACCTGGCTGTTTTTTGGG - Intronic
937853579 2:126656649-126656671 CTCTCACCTAACTGTTCTTTAGG - Intronic
938762224 2:134436380-134436402 CTCTCAGCAGTCTGTTTTGGGGG - Intronic
943998117 2:194797399-194797421 CTCCCTCCTGGCTGTTTTCATGG - Intergenic
944906146 2:204264169-204264191 TTCTCTCCTGGCTGTTTTAAAGG - Intergenic
945073725 2:206016142-206016164 CCCTCTCCTGGCTGTTTTCATGG - Intronic
948310785 2:236984745-236984767 CTCTCACCTGGGTGATTTCAAGG + Intergenic
1169983507 20:11414366-11414388 ATCTCAGGTAGCTGTTTTGTAGG - Intergenic
1170390033 20:15862386-15862408 CTCTCGTGTGGCTGTTTTATAGG + Intronic
1170395452 20:15921078-15921100 CTCTCACCTGGCTGTTTTGTGGG - Intronic
1170875231 20:20244096-20244118 CTCCCTCCTGGCTGTTTTCATGG + Intronic
1170991434 20:21305140-21305162 GTCACACCTGGCTATTCTGTAGG + Intronic
1171155421 20:22868269-22868291 CTCCCACCTGGCTTCTTTGAAGG - Intergenic
1171337774 20:24401163-24401185 CTCTCAGCTGACAGATTTGTTGG + Intergenic
1174430413 20:50464374-50464396 CTCTGAGCTGGCCGGTTTGTGGG - Intergenic
1174728098 20:52886155-52886177 ATCTCACCTCTCTGTTGTGTTGG + Intergenic
1177204796 21:17998315-17998337 CTCTCTCCTGGCTGCTTTCATGG + Intronic
1177554567 21:22672571-22672593 CTCTCTCCTGGCTGCTTTCATGG - Intergenic
1178021829 21:28417068-28417090 CTCTTACCTGGCTGTGTTTCTGG + Intergenic
1178954050 21:37007212-37007234 CTCTCACCTTGCTACTTTCTCGG + Intronic
1179718588 21:43302772-43302794 CCCTCACCTGGCTCTGTTTTGGG + Intergenic
1181453226 22:23037872-23037894 CTCTCATCTGGCTGTGCTGCGGG - Intergenic
1181772431 22:25135694-25135716 CCCTCACGTGGCTGTCTGGTGGG + Intronic
1182666748 22:31965677-31965699 AACTCACCTGGCTGTTGCGTGGG + Intergenic
1183110956 22:35648257-35648279 CTCTGTCCTGGCTGTGTTATAGG - Intergenic
1184330350 22:43823327-43823349 AGCTCTCCTGGCTGCTTTGTGGG - Intergenic
949275227 3:2271620-2271642 GTCTCAGTTGGCTGTTTTCTTGG - Intronic
949623570 3:5844192-5844214 CCCTCTCCTGGCTGTTTTCATGG + Intergenic
949719357 3:6970676-6970698 CTCTCTCTTGGTTTTTTTGTAGG - Intronic
951171469 3:19546893-19546915 CTCTGTCCTGGTTGTTGTGTGGG - Intergenic
951345406 3:21542633-21542655 CCCTCACCTGGCTGTTTCAGTGG - Intronic
953514832 3:43579790-43579812 CTCTGAACTGTCTGTGTTGTTGG + Intronic
953541804 3:43826241-43826263 CTCTCGCCTGGCTGGTGGGTTGG + Intergenic
954146020 3:48634742-48634764 CTCTAACCTGGCTGTACTGTTGG + Intronic
955308894 3:57864028-57864050 CTCTCTCCTGGGTGTTATGGAGG + Intronic
958043642 3:88256120-88256142 ATCTTACCTGGCTGTTTTCTGGG + Intergenic
958577758 3:95974303-95974325 CTCTCTCCTGGCTGCTTTCATGG - Intergenic
958827430 3:99048677-99048699 CTCTACCATGGTTGTTTTGTAGG - Intergenic
959202886 3:103271289-103271311 CTCCCTCCTGGCTGTTTTCGTGG + Intergenic
963201230 3:142588333-142588355 CTGTCACTTGGCTCTTATGTAGG + Intergenic
963391123 3:144665348-144665370 CTCTCTCCTGGCTGCTTTCATGG + Intergenic
963422035 3:145073077-145073099 CTCTCTCCTGGCTGCTTTCACGG + Intergenic
963581814 3:147135127-147135149 CCCTCTCCTGGCTGTTTTCATGG + Intergenic
963716735 3:148811958-148811980 CTCCCTCCTGGCTGTTTTCATGG - Intronic
964654606 3:159052381-159052403 CTCCCTCCTGGCTGTTTTCATGG - Intronic
965045542 3:163572659-163572681 CTCTCTCCTGGCTGCTTTCATGG - Intergenic
966275335 3:178159134-178159156 GTCTAACGTTGCTGTTTTGTGGG - Intergenic
968379989 4:85289-85311 CTCTCAGCTCTCTGTGTTGTTGG + Intronic
968481250 4:834015-834037 CTCTCAGCTGGCTGTGTGGCTGG + Intergenic
968834506 4:2953538-2953560 CTCTGACTTGGGAGTTTTGTGGG + Exonic
970483515 4:16501732-16501754 CTCTCACCTGGTTCTTTTATGGG - Exonic
971627440 4:28940303-28940325 CTCTAAGATGGCTGTTTTGTAGG + Intergenic
974487615 4:62525226-62525248 CTCCCTCCTGGCTGTTTTCATGG - Intergenic
976379284 4:84380693-84380715 TTCTCATCCGGGTGTTTTGTGGG - Intergenic
977670170 4:99685806-99685828 CTCCCACCTGGCTGCTTTCACGG - Intergenic
979169271 4:117579587-117579609 CTCTCAACAGGCTTTTTTATTGG + Intergenic
979183460 4:117758251-117758273 CTCTCTCCTGGCTGCTTTTATGG - Intergenic
979305121 4:119133663-119133685 CACTCACCTGGCTAATTTTTGGG + Intergenic
981795422 4:148589851-148589873 CTCGCTCCTGGCTGTTTTCATGG - Intergenic
981808552 4:148746148-148746170 TTCTTACCTGGTTGTTTTCTGGG + Intergenic
983431739 4:167659612-167659634 CTCCCTCCTGGCTGTTTCATGGG + Intergenic
984131220 4:175878151-175878173 CTCCCTCCTGGCTGTTTTCATGG + Intronic
985256280 4:188073078-188073100 CTCTCAGCTGCTTGTTTTGATGG - Intergenic
985470563 5:41501-41523 CTCTCACCTAGGTATTTTCTGGG + Intergenic
987192371 5:15491372-15491394 AACTCACCTGGTTGTTTTGTAGG - Intergenic
987602044 5:20084392-20084414 CTCTCTCCTGGCTGCTTTCATGG + Intronic
987835302 5:23153012-23153034 CTCTGGCTTGGCTGTTTTGGAGG - Intergenic
987914525 5:24194476-24194498 CTCACTCCAGGGTGTTTTGTTGG - Intergenic
988028161 5:25727053-25727075 CTCTCTCCTGGCTGCTTTCATGG + Intergenic
988603054 5:32657041-32657063 CCCTCTCCTGGCTGCTTTGATGG + Intergenic
988643261 5:33065296-33065318 CTTTCATGTGGCTATTTTGTAGG - Intergenic
988928598 5:36013860-36013882 CTCTCTCCTGGCTGCTTTCATGG - Intergenic
989028358 5:37091518-37091540 CCCTCTTCTGGCTGTTTTCTGGG - Intergenic
989298359 5:39858154-39858176 AACTCATCTGGCTGTTTTCTTGG - Intergenic
989515259 5:42336335-42336357 ATCTCAGCAGGTTGTTTTGTGGG + Intergenic
991271733 5:64791605-64791627 TTCTCATCTGGCTCTTTCGTAGG + Intronic
993311602 5:86339024-86339046 TTCTCTCCTGGCTATTTTGTCGG - Intergenic
994257777 5:97620244-97620266 ATCTTGCCTGGCTTTTTTGTAGG + Intergenic
994964102 5:106644135-106644157 CTCTTACATGGCATTTTTGTGGG + Intergenic
995212110 5:109551911-109551933 CTCCCTCCTGGCTGTTTTCACGG - Intergenic
995608150 5:113880355-113880377 CTCACTCCTGGCTGATTTCTTGG - Intergenic
995988740 5:118210160-118210182 CTCTCTCCTGGCTGCTTTCATGG - Intergenic
996701689 5:126456611-126456633 CTCTCAACTTCCTGTTTTGATGG + Intronic
997010147 5:129867207-129867229 CTGTTACCTGGTTATTTTGTTGG - Intergenic
997074570 5:130657432-130657454 CCCTCACTCGGCTGTTGTGTTGG - Intergenic
998052666 5:139049016-139049038 ATCTGAACAGGCTGTTTTGTGGG + Intronic
998513969 5:142736361-142736383 CTCTCACCCTGCAGCTTTGTGGG + Intergenic
998676542 5:144415114-144415136 CTCTCACCTTGCTGCATAGTAGG - Intronic
999669319 5:153944903-153944925 CTCCCTCCTGGCTGTTTTCATGG + Intergenic
1001371075 5:171202701-171202723 CTCTGACACGGCTCTTTTGTTGG + Intronic
1004839815 6:19570076-19570098 CTTTCACCTTGGTGTTTTGCTGG + Intergenic
1006987909 6:38188992-38189014 GTCTCAGCTGGCTATTCTGTTGG - Intronic
1007851460 6:44806795-44806817 GTCTGAGATGGCTGTTTTGTGGG + Intergenic
1010190107 6:73186355-73186377 TTCTCAACTGGCTGTGTTGTGGG - Intronic
1013801960 6:113956618-113956640 CTCTCAACTGGCGGTTCAGTTGG - Exonic
1014730907 6:125030706-125030728 CTCCCTCCTGGCTGTTTTCATGG + Intronic
1015021618 6:128482704-128482726 CTAGCACCTTGCTGTTTGGTTGG - Intronic
1015545439 6:134356718-134356740 TTCTGACCTGGCTTGTTTGTTGG + Intergenic
1017002667 6:150006624-150006646 CTCTCACCTGGCTATCCTGCTGG - Intergenic
1017646978 6:156548293-156548315 TTCTCACCTGACTGGCTTGTCGG + Intergenic
1018028187 6:159821873-159821895 CTCTCAGCTGCCTGTCTTGAGGG + Intergenic
1019015090 6:168874215-168874237 CTCTGAACCGGCTGATTTGTAGG + Intergenic
1020472628 7:8556396-8556418 CACTCACCTGGCTGTCAAGTTGG + Intronic
1022989734 7:35695342-35695364 CTCTCCCCTGGCCGTTTGCTCGG + Intronic
1024204445 7:47144696-47144718 ATCTCAGCTGGCTCTTTTCTGGG + Intergenic
1025038611 7:55619571-55619593 CTCTCTCCTGGCTGCTTTCATGG - Intergenic
1026899753 7:74030250-74030272 CACTCACCTGGCTGTCCTGGGGG + Intronic
1028011334 7:85648498-85648520 CTCCCTCCTGGCTGTTTTCATGG + Intergenic
1028908777 7:96184354-96184376 CGATCAACTGGCTCTTTTGTGGG - Exonic
1029273283 7:99389784-99389806 CTCTCTCCTGGGTCTTTGGTGGG + Intronic
1029977473 7:104848489-104848511 CTCCAAGCTGGCTGTTTTTTGGG - Intronic
1031792038 7:126118426-126118448 CTCCCACCTGGTTGTTTTCATGG - Intergenic
1032628415 7:133619892-133619914 CTCTCACCTGGCTCTTGTAGGGG - Intronic
1033068637 7:138180857-138180879 ATCTCACCTTGCTGATTAGTTGG - Intergenic
1033607467 7:142937818-142937840 CTCCCTCCTGGCTATTTTGGGGG - Intergenic
1035280154 7:157773330-157773352 CTCTCTCCTGTTTGTTTTCTAGG - Intronic
1037963961 8:23118982-23119004 CTCTCACCTGGCTTGTCTGTGGG + Intergenic
1037976795 8:23219626-23219648 CTCTCACCTGGCTTGTCTGTGGG - Intronic
1038275622 8:26118405-26118427 CTGTCTCCTGCCTGTGTTGTGGG - Intergenic
1038328336 8:26589013-26589035 CTCTCGCCAGGCTGTTTTTCTGG + Intronic
1039584143 8:38691525-38691547 CTCTCACTTGAATGTTTTTTTGG + Intergenic
1041137810 8:54778990-54779012 CTCTCACAGGGCTTTTTTGGAGG + Intergenic
1041289498 8:56295672-56295694 CTCTTACATGGCTGTTTACTTGG + Intergenic
1042432753 8:68727369-68727391 CTCTCTCCTGGCTGCTTTCATGG + Intronic
1046175519 8:110570823-110570845 CTCCCTCCTGGCTGCTTTCTTGG + Intergenic
1048289685 8:133171295-133171317 CACTGACCTGGCAGCTTTGTCGG + Intergenic
1050199852 9:3132690-3132712 CTCACACCTTCCTGTCTTGTTGG + Intergenic
1050827604 9:9968704-9968726 CTGTGACCTAGCTTTTTTGTAGG - Intronic
1052244922 9:26322963-26322985 CTCTCACCCATCTGTTTTGTAGG - Intergenic
1053053131 9:34977685-34977707 CTCTTACTTGTGTGTTTTGTGGG - Intronic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1059646058 9:116269173-116269195 ATCTCACATGGCTGTTGGGTGGG - Intronic
1190773681 X:53535718-53535740 CTCTCTTCTGCCTTTTTTGTAGG - Intronic
1192200902 X:69066188-69066210 CTCCCACCTGGCTTTTTAGTAGG + Intergenic
1193041069 X:77004373-77004395 CTCTCACCTGTCTCTTTATTTGG + Intergenic
1193497424 X:82231902-82231924 CTCTCTCCTGGCTGATTTCATGG - Intergenic
1199192104 X:144982154-144982176 CTCCCTCCTGGCTGCTTTGATGG - Intergenic
1199929727 X:152506240-152506262 CCCTCTCCTGGCTGCTTTCTTGG + Intergenic
1200672689 Y:6112940-6112962 CTCCCTCCTGGCTGTTTTCATGG - Intergenic
1200708394 Y:6462525-6462547 CTCTCACCTGTCTTCTCTGTGGG - Intergenic
1200910178 Y:8524894-8524916 CTCTCACCTGTCTTCTCTGTGGG + Intergenic
1200911416 Y:8534613-8534635 TTCTCACCTACCTTTTTTGTGGG + Intergenic
1200919365 Y:8599456-8599478 CTCTCACCTGTCTTCTCTGTGGG + Intergenic
1200919658 Y:8601935-8601957 CACTCACCTGTCTTTTTTGTGGG + Intergenic
1200924561 Y:8642761-8642783 CTCTCGACTGTCTTTTTTGTGGG + Intergenic
1200927687 Y:8669244-8669266 CTCTCACCTGTCTTCTCTGTGGG + Intergenic
1200927988 Y:8671719-8671741 CTCTCACCTGTCTTTTCTGTGGG + Intergenic
1200935434 Y:8734336-8734358 CTCTCACCTGTCTTCTCTGTGGG - Intergenic
1200936659 Y:8744279-8744301 CTTTCACCTGTCTGCTCTGTGGG - Intergenic
1200939758 Y:8769190-8769212 CACTCACCTGTCTGTTCTGTAGG - Intergenic
1200939997 Y:8771333-8771355 CTCTCACCTGTCTTCGTTGTGGG - Intergenic
1200960824 Y:8994308-8994330 CTCTCATCTGTCTTCTTTGTGGG + Intergenic
1200961657 Y:9001551-9001573 CTCTCCCCTGTCTTTTCTGTGGG + Intergenic
1200962591 Y:9008969-9008991 CTCTCACCTGTCTTCTCTGTGGG + Intergenic
1200963039 Y:9012382-9012404 CTCTCACTTGTCTTCTTTGTGGG + Intergenic
1200963793 Y:9018439-9018461 CTCTCACCTGTCTTCTCTGTGGG - Intergenic
1200982240 Y:9272915-9272937 CTCTCCCCTGTCTTTTCTGTGGG - Intergenic
1201025718 Y:9702183-9702205 CTCTCACCTGTCTTCTCTGTGGG + Intergenic
1201038965 Y:9810094-9810116 CTCTCACCTGTCTTTTTTGTGGG - Intergenic
1202128162 Y:21586764-21586786 CTCTCCCCTGTCTTTTCTGTGGG + Intergenic
1202128485 Y:21589265-21589287 CTCTCACCTGTCTTCTCTGTTGG + Intergenic
1202129911 Y:21600227-21600249 CTCTCACCTGTCTTCTCTGTGGG - Intergenic
1202148354 Y:21822918-21822940 CTCTCACCTGTCTTCTCTGTGGG + Intergenic
1202149311 Y:21830349-21830371 CTCTCACCTGTCTTCTCTGTGGG + Intergenic
1202150061 Y:21836400-21836422 CTCTCACTTGTCTTCTTTGTGGG - Intergenic
1202150479 Y:21839549-21839571 CTCTCACCTGTCTTCTCTGTGGG - Intergenic