ID: 1170399248

View in Genome Browser
Species Human (GRCh38)
Location 20:15961892-15961914
Sequence GAAAGAAATCAGAAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 751
Summary {0: 1, 1: 0, 2: 10, 3: 69, 4: 671}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170399242_1170399248 19 Left 1170399242 20:15961850-15961872 CCTGTGGTGTGAGGCTTAGTAAG 0: 1
1: 0
2: 0
3: 12
4: 138
Right 1170399248 20:15961892-15961914 GAAAGAAATCAGAAGGATGGAGG 0: 1
1: 0
2: 10
3: 69
4: 671

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170399248 Original CRISPR GAAAGAAATCAGAAGGATGG AGG Intronic
901094831 1:6669793-6669815 CAAAGTTATCAGATGGATGGGGG + Intronic
901663058 1:10810881-10810903 AAATGAAAGCAGAAGGTTGGAGG - Intergenic
901742423 1:11350948-11350970 GAAAGAAAGGAGAGGGAGGGAGG - Intergenic
901793598 1:11667585-11667607 AAAAAAAATCAGATGGAGGGTGG - Intronic
901815843 1:11793127-11793149 GATAGAAATCAGACCTATGGAGG - Intronic
902145238 1:14393105-14393127 AAAAGAACTCAGAGAGATGGTGG - Intergenic
902645565 1:17795668-17795690 GAAATTAAACAGAAGGGTGGGGG + Intronic
903572391 1:24315892-24315914 GAATGGAATCAGAAAGATGTGGG + Intergenic
903953299 1:27008966-27008988 AAAAAAAAAAAGAAGGATGGAGG - Intronic
904268174 1:29330010-29330032 CAAAGAGCTCAGAATGATGGGGG - Intergenic
904294820 1:29513342-29513364 TATAGAAATCAGGATGATGGGGG + Intergenic
904547604 1:31288202-31288224 AAAAGCAATAAGAAGTATGGGGG + Intronic
904696537 1:32334847-32334869 AAGAGAAATCGGAAGGAGGGTGG - Exonic
905008784 1:34732651-34732673 GACTGAAGTCAGAAAGATGGAGG - Intronic
905350815 1:37345143-37345165 GAAAGAATTCACAGGGGTGGTGG + Intergenic
906961210 1:50420449-50420471 GGAAGAAACTAGAAGGAGGGAGG + Intronic
907100353 1:51827598-51827620 GAAGTAAATGAAAAGGATGGTGG - Intronic
907545734 1:55258445-55258467 GAAAGAGACCAGAAAAATGGAGG - Intergenic
907648086 1:56264317-56264339 GAAAGAAAGCAGAAGTGAGGGGG + Intergenic
907770105 1:57452995-57453017 AAAAGAAAAAAGAAGGAGGGAGG + Intronic
907928667 1:58978835-58978857 AACAGAAAGCAGTAGGATGGGGG + Intergenic
908792997 1:67801936-67801958 GAAGGAAAAAAGAAGGAAGGGGG + Intronic
909686988 1:78360847-78360869 GAGAGAAATGACCAGGATGGTGG + Intronic
911094656 1:94045585-94045607 GAGAGAAAGCAGATGGATGCAGG + Intronic
911317644 1:96374867-96374889 AAAAGAGATCAGAAGCATGAGGG - Intergenic
911445212 1:97984067-97984089 GAAAAAAATGTGAAGGATGTGGG - Intergenic
911569337 1:99504289-99504311 GAAAATAATAAAAAGGATGGGGG + Intergenic
911571502 1:99522853-99522875 AAAGGAAATCAAAAGGTTGGGGG + Intergenic
912179591 1:107203067-107203089 GAAGAAAAACAGAAGAATGGAGG - Intronic
912708311 1:111931221-111931243 GAAAGAGGTGAGAAGGAAGGAGG + Intronic
913343375 1:117782472-117782494 GAAGCAAATCAGAAGTAGGGTGG + Intergenic
913706687 1:121432245-121432267 GAAAGAAAGAGGAAGGAAGGAGG - Intergenic
914214475 1:145612731-145612753 GAAAAAGATGAGAAGGATGGTGG - Intronic
914466414 1:147933121-147933143 GAAAAAGATGAGAAGGATGGTGG - Intronic
915545521 1:156595126-156595148 GTAAGGGATGAGAAGGATGGCGG - Intronic
915556549 1:156664043-156664065 GAAAGAAAGCAGAAGGAGAGGGG + Intergenic
916051857 1:161042042-161042064 GAAGGGAATCAGTAGGATGGGGG - Intronic
916485852 1:165257831-165257853 ACAAAAAAGCAGAAGGATGGAGG + Intronic
916811223 1:168307366-168307388 GAAAGGCATCACATGGATGGTGG + Intronic
917793622 1:178515806-178515828 GAAAGAAATATCTAGGATGGAGG - Intronic
918038391 1:180897082-180897104 GAAAGAAATGAAAAGGAAAGAGG + Intergenic
918440666 1:184563787-184563809 GAAAGAAAATACAAGGTTGGGGG + Intronic
918996715 1:191771451-191771473 GAAAGAAATAAGAAAGATATTGG - Intergenic
919058855 1:192605957-192605979 GAAAGAAAGAAGAGGGAGGGAGG + Intergenic
919058868 1:192606057-192606079 GAAAGAAAAAAGAAGGAGGGAGG + Intergenic
919333050 1:196195429-196195451 GAAAGAAAACAGAAGAAAGAAGG + Intergenic
919519009 1:198564210-198564232 GAAAGAAAGAAGAAGGAAAGAGG - Intergenic
919971144 1:202580060-202580082 GAAAGAATTCAGAAAGGGGGTGG - Intronic
920061594 1:203230545-203230567 AAAAAAAAACAGAAGAATGGTGG + Intronic
920194582 1:204218373-204218395 GAAATAAACCAAAGGGATGGAGG + Intergenic
920360326 1:205410990-205411012 GAAAGAAAAGAAAAGGAGGGAGG + Intronic
920770518 1:208880704-208880726 GAAAGAAAACATAAGTAGGGAGG + Intergenic
920906082 1:210169964-210169986 GAAAGAACTAGGAAGGAAGGAGG - Intronic
920947335 1:210542028-210542050 AAGAGAAAGCAGAAGGAAGGAGG - Intronic
922033538 1:221826705-221826727 GAAAGAAAAGAGAGGGAGGGAGG + Intergenic
922919841 1:229293227-229293249 CAAAAAAACCAAAAGGATGGGGG - Intronic
923359543 1:233197075-233197097 GACAGAAATCTGATGAATGGTGG + Intronic
923397039 1:233576178-233576200 GAAAGAAGTGAGCAGGATGGTGG - Intergenic
923727230 1:236517183-236517205 GAAAGAAAAGAGAAGGCTGAAGG + Intergenic
923943784 1:238859695-238859717 AAAAGAAAAGAGAAGGCTGGAGG + Intergenic
923957629 1:239040712-239040734 GAAAGAAATCAGGGGGGCGGGGG + Intergenic
923986174 1:239385590-239385612 GAAAGAAAAAGGAAGGAAGGAGG - Intergenic
924048435 1:240055921-240055943 GAATGGAAACAGAAAGATGGTGG + Intronic
924202557 1:241675028-241675050 GAAGGAAAGAAGAAGGAGGGAGG - Intronic
924885978 1:248217126-248217148 GAAAAAAATCAGAAGATTGGTGG - Intergenic
1062970061 10:1640521-1640543 GACAGAAATCATAAAAATGGCGG + Intronic
1063736494 10:8761434-8761456 GAAAGAAGTGAGGAGCATGGTGG - Intergenic
1063789678 10:9428505-9428527 AGAAGAACTCAAAAGGATGGTGG - Intergenic
1063883566 10:10554661-10554683 GAGATAACTCAGAAGGATGGAGG - Intergenic
1064054033 10:12082330-12082352 GAAAGAAAACAGAATGAGGCGGG - Intronic
1064637812 10:17386995-17387017 AAAAGAGATCAGAAAGAGGGAGG - Intronic
1064683327 10:17833648-17833670 GAAAGAAATCAGATGGAATTTGG - Intronic
1064709790 10:18111605-18111627 GAAAGAGAGCAAGAGGATGGGGG + Intergenic
1064964480 10:21001102-21001124 GTAAGATGTCAGAGGGATGGAGG + Intronic
1065253731 10:23843649-23843671 GCAAGAAATCAGAGAGAAGGAGG + Intronic
1065438571 10:25726441-25726463 GAAAGAAAAAAGAAAGAGGGAGG - Intergenic
1065745369 10:28836188-28836210 GAAAGAAAGAAAAAGGAAGGAGG - Intergenic
1065977537 10:30855859-30855881 AAAAGAAATCAGGATTATGGTGG + Intronic
1066354622 10:34670351-34670373 GTAAGAAATCAGAAGCATAGTGG - Intronic
1066386863 10:34948521-34948543 AAAAGAAAAAAGAAAGATGGAGG + Intergenic
1066632430 10:37470093-37470115 GAAGGAAGTCAGAAGGAGGTTGG + Intergenic
1067071475 10:43135747-43135769 GGAAGAGATCAGAAGGATAAGGG + Intergenic
1068431682 10:56941410-56941432 GAAAGAAAGAAAGAGGATGGAGG + Intergenic
1068901539 10:62274823-62274845 GATAGAAAACAGTAGGAAGGGGG + Intergenic
1068973695 10:62985557-62985579 GAAAAAAACCAGAAGGATATGGG - Intergenic
1070519316 10:77238075-77238097 GGAAGAAATCTGAAGGAAGCTGG + Intronic
1070662345 10:78316360-78316382 GATAGAAGTCAGAAAGATGTTGG + Intergenic
1070934173 10:80280693-80280715 GACAGAAATGAGGAGGATGTGGG - Exonic
1071321435 10:84463386-84463408 GTTAGAAATCAGAAGAATGATGG - Intronic
1073691510 10:105814367-105814389 CAAAGAATTAAGAAGGATGCTGG + Intergenic
1074233151 10:111557769-111557791 GAAATAAAACAGCAGCATGGAGG - Intergenic
1074268329 10:111927718-111927740 GAAGGACAACAGAAGGATGAAGG - Intergenic
1075887890 10:125917693-125917715 CCAAGAAATTAGAAGGGTGGAGG + Intronic
1076369862 10:129945221-129945243 GAAAGGAAGCAGAGGGAGGGAGG + Intronic
1076810204 10:132882497-132882519 GAAGGCAAGAAGAAGGATGGTGG + Intronic
1076870793 10:133192843-133192865 GAAAGAGAAGAGAAGGAGGGTGG + Intronic
1077452606 11:2658465-2658487 AAAATAAATGAAAAGGATGGCGG - Intronic
1078142525 11:8702534-8702556 GCAAGAAAGCAGAAGGGAGGGGG - Intronic
1079016818 11:16875978-16876000 GAAAGAGATCAAAAGGGTGGTGG - Intronic
1079185852 11:18235813-18235835 GTAAGAACTCTGGAGGATGGAGG - Intronic
1079561271 11:21823007-21823029 GAAAGAAATAATAAGGATTAAGG + Intergenic
1079901725 11:26195116-26195138 GAAAGAAAACAGAAAGGTGGTGG + Intergenic
1080649837 11:34213148-34213170 GTTAGAATTTAGAAGGATGGAGG + Intronic
1081066628 11:38549398-38549420 GAAAGAAATCATAAAGAAGAGGG - Intergenic
1081120489 11:39259559-39259581 GACAGGAATCAGAGGGGTGGAGG + Intergenic
1081266727 11:41033257-41033279 GAAAGAAGTCACAAGCATGAAGG + Intronic
1081322147 11:41704510-41704532 GAAAGAAAACTGAAGTATGGAGG - Intergenic
1081363215 11:42205210-42205232 GAAAGAGAGCAGAAGCAGGGTGG + Intergenic
1082089872 11:48080595-48080617 GCAAGAAGTCAGAAGGGTGTTGG + Intronic
1082792744 11:57358507-57358529 GAAGTAAAGCAGAAGGATGTGGG + Intronic
1083564362 11:63700594-63700616 AAAAAAAATAAAAAGGATGGGGG - Intronic
1083807041 11:65080638-65080660 GAGAGAAATCAGAAGGTCGCTGG - Intronic
1084467118 11:69330550-69330572 GAAAGAAAAAAGAAGGAGGAGGG - Intronic
1084906666 11:72353697-72353719 GAAAGACTTCAGAAGGAAGGTGG + Intronic
1085134036 11:74068779-74068801 TAAATAAACCAGAGGGATGGGGG - Intronic
1085290580 11:75396369-75396391 GAGAGATAACAGATGGATGGGGG + Intergenic
1085873091 11:80373411-80373433 AAAAGAGATAGGAAGGATGGAGG - Intergenic
1086146682 11:83560085-83560107 GAAAGAGAGGGGAAGGATGGGGG + Intronic
1086731709 11:90257764-90257786 TAAAGACATCAGCAGGATGGAGG - Intergenic
1087507242 11:99041271-99041293 GGCAAAAATCAGAAGGATAGAGG - Intronic
1087699584 11:101420530-101420552 GAAAGAAACCAGAAAGATCACGG - Intergenic
1087779094 11:102284467-102284489 CAAATTAATCAGAAGGATGTAGG - Intergenic
1087861857 11:103168055-103168077 GAAACAAAACAGAAGGCTGAGGG - Intronic
1088591588 11:111408229-111408251 GAAATAAATGAGAAGGAGAGGGG - Intronic
1089256192 11:117195543-117195565 GAAGAGAATCAGAAGGAAGGAGG + Intronic
1089286195 11:117409593-117409615 GAAAGAAAAGAGGTGGATGGTGG - Intronic
1090697570 11:129263648-129263670 GAAAGAAGGAAGAAGGAAGGAGG + Intronic
1090920538 11:131202732-131202754 GAATGAACTAAGAAAGATGGGGG - Intergenic
1092062370 12:5561877-5561899 GGAGGAAATCAGAAAGGTGGTGG + Intronic
1092887674 12:12939295-12939317 GAAAGCATTCAGAAGAATGTGGG + Intergenic
1092974329 12:13729773-13729795 GAAAGAAACCAGGAGTAGGGTGG + Intronic
1093146252 12:15570233-15570255 TATAGAAACCTGAAGGATGGGGG - Intronic
1093318288 12:17678938-17678960 AAAAGAAAAGAGAAGGAGGGAGG + Intergenic
1093772560 12:23034506-23034528 GAAAGAAAGAAAAAGGAGGGAGG - Intergenic
1093795582 12:23306580-23306602 GAAAGAAATCTGAAGGTAGTTGG - Intergenic
1094019666 12:25900907-25900929 GAAAGGAAGGAGAAGAATGGCGG + Intergenic
1094027488 12:25974254-25974276 GAAAGAAAGAAGAGGGAGGGAGG + Intronic
1095762498 12:45855698-45855720 GAAAGAAATTAAAAGGATGGGGG - Intronic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096638350 12:52975475-52975497 GAATGCAGACAGAAGGATGGAGG - Intergenic
1096765872 12:53888937-53888959 GAAAGAAAGAAGACGGAGGGAGG - Intergenic
1096784960 12:54011659-54011681 GGAAGGACTCAGAAGGGTGGGGG - Exonic
1096877912 12:54644883-54644905 CACAGAAGTCAGAGGGATGGAGG + Intronic
1096943176 12:55372425-55372447 GAAAGAAAGAGGAAGGAAGGAGG + Intergenic
1096945511 12:55403936-55403958 GAAAGAAAAAACAAAGATGGAGG + Intergenic
1097120689 12:56729306-56729328 TAAAGAACTCAGAAGGAGAGTGG - Intronic
1097152946 12:56993164-56993186 GACAGGAAGCAGAAGGTTGGTGG + Intergenic
1098050520 12:66447741-66447763 GACAGAAGTCAGAAAGCTGGGGG - Intronic
1098307907 12:69119762-69119784 GAAAAAAACCTGAAGTATGGTGG - Intergenic
1098460769 12:70730842-70730864 GAGAGAGAGCAGAAGGAAGGAGG + Intronic
1098666808 12:73173874-73173896 GAAAGAAATGAGACGGTAGGAGG - Intergenic
1098847255 12:75552849-75552871 CAATGAACTCAGAAGCATGGTGG + Intergenic
1099072509 12:78063765-78063787 GGGAGAAATCAGAAGGAATGTGG + Intronic
1100155334 12:91792702-91792724 GAAAGAAAGAAGAAGTATAGTGG + Intergenic
1100198528 12:92274112-92274134 GAAAGAAATAAGAATGGTGACGG + Intergenic
1100555516 12:95689416-95689438 CAAAGAAACAAGAAAGATGGAGG - Intronic
1100622109 12:96287289-96287311 GAAGGAAAAGAAAAGGATGGTGG + Intronic
1100742872 12:97614676-97614698 GGAAGAAAGAAGAAGGAAGGAGG - Intergenic
1100925778 12:99546725-99546747 GAAAGAAATCAGATGGAGTCTGG + Intronic
1101015661 12:100497472-100497494 GAATGGAATCAGAGAGATGGGGG + Intronic
1101332724 12:103769939-103769961 GAAAGTAATGCGAAGGATTGGGG + Intergenic
1102073127 12:110038087-110038109 GAATGGAATCAGATAGATGGAGG - Exonic
1102622621 12:114208752-114208774 GAAGGAATCCAGAAGGAGGGAGG + Intergenic
1102856324 12:116297667-116297689 GAAAGAAAGAGGAAGGAAGGAGG + Intergenic
1103076698 12:117989044-117989066 GACAGAAAGTAGAATGATGGTGG + Intergenic
1103210760 12:119164761-119164783 GAAAGAAATCAGTGTGTTGGGGG - Intergenic
1103319718 12:120084944-120084966 GAAAGAGAACAGAAGGGAGGGGG - Intronic
1104744031 12:131199609-131199631 TAATGAAATGACAAGGATGGGGG - Intergenic
1105783324 13:23723290-23723312 AAAAGAAAACAAAGGGATGGTGG - Intergenic
1106785623 13:33105718-33105740 GAAAGAAATCAGAAAGGAAGTGG + Intronic
1107098400 13:36561077-36561099 GTAAGAAATGTGAATGATGGAGG - Intergenic
1107350358 13:39507919-39507941 GAAAGAAATGGGAGGGAGGGAGG - Intronic
1107465682 13:40647736-40647758 CAAAGAACCTAGAAGGATGGGGG + Intronic
1107684405 13:42882134-42882156 GAAAGAAATAAGTATGGTGGTGG - Intergenic
1107924248 13:45243193-45243215 TAAAGTACACAGAAGGATGGAGG - Intronic
1108130350 13:47292796-47292818 GAAAGGAGACAGAAGGAAGGAGG + Intergenic
1108611278 13:52086291-52086313 GAAAGAAATTAGAAAGAAGATGG - Exonic
1108852922 13:54757384-54757406 GCAAGAGATTAGAGGGATGGAGG + Intergenic
1109584112 13:64375423-64375445 AAAAGAATGCAGAATGATGGAGG + Intergenic
1110185863 13:72674158-72674180 GATAGAAATGAGTAGGATGAAGG - Intergenic
1110421083 13:75310015-75310037 GAAAGAAATCAAAAGAACTGAGG - Exonic
1110489787 13:76089416-76089438 GACAGAAATCAGAAGTCTGTGGG + Intergenic
1110613875 13:77519906-77519928 CAAAGAAACAAGAAGGCTGGAGG + Intergenic
1111090057 13:83434215-83434237 GAAAGAAATTAAAAAGATGTTGG + Intergenic
1111697485 13:91642928-91642950 GAAGGGAATCAGAATCATGGTGG + Intronic
1111954080 13:94737975-94737997 GAAAGAGATGAGAAGTGTGGGGG + Intergenic
1112515975 13:100053381-100053403 GTTAGAAATCAGAATAATGGTGG - Intergenic
1112572832 13:100609118-100609140 CAATGCAATCAGAAGGAAGGAGG - Intronic
1112602717 13:100872609-100872631 CAAAGGAATAAGAAGGATAGAGG - Intergenic
1112881746 13:104115688-104115710 GATAGAAATCAGAATGGTGTGGG - Intergenic
1114307715 14:21438536-21438558 GAAAGAAAAAAGAAAGATGCCGG + Intronic
1115054667 14:29108814-29108836 GAAAGAAAAAAGAGGGAGGGAGG + Intergenic
1116684928 14:48027197-48027219 GAAAGGACTTAGAATGATGGTGG - Intergenic
1117872272 14:60213631-60213653 GAAAGAAAGAAAAAGCATGGAGG - Intergenic
1120145179 14:80971206-80971228 GTAAGAAATCTGAAGGTTGGGGG - Intronic
1120266261 14:82254361-82254383 GAAGGTATTCAGAAAGATGGAGG - Intergenic
1120550562 14:85866888-85866910 GAAAGAAATCATGATGAGGGAGG + Intergenic
1120554981 14:85918632-85918654 AAGAGAAAGCGGAAGGATGGAGG + Intergenic
1121843837 14:97156147-97156169 GAAAGAAAGGAGAGGGAGGGAGG - Intergenic
1121994371 14:98590808-98590830 TAAATAAATTAGAAGGATGAAGG + Intergenic
1122430733 14:101639679-101639701 GAAAGCTACCAGAAGGCTGGTGG + Intergenic
1122487881 14:102093970-102093992 AAAAGAAAAAAGAAGGAAGGTGG + Intronic
1123131739 14:105992312-105992334 GAAAGAAAGAAGAAGGAAGAAGG - Intergenic
1123885888 15:24728086-24728108 TAAAGAAAGCAGCAGGAAGGTGG - Intergenic
1124026012 15:25966550-25966572 AAAAAAAATAAGAAGGATTGGGG - Intergenic
1124430767 15:29606148-29606170 TAAAGAAATGAAATGGATGGAGG - Intergenic
1124593247 15:31071554-31071576 GAAGGCCATCAGAAGGAGGGTGG - Intronic
1124793974 15:32758382-32758404 GAGAGAAATTAGAAGGAAGTAGG - Intergenic
1124873418 15:33566577-33566599 GAAAGGAATAAGAGGGATGAGGG + Intronic
1125201360 15:37102645-37102667 GTAGGAAATCTGAAGGTTGGGGG + Intergenic
1125233800 15:37487860-37487882 GAAAGAAAGCAGATGGCAGGTGG - Intergenic
1127364966 15:58280495-58280517 AAAAGAAATCACAAGGATTAGGG + Intronic
1128396281 15:67229581-67229603 GAAAGAAAAAAGGAGGAAGGAGG + Intronic
1128417035 15:67456449-67456471 TGAAGAGATGAGAAGGATGGAGG + Intronic
1128836720 15:70814755-70814777 AAAAGAGCTCAGAGGGATGGAGG + Intergenic
1128859498 15:71054282-71054304 GAAAGAAAAGAGAAAGAAGGGGG + Intergenic
1128940860 15:71786733-71786755 GAAAGAAAGAAGAAGGAGGAGGG + Intergenic
1129272940 15:74428943-74428965 GAAAGAAAGCAGGGGGATGGAGG - Intronic
1129306412 15:74667420-74667442 GAAAGAAAGGAGAAGGGGGGAGG + Intronic
1129372711 15:75107986-75108008 GTAAGAAAACAGAAGAATGATGG + Intronic
1129710428 15:77818069-77818091 GAAAGAAGGCATATGGATGGGGG + Intronic
1130894923 15:88162511-88162533 GAAAGAAAACAGGAGCATGGAGG + Intronic
1131322552 15:91408748-91408770 CAAAGAAATCGGAGGGCTGGAGG + Intergenic
1131619337 15:94050594-94050616 GAAAGAACTCAGAAGGAACAAGG + Intergenic
1131833303 15:96367832-96367854 GAGAAAATTCAGAAGGAAGGGGG + Intergenic
1132158871 15:99518213-99518235 AAAAGAAATCAGCAGGGTGAAGG - Intergenic
1133535991 16:6702948-6702970 GACAGAAAGCAGAATGCTGGTGG - Intronic
1133688291 16:8188044-8188066 GAAGGAAGAAAGAAGGATGGGGG + Intergenic
1134463555 16:14451594-14451616 AAAAAAATTCAGAAGAATGGTGG + Intronic
1135521514 16:23182190-23182212 AAAAGAAAGAAGAAGGAAGGAGG + Intergenic
1135650517 16:24202366-24202388 GAAAAATATCAATAGGATGGCGG - Intronic
1136044094 16:27601934-27601956 GATGGAAATCAGGTGGATGGAGG + Intronic
1136074799 16:27809657-27809679 GAGAGAAAAGAGAGGGATGGAGG - Intronic
1136589080 16:31206353-31206375 GAAAGAAAGAAGAAGGAGGAAGG - Intergenic
1138062073 16:53902330-53902352 GGAAGGACTCAGAAGGATGTAGG + Intronic
1138645208 16:58419657-58419679 GAAAGAAAAAAAAAGGAAGGGGG + Intergenic
1139193467 16:64891595-64891617 GAAAGAAAGGAGAAGGAAGAGGG + Intergenic
1139518046 16:67463536-67463558 GAAAGAAAAAAGAAAGAGGGAGG + Intronic
1140857479 16:78990694-78990716 GAAAGAAGGAAGAAGGAAGGAGG + Intronic
1141282090 16:82638107-82638129 GAAAGACAGCAGAAAGAGGGAGG - Intronic
1141341815 16:83210461-83210483 AAGAGAAATCAGAAACATGGAGG + Intronic
1141844793 16:86600679-86600701 GATAGTAATCAGAAGGATAATGG - Intergenic
1141868280 16:86766061-86766083 CAAAGAAATCAAAACGAAGGAGG - Intergenic
1141980766 16:87548706-87548728 GCAAGAAAATAGAAAGATGGAGG + Intergenic
1142542520 17:671363-671385 GAAAGAAAAGAGAAAGAGGGAGG + Intronic
1143794214 17:9323546-9323568 GAAGGCAATCAGAAGAACGGTGG + Intronic
1143815433 17:9508658-9508680 GAAATAACACAGAAAGATGGGGG + Intronic
1144640980 17:16936330-16936352 GAAAGAAAACAAAAGGTGGGTGG + Intronic
1145049104 17:19646047-19646069 TAAGGAAATCAGAAGGCAGGAGG - Intergenic
1145055531 17:19701419-19701441 GAAAGAAATCATATTTATGGAGG - Intronic
1145958804 17:28873394-28873416 GAAAGAGATCTGAAGGGTGCTGG - Intergenic
1146052570 17:29565638-29565660 GACAGGAATCAGAAATATGGTGG - Intronic
1146563691 17:33893597-33893619 GACACAAATTAGGAGGATGGAGG + Intronic
1146601275 17:34218871-34218893 GTAAGAAATCTCAAGGATGGGGG + Intergenic
1147715909 17:42508346-42508368 AAAAGAAATCACAAGGGTTGTGG + Intronic
1148060828 17:44835175-44835197 AAAAAAAATTAGAAGGATAGTGG + Intergenic
1148342620 17:46882646-46882668 GAAAGAAATGGGAAGGGTGGGGG - Intronic
1148489025 17:48011601-48011623 GAAAGAAAAGAAAAGGGTGGAGG + Intergenic
1148495218 17:48049352-48049374 GAAAAAAAGGAGAGGGATGGTGG - Intronic
1148591348 17:48818516-48818538 GAAAGACAACAGTGGGATGGGGG - Intergenic
1149414815 17:56448228-56448250 GAAAGAAAATAGAAGGAAGAAGG + Intronic
1149528355 17:57375820-57375842 GAATGAAAGGAGAAGGATGGGGG - Intronic
1149855126 17:60075855-60075877 AAAAGAAATTATAAGGTTGGGGG + Intronic
1150402532 17:64870813-64870835 GAAAGAAAATAGAAGGAAGGGGG - Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150554347 17:66240314-66240336 GAAAGAAAAAAAAAGGATGGAGG + Intronic
1150934273 17:69618237-69618259 GAAAGAAAACTGAAGGAGAGAGG + Intergenic
1151175948 17:72288163-72288185 GCAAGAAATCTGAAGGTAGGTGG + Intergenic
1151720430 17:75852299-75852321 GGAAGAAATGAGCAGGTTGGGGG + Intronic
1151849545 17:76682331-76682353 GAAAGGCATCAGAGGCATGGAGG + Intronic
1151947954 17:77329730-77329752 GGAAGAAACCTGAAGGATGGTGG - Intronic
1152050740 17:77974078-77974100 GAAAGAAAGAAAAAGAATGGAGG + Intergenic
1153499698 18:5735847-5735869 GAAGGAAAGATGAAGGATGGTGG - Intergenic
1153906146 18:9663086-9663108 GAAGGAAATCGGAAGGAAGCAGG + Intergenic
1154139319 18:11809269-11809291 GGAAGAAAGCAGGAGGCTGGGGG + Intronic
1154301087 18:13193276-13193298 GGAAGAAAGCAGAATGAGGGAGG - Intergenic
1154961904 18:21317782-21317804 GAAACAGATCAGCAGGATTGGGG - Intronic
1155047393 18:22114717-22114739 GAAGGAAAGAAGAAGGAAGGAGG - Intergenic
1156044548 18:32862677-32862699 GAAAGAAATCAGTATGGGGGAGG - Intergenic
1156328942 18:36101331-36101353 GAAAGAGAGCAGAAGCAGGGTGG - Intergenic
1156358714 18:36364894-36364916 GGGAGAAAGCAGAAGGGTGGTGG + Intronic
1156550477 18:38011143-38011165 CAAAGAAGACAGAAGGAGGGAGG + Intergenic
1156635698 18:39026474-39026496 GAAAGGAATCAGAATGACAGAGG - Intergenic
1156840556 18:41605461-41605483 GGAGGAAATGAGAAGAATGGGGG + Intergenic
1156950849 18:42895910-42895932 GATAGAAACCAGGAAGATGGGGG + Intronic
1158226424 18:55206008-55206030 AAATGAAATCAGAAGGAAGTGGG + Intergenic
1158369520 18:56784121-56784143 GAAAGAAAACAAAAGGCTGGGGG - Intronic
1158653352 18:59307382-59307404 AAAAGAACTTAGAAGGTTGGAGG + Intronic
1159214648 18:65375138-65375160 GAAGGAAATCAAAGGGAAGGAGG - Intergenic
1159384496 18:67706294-67706316 GAAAGCAAGCAAGAGGATGGTGG + Intergenic
1159435650 18:68413565-68413587 GAAAAAAACAAGAAGGATGGTGG + Intergenic
1160287320 18:77556452-77556474 GGAAGAAATAAGAAAGAAGGGGG - Intergenic
1161999794 19:7736499-7736521 GAAAGAAAGAAAAAGGAAGGAGG - Intergenic
1162226294 19:9225439-9225461 GAAAGAAAAGAGAGGGAGGGAGG + Intergenic
1162334098 19:10049659-10049681 GAAAGAAAGAAGAAGGAAGGAGG + Intergenic
1162864904 19:13538345-13538367 GAAAGAAAGCAGAAGCTGGGAGG + Intronic
1163326939 19:16610683-16610705 CATAGAAATTATAAGGATGGTGG - Intronic
1164126724 19:22325099-22325121 GAAAGTAATTAGAAAAATGGAGG + Intergenic
1164172624 19:22738705-22738727 GAAAGCAATTAGAAAAATGGAGG - Intergenic
1164469310 19:28516045-28516067 GGAAGAACACAGCAGGATGGTGG + Intergenic
1164737226 19:30550626-30550648 GAAAGAAAAGGGAAGGAAGGGGG + Intronic
1164891523 19:31827717-31827739 GAAATCACTCAGAAAGATGGGGG - Intergenic
1164963586 19:32459180-32459202 GAAAAAAATCAGGAGTATGAAGG + Intronic
1164982456 19:32624555-32624577 GAGAGAAGCCAGAAGGAGGGCGG + Intronic
1165370187 19:35400504-35400526 GAAAGAAAAAAGAAGGAAGGAGG + Intergenic
1166009183 19:39928404-39928426 GAAAGGAAAGAGAAGGGTGGTGG - Intronic
1166812763 19:45524064-45524086 GCAAGAAATCAGAAAGATCAGGG - Intronic
1167370248 19:49076626-49076648 GACAGAGACCAGAAAGATGGTGG - Intergenic
1167567340 19:50264913-50264935 GAAAGGAATGAGAAGGATGGAGG + Intronic
1167635726 19:50654277-50654299 GAAAGAAAAGAGAGAGATGGAGG - Intronic
1168340454 19:55620366-55620388 CAATGACATCAGAAGCATGGAGG + Intergenic
925857199 2:8140796-8140818 GAAAAAGATCAGAAAGAGGGAGG + Intergenic
925895401 2:8467759-8467781 GACTGAAAACAGAAGCATGGTGG - Intergenic
926473800 2:13296214-13296236 AAAAGAAATTAGAAGGATAAAGG + Intergenic
927446629 2:23168006-23168028 GAAAAAAATCAAAAGAATGGTGG + Intergenic
927616360 2:24600674-24600696 GAAAGAAAGCAAGAGGATGTAGG - Intronic
927652128 2:24919524-24919546 GAAAGAAATCAGGACCATCGTGG + Exonic
928639154 2:33279681-33279703 GAAAGAAATACAAAGAATGGGGG - Intronic
928740878 2:34351156-34351178 GAAAGAAAGCAGAAATTTGGAGG - Intergenic
928943884 2:36754645-36754667 AAAAGAAATCTGAGGCATGGTGG + Intronic
929013614 2:37472446-37472468 GAAAGAAATCCAAAGGTTTGGGG + Intergenic
929982731 2:46697111-46697133 AGAAGAAAGCAGAAGGAAGGGGG + Intergenic
930207367 2:48601682-48601704 GAAAGAGATCAGAGAGATTGTGG + Intronic
930371573 2:50508107-50508129 GAGAGAAATCAATAGGCTGGTGG - Intronic
930881257 2:56273239-56273261 GAAAGAGGCCACAAGGATGGGGG + Intronic
931150546 2:59568104-59568126 GATAGAAATCAGAAGAGAGGGGG + Intergenic
931661717 2:64571034-64571056 GAAAGATATCACAAAGATGGGGG - Intronic
931992582 2:67805443-67805465 GAAAGAAAGCAGAAAAATGGGGG + Intergenic
932155984 2:69418096-69418118 GAAAGAAAACTGAAGAATGGGGG + Intronic
932835428 2:75031364-75031386 TAAAGAAATAAGAAGAAGGGAGG + Intergenic
933067648 2:77818354-77818376 GAAAGAAAAGAAAAGGAGGGAGG - Intergenic
933152451 2:78931758-78931780 GAAAGAGATTTGAAGGATGTGGG + Intergenic
933421965 2:82059836-82059858 GTAAGAAATAAGAAGGAGAGAGG - Intergenic
933453154 2:82483092-82483114 GAAAGAAAAAAGAAAGAGGGAGG - Intergenic
933513325 2:83269294-83269316 AAAATAAATAAAAAGGATGGAGG - Intergenic
933796430 2:85923697-85923719 GATAGAAATCAGAACAATTGGGG + Intergenic
934018084 2:87911332-87911354 GGCAGAAATCAGAGGGATAGAGG + Intergenic
934080616 2:88464674-88464696 GAAACAAAGCAGAAGGCTGTAGG - Intergenic
934622621 2:95824335-95824357 GAAAGGAATCAGAATGATGCTGG - Intergenic
935338905 2:102042369-102042391 GAAAGAAAGGAGAGGGAAGGAGG + Intergenic
935556841 2:104519356-104519378 GAAAGGAAACAGAGGGAGGGAGG + Intergenic
936527977 2:113255083-113255105 GAAGGAAAAAAGAAGGAAGGAGG + Intronic
936650722 2:114423000-114423022 GGAAGAATTCTGAAGCATGGAGG + Intergenic
936763715 2:115818049-115818071 GAAAAAAAAGAGAGGGATGGAGG + Intronic
937380251 2:121370310-121370332 GAAAGAAAATCGAAGAATGGAGG - Intronic
937425917 2:121798226-121798248 GAAGGAAAAGAGAAGGAAGGGGG + Intergenic
938043434 2:128095441-128095463 GAAAGAAAGAAGAAAGAAGGAGG - Intronic
939259623 2:139790362-139790384 GAAAGAAATCAGCATGAAGGAGG + Intergenic
939313044 2:140509571-140509593 AAAAGCCTTCAGAAGGATGGTGG + Intronic
939714236 2:145562966-145562988 GAAAAAAGTCAGAAAGATAGAGG + Intergenic
939970585 2:148654727-148654749 GCCAGAAAACAGAAGGAAGGAGG - Intronic
940149579 2:150584525-150584547 GAAAGAAATCAGAAGCTTGTAGG + Intergenic
941763638 2:169272321-169272343 GAATGAAATCAGGAATATGGAGG + Intronic
941943911 2:171073878-171073900 GAAAGAAAAAAAAAGGAGGGGGG - Intronic
942451623 2:176111949-176111971 GAAAAAAATAAGACGCATGGGGG + Intronic
942725177 2:178998472-178998494 GAAAAAAAACTGAAGCATGGAGG - Intronic
944193323 2:197026574-197026596 GACAGAAATCAGAGAGATGGTGG + Intronic
944345092 2:198654310-198654332 GAAAGAAAACAGATAGGTGGAGG - Intergenic
944805607 2:203277914-203277936 GACAGAATTTAGAAGGAAGGTGG + Intronic
944948631 2:204720529-204720551 AAAAGAAATCAGATGGCTGATGG + Intronic
945492158 2:210468879-210468901 AAAAGAAAACAGAAGTATAGTGG - Intronic
946712329 2:222518948-222518970 GAAAGAAAGCACAAGAATGTGGG + Intronic
946915460 2:224516046-224516068 GAATGAAAGGAGAAGGTTGGAGG - Intronic
948466532 2:238154560-238154582 GCAAGAAAACAGAAGGATACAGG + Intergenic
948570880 2:238916475-238916497 GAAAGAAAGAAGGAGGAGGGAGG + Intergenic
948618826 2:239220458-239220480 GAAAGAAATCTGACAGATTGCGG + Intronic
949030173 2:241791978-241792000 AAAAGAAAACAGAAAAATGGGGG - Intronic
1168819779 20:765113-765135 CAAAGAACCTAGAAGGATGGAGG + Intronic
1169542327 20:6613594-6613616 GAAAGCAATCAGAATGAGAGAGG + Intergenic
1170209972 20:13838564-13838586 GAAAGAAAAGAAAAGGAAGGTGG - Intergenic
1170253159 20:14308830-14308852 GAAAGAAAAAATAAAGATGGAGG + Intronic
1170271919 20:14537064-14537086 AACAGAAAACAGAAGGAAGGGGG - Intronic
1170370664 20:15644467-15644489 GTAAGAAAACAGAAGGAAAGAGG - Intronic
1170374137 20:15681407-15681429 CAAAGACTTCAGCAGGATGGGGG - Intronic
1170399248 20:15961892-15961914 GAAAGAAATCAGAAGGATGGAGG + Intronic
1170902243 20:20475756-20475778 GAAAGAAAGAAGAAGGGTAGGGG + Intronic
1171151899 20:22834828-22834850 GAAAGAAGTAAAAAGGAAGGAGG - Intergenic
1171239953 20:23558494-23558516 AACAGAAATCAGAAGAAAGGAGG - Intergenic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1173131233 20:40395616-40395638 GAGAGAAAACAGAAGATTGGAGG + Intergenic
1173507319 20:43598257-43598279 GACAGAAAATAGAAGGGTGGTGG + Intronic
1173857495 20:46259940-46259962 GAAACAAGAAAGAAGGATGGGGG - Intronic
1174195701 20:48771338-48771360 GAAAAAAATCCTAAGCATGGGGG - Intronic
1174207041 20:48847805-48847827 TATAGAAATCAGAAGGATGGGGG - Intergenic
1174265135 20:49325786-49325808 GAAAGGAAACAGAAAGAGGGAGG - Intergenic
1174638543 20:52023020-52023042 CAAAGAAAGCAGAAGGAAGAAGG - Intergenic
1175144102 20:56882818-56882840 GAAATAAATGAGAAGGAAAGGGG + Intergenic
1176031037 20:63011800-63011822 CTAAGAAATGAGAGGGATGGGGG + Intergenic
1176992463 21:15514362-15514384 GGAGGAAATGAGAATGATGGAGG - Intergenic
1177946194 21:27472396-27472418 GAAAGCAATCCCAAGGAAGGGGG + Intergenic
1178119741 21:29456922-29456944 GAAAGAACTCAGAAAGAAGAAGG - Intronic
1178481084 21:32979589-32979611 AAGAGAAATGAAAAGGATGGAGG + Intergenic
1178691200 21:34751681-34751703 GAAAGAAGTCACAATCATGGTGG - Intergenic
1179096683 21:38322440-38322462 AAAAGACATCTGAAGAATGGTGG - Intergenic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181577530 22:23804835-23804857 TAAAGAAATCAGAAAGAGGCTGG - Intronic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1182167353 22:28189386-28189408 CAAAGAAATCCTAAGGAAGGGGG + Intronic
1183754352 22:39746205-39746227 GAAGTAAAGCAGAAAGATGGAGG - Intronic
1185159655 22:49215567-49215589 GAAAAAAATGAGAAGGAAGAAGG - Intergenic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
949956151 3:9270383-9270405 GATAGAAATCAGAACAATAGTGG + Intronic
950307038 3:11923960-11923982 GAAGGCAATCAGGAGGGTGGAGG - Intergenic
950935112 3:16831685-16831707 GAAAGAAAAAAGAGGGAGGGAGG + Intronic
951285241 3:20803502-20803524 AAAAGAATTCAAAAGGAGGGAGG - Intergenic
951464132 3:22983748-22983770 AAAAGAAACCAGAAGGTTGGAGG + Intergenic
951535247 3:23734585-23734607 AAAGGAAATCAGAATGTTGGGGG + Intergenic
952022278 3:29038574-29038596 GAAACAAAAAAGAAAGATGGTGG - Intergenic
952364506 3:32663194-32663216 GAAATATATCAGAAAGATAGTGG + Intergenic
952433277 3:33246927-33246949 GAAAGAAAAGAGAGGGAGGGAGG - Intergenic
952957716 3:38567619-38567641 GGAACAAATCAGTAGGCTGGAGG - Intronic
953370698 3:42386091-42386113 GAAAGAAAAAAAAAGGATGCAGG - Intergenic
953556945 3:43953355-43953377 GAAAGAAATAATAAAAATGGGGG + Intergenic
953859794 3:46533761-46533783 GAAAGAAAAGAGAGGGAGGGAGG - Intronic
953917162 3:46927425-46927447 GTGAGAAATCAGAAGGAGAGAGG + Intronic
954536433 3:51362495-51362517 GAGAAAAATCAGCAGGATAGAGG - Intronic
954953944 3:54502032-54502054 GAAAGAAACCAGAAAGAGGGTGG - Intronic
955454051 3:59100804-59100826 GAGAGCAATCAGAAGCAGGGTGG - Intergenic
956698938 3:71942000-71942022 GAAAAAAAAAAGAAGGAGGGAGG - Intergenic
956879200 3:73493052-73493074 GAATGAAATCTGAAGGAGGTGGG + Intronic
958536862 3:95414986-95415008 GAAAGAAAACAGAAGGAAGGAGG + Intergenic
958975248 3:100660170-100660192 TAAAGAAATGAGAAGGTTGTGGG + Intronic
959131165 3:102357742-102357764 GAAATAGATCAGAAGTATGGAGG - Intronic
959671635 3:108984526-108984548 GAAAGAAATGAAAAGGTTTGGGG + Intronic
959825654 3:110792876-110792898 GAAAGAAATCAAAAGGAGAGGGG + Intergenic
960246787 3:115408525-115408547 GAAAAAAGAAAGAAGGATGGGGG + Intergenic
960818390 3:121698701-121698723 GAAAGAAATGAAACAGATGGAGG - Exonic
961189966 3:124951682-124951704 GAAAGAGTTCTGAAAGATGGTGG - Intronic
961314687 3:126026486-126026508 GACAGAAATCAGAAGCATGAAGG + Intronic
961351515 3:126307456-126307478 GAGAGAAATGAGCGGGATGGTGG + Intergenic
961444102 3:126970782-126970804 GAAGGAAATAAGAAGGAGAGAGG + Intergenic
961971595 3:130974036-130974058 GAAAGAAGACTGAAGGAGGGTGG + Intronic
962583936 3:136822295-136822317 GAAAAAGAGTAGAAGGATGGTGG - Intronic
962694059 3:137930245-137930267 GAAAGAAAGAAAAAGGAGGGAGG + Intergenic
963110192 3:141682267-141682289 GAAAGAAAGAGGAAGGAAGGAGG + Intergenic
963492925 3:146023566-146023588 GAAAGAAATCTGAAGACGGGAGG + Intergenic
963575030 3:147049548-147049570 GAAACAAATCAGAAAAATGTAGG + Intergenic
964144797 3:153446901-153446923 GCTAGAAATCAGAAGGAGTGTGG + Intergenic
965764526 3:172115937-172115959 AACAGAAATCAGAAGGAGGAGGG - Intronic
966855163 3:184188857-184188879 AAAGGAAATCTGAAGGAGGGAGG - Intronic
967095530 3:186174445-186174467 GAAAAAAAGGAGAAGGTTGGGGG + Intronic
967155193 3:186685456-186685478 GGAAGAACTCACAATGATGGTGG + Intergenic
967498868 3:190174744-190174766 GAAAGAGAGAAGAAGGAGGGAGG - Intergenic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
969716534 4:8870842-8870864 GAAAGAAAATGGGAGGATGGAGG - Intronic
969834376 4:9828116-9828138 ATAATCAATCAGAAGGATGGAGG - Intronic
969853402 4:9979829-9979851 GAAAGAACTCAGATGGCTGTGGG - Intronic
970057127 4:11987956-11987978 GAAAGAAATAAAAAAGGTGGGGG + Intergenic
970600613 4:17638702-17638724 CGAAGAAATCAGAAGGATCAGGG - Intronic
970632364 4:17963376-17963398 GAAAGGAATCAGAACAAAGGGGG + Intronic
971629933 4:28977929-28977951 GAAGGATATCACAAGGTTGGAGG + Intergenic
971932386 4:33101806-33101828 GAAGGAAAAAAGAAGGAAGGAGG - Intergenic
972211499 4:36843314-36843336 GAAAGAAAAAGGAAGGAAGGGGG - Intergenic
972556771 4:40189376-40189398 GAAAGGACTCAGAAGGGTGGAGG + Intergenic
972966194 4:44513518-44513540 GAAAGAATTCAGATAGATAGAGG - Intergenic
973104016 4:46309248-46309270 AAAAGAAAACGGAAGAATGGTGG - Intronic
973735958 4:53871983-53872005 GCAATGAGTCAGAAGGATGGAGG - Intronic
974488375 4:62532656-62532678 TAAAGAGATAAGAAGGAAGGTGG + Intergenic
975430999 4:74290746-74290768 AAAAGTAATGAGGAGGATGGTGG - Intronic
975868296 4:78749152-78749174 AAAAAAAATCAGAAGGATGAAGG + Intergenic
976212279 4:82683129-82683151 GAGAGAAAACAGGAGCATGGCGG + Intronic
976506978 4:85859124-85859146 GGAAAAAATGTGAAGGATGGAGG + Intronic
976833075 4:89337262-89337284 GAAATAAAGAAGAAAGATGGAGG - Intergenic
977895726 4:102362800-102362822 GAAGGAAAACAGAAGCAAGGTGG + Intronic
977998323 4:103523720-103523742 GAAAGAAAGAGGAAGGAAGGAGG - Intergenic
978219643 4:106255668-106255690 GAAAGAAGACAGAAGGAGAGAGG - Intronic
978234577 4:106443269-106443291 GAAAGAGAAGAGAAGGAGGGAGG - Intergenic
978286630 4:107085434-107085456 GATAGAAATCAGATTAATGGTGG + Intronic
978832715 4:113108271-113108293 GAAACAAATCAAAAAGATTGGGG - Intronic
978907659 4:114026896-114026918 TAAAAAAATCAGTAGGGTGGTGG - Intergenic
979148542 4:117277988-117278010 GAAAGGCAACAGAAGAATGGAGG + Intergenic
981283179 4:142984666-142984688 GAGGGACATCAGAAAGATGGGGG + Intergenic
982220549 4:153121545-153121567 GAATGAAAACAGCAGAATGGAGG + Intergenic
982454641 4:155594328-155594350 AGAAGAGATCAGAGGGATGGAGG - Intergenic
983156005 4:164349742-164349764 GAAAGAAATAAGGAGGAAGATGG + Intronic
983489816 4:168375426-168375448 GGAAGCAATCAGCAGGAAGGAGG + Exonic
983542245 4:168924180-168924202 GAAAGAATTCAGAAGGCTTTTGG - Intronic
983719940 4:170838481-170838503 GGAAGAAATCAGAAGGCTATAGG - Intergenic
984244800 4:177262185-177262207 GATAAACATCAGAGGGATGGTGG + Intergenic
984352126 4:178608628-178608650 GAAAGAAAACAGTGGGGTGGAGG + Intergenic
985861742 5:2476877-2476899 GAGAGAAATGAGAGGGAGGGAGG + Intergenic
986190535 5:5492915-5492937 GAAAGGAAAGAGAAGGAAGGAGG + Intergenic
986294396 5:6424927-6424949 GGAAGAAAGGAGAAGGAAGGAGG - Intergenic
986462114 5:7983205-7983227 GAAAGAAGTCAGAAGGAGCTCGG + Intergenic
986537151 5:8801530-8801552 GAAAGAAAGAAGAGGGAGGGAGG + Intergenic
986628947 5:9750313-9750335 TTAAGAAAGCAGCAGGATGGTGG - Intergenic
987160716 5:15139524-15139546 GAATGACATCAGCAGCATGGTGG + Intergenic
987249954 5:16089871-16089893 GTGAGAAAACAGAAGTATGGAGG + Intronic
987954057 5:24715053-24715075 GAAAGAAATCGGTAGAAAGGGGG - Intergenic
988404625 5:30808245-30808267 GAAAGAAAGGAGAAGGAAGTAGG + Intergenic
988710716 5:33771812-33771834 GAAAGAAAGAAAAAGGATGAGGG - Intronic
988985555 5:36615110-36615132 GATACAAATCAGAAGGAGGGTGG - Intronic
989085674 5:37673589-37673611 GAAAGAAAAAAAAAGGGTGGGGG - Intronic
989791111 5:45402885-45402907 GAAAGAAAAGAAAAGGAGGGAGG - Intronic
989970975 5:50523647-50523669 GAAAGAAAGAGGAAGGAAGGAGG + Intergenic
990378992 5:55202922-55202944 GAAAGAAAGAGGAAGGAAGGGGG + Intergenic
991137843 5:63204231-63204253 GAATGAAGTAAGAAGGAAGGAGG - Intergenic
991158443 5:63466470-63466492 AGAAGAAATCAGATGGAAGGAGG + Intergenic
991158450 5:63466589-63466611 GACAGAGATCCGAAGGATAGAGG - Intergenic
992130304 5:73685467-73685489 GTCTGAAATCAGAAGGAAGGAGG - Intronic
992410989 5:76504999-76505021 ACATGAAATCAGGAGGATGGTGG - Intronic
993622406 5:90184419-90184441 GAAGGAGATGAGAAGGAAGGCGG - Intergenic
993628511 5:90255140-90255162 GAAAGAAAGCAGAAGGCAAGAGG - Intergenic
993669327 5:90741056-90741078 GAATGACATCAGCAAGATGGTGG - Intronic
994001735 5:94789204-94789226 GGAAGAATTCAGGAAGATGGTGG + Intronic
994102604 5:95910254-95910276 GAAAAAAATAATAAGGAGGGTGG + Intronic
994651960 5:102540259-102540281 GAAATGAGTCAGAATGATGGAGG + Intergenic
995121022 5:108535280-108535302 GAAATAGGTCAGAAGCATGGTGG - Intergenic
995345694 5:111114310-111114332 GAGAAAAATGAGAAGGAAGGTGG + Intronic
995353448 5:111209736-111209758 GAAAGAAAACAAAAGGCTGAGGG - Intergenic
995449666 5:112286697-112286719 GAAAGAGAACAGAAGGTTGCTGG - Intronic
995934017 5:117486444-117486466 GCAAGAAATCAGAGGGCAGGAGG + Intergenic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
996395272 5:123007188-123007210 GAAAGAGAGCAGTAAGATGGGGG - Intronic
997219354 5:132147508-132147530 GGAGGAAATCAAAAGGATGAAGG - Intergenic
997596466 5:135110479-135110501 TAAAGAAAGCAGCAGGATGAGGG - Intronic
997665552 5:135627202-135627224 GACAGAAATCAGAGGCAAGGGGG - Intergenic
998154880 5:139779702-139779724 GAAAGAAATCAGAACAATGGGGG - Intergenic
998220412 5:140273564-140273586 GAAATAAATAGGAAGAATGGCGG - Intronic
998261760 5:140637091-140637113 GAAAGAAAAGGGAAGGATGCAGG + Intergenic
998955049 5:147430193-147430215 GGAAGAAAAAAGAAGGATGGGGG + Intronic
999208779 5:149869723-149869745 GGAAGAAAAGAGCAGGATGGAGG + Intronic
999474697 5:151887884-151887906 GAAAGACCTCAGAAAGGTGGTGG + Intronic
999637581 5:153638932-153638954 GAAAGAAAGCAGGAGGCAGGAGG + Intronic
999775390 5:154808821-154808843 GAAAGACACCAGATGGGTGGGGG - Intronic
1000104281 5:158044053-158044075 GAAGGAAGTCAGTAGGATGCAGG + Intergenic
1000125848 5:158243184-158243206 GTAAGAAACCAGATGCATGGAGG + Intergenic
1000793917 5:165640798-165640820 GAATGAAATCACAAGGAAGTGGG + Intergenic
1001000521 5:168002161-168002183 GAAAGAAATGTAAAGGTTGGAGG - Intronic
1001129030 5:169047973-169047995 GGAAGAAAGCAGGAGGAAGGAGG + Intronic
1001234250 5:170015935-170015957 GAAAGAAACAAGAAGGAAGGAGG - Intronic
1001514339 5:172344975-172344997 GAAAGAAAGAAGGAGGAAGGAGG + Intronic
1002831121 6:822185-822207 GCGTGAAATCAGAAGGCTGGAGG + Intergenic
1003000802 6:2330981-2331003 AAAAGAAAACAGAGGCATGGTGG - Intergenic
1003012047 6:2435458-2435480 GAAATAAAGAAGAAGGAAGGAGG - Intergenic
1003089202 6:3087320-3087342 GAAAGAAAAGAGAAAGAGGGTGG - Intronic
1003528258 6:6916540-6916562 GAAGGAAAGCAGAAGGAGGCAGG + Intergenic
1003792388 6:9561247-9561269 GAAAGAAAGAAGAAAGAAGGAGG + Intergenic
1003870892 6:10402289-10402311 AAAAGAAGGAAGAAGGATGGAGG + Intronic
1003933081 6:10946154-10946176 GAAAGAAAACAGAATGGTTGGGG - Intronic
1004331861 6:14728982-14729004 GAAAAAAATGGGAAGGAGGGAGG + Intergenic
1004423552 6:15492491-15492513 AAAAGGAAACAGAAGAATGGAGG - Intronic
1005275511 6:24212409-24212431 GAAAGAAAACAAAAGGCAGGAGG - Intronic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1005736425 6:28751936-28751958 GAAATAAATGAGAAAGAAGGTGG + Intergenic
1006213166 6:32414587-32414609 GAAAGAAAAGAGAAGAAAGGAGG + Intergenic
1006277044 6:33013333-33013355 AAAACAAAACAGAAAGATGGAGG - Intergenic
1006341815 6:33451598-33451620 GAAACAAAATAGGAGGATGGTGG + Intronic
1006557921 6:34885073-34885095 AAAATAAATCAGAAGAATGTAGG - Intronic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1007623936 6:43231879-43231901 GAAAGAAAGAAGAAAGAAGGAGG - Intergenic
1007735282 6:43978446-43978468 GAAAGAGAAGATAAGGATGGAGG - Intergenic
1009613629 6:65977783-65977805 GAAAGGAATCTGGAGGATGGAGG + Intergenic
1010182642 6:73105903-73105925 GAAAATAATCAGAAGCTTGGGGG - Intronic
1010301965 6:74271465-74271487 GAAAGAAATTAGATTGATAGTGG - Intergenic
1010463710 6:76142838-76142860 GAAAAAAACCACAAAGATGGGGG - Intergenic
1010663696 6:78600832-78600854 GAAAGACAGCAAAAGGTTGGGGG + Intergenic
1011076170 6:83441638-83441660 GAAAAAAAATAAAAGGATGGAGG - Intergenic
1011198297 6:84805330-84805352 GAAAGAAAACATTAGGAAGGTGG - Intergenic
1012445099 6:99299034-99299056 GAAAGAACTGAGATGCATGGTGG - Intronic
1012604883 6:101145490-101145512 GGAAAAAAACAGGAGGATGGGGG - Intergenic
1014148725 6:118028585-118028607 AAAAGAAGGCTGAAGGATGGGGG + Intronic
1014164096 6:118204030-118204052 GAAAGCAATAATTAGGATGGAGG + Intronic
1014253072 6:119134788-119134810 GAAAGATGTCAAGAGGATGGAGG - Intronic
1014309990 6:119787789-119787811 GAACCAAATCAGCAGGATGTGGG + Intergenic
1015246220 6:131077423-131077445 GAAAGAAATAAGAAGAATAAGGG - Intergenic
1015426788 6:133079893-133079915 GAAAAAAATCAGAATGGTGTTGG - Intergenic
1015567431 6:134588011-134588033 GAAAGAAAAGAAAAGGAGGGAGG + Intergenic
1016207078 6:141481562-141481584 GGAGGAAGACAGAAGGATGGTGG - Intergenic
1016855370 6:148664846-148664868 GAAAGAAATAATAAAGATGAAGG - Intergenic
1016981935 6:149862314-149862336 GAATGATATCAGCAAGATGGGGG - Intronic
1017284517 6:152658698-152658720 GAAAAAAAAAAAAAGGATGGTGG + Intergenic
1017921565 6:158877462-158877484 GAAAGAAAAAGGAAGGAAGGAGG - Intronic
1018008631 6:159647677-159647699 GAGAGAAGGAAGAAGGATGGAGG + Intergenic
1018278202 6:162155922-162155944 TAAAGAATGCAAAAGGATGGAGG + Intronic
1018622269 6:165741752-165741774 GAAAGAAATGAGATTGATTGTGG + Intronic
1019916819 7:4138767-4138789 GAAAGAAAGAAGAAGGAAGGAGG + Intronic
1019985466 7:4652260-4652282 GAAAGGAATGAGCAGGAGGGAGG - Intergenic
1020240406 7:6390042-6390064 AAAAGAAAGGAGAAGGAAGGAGG - Intronic
1020254159 7:6492756-6492778 GAAAGAAAGAAGGAGGATAGAGG + Intergenic
1020487749 7:8739442-8739464 GAAGGCAATCAGAAGCAGGGTGG - Intronic
1020558883 7:9704113-9704135 GAAAGAAATGAGAAGGAGATGGG - Intergenic
1020687079 7:11309400-11309422 GCAAGCAATAAGGAGGATGGGGG + Intergenic
1020756448 7:12209986-12210008 AAAACAAATCAGAATCATGGGGG - Intergenic
1020914876 7:14180363-14180385 GAAAAAAATCAGAAGGAGGGTGG - Intronic
1021706948 7:23376938-23376960 TAAAGAAATCAGCAGGAATGTGG + Intronic
1022252771 7:28625324-28625346 GCAAGAAATCAGAATGATGGAGG - Intronic
1022521079 7:31007242-31007264 TAGAGAACTCACAAGGATGGGGG + Intergenic
1023286355 7:38624916-38624938 GAAACAAGTCAGCAGAATGGAGG + Intronic
1023293386 7:38690273-38690295 GCAAGAAACTGGAAGGATGGAGG - Intergenic
1024392164 7:48827682-48827704 GAAAGAAGAAAGAAGGATAGCGG + Intergenic
1024403864 7:48954850-48954872 GAAAGAAATCACAAGGACTGGGG + Intergenic
1024528772 7:50373136-50373158 GGAAGGAAACAGAAGCATGGGGG - Intronic
1024634364 7:51275317-51275339 GGAAAAAACCAGGAGGATGGAGG - Intronic
1024824488 7:53375258-53375280 GAAAAAAATCAAAATGATAGAGG - Intergenic
1024955352 7:54913063-54913085 TAAAGAAATAAGACGAATGGTGG + Intergenic
1025640983 7:63369266-63369288 GCAAGAACTCAGAGGGAAGGTGG - Intergenic
1025733805 7:64129402-64129424 GACAGAAAGCAGACCGATGGTGG + Intronic
1026452471 7:70541200-70541222 GAAGGCAATTAGAAGGATGCAGG - Intronic
1026638877 7:72106891-72106913 GAAAGAAAAAGGAAGGAAGGAGG + Intronic
1027450321 7:78324238-78324260 AAAAAAAAACAGAAGGCTGGTGG + Intronic
1027547774 7:79550744-79550766 GAAAGAGATGAGAATTATGGAGG - Intergenic
1028136438 7:87227790-87227812 GAAAGAAAGAAGAGGGAGGGAGG + Intergenic
1028210577 7:88069240-88069262 GAAGGAAAGCAGAAGGAGAGAGG - Intronic
1028262784 7:88685651-88685673 GAAAGAAAGAAGGAGGATGGAGG - Intergenic
1028401315 7:90428633-90428655 GAAAGAAAGGAGAAAAATGGTGG - Intronic
1028839504 7:95412704-95412726 GAGAGTAATCAGAAGGTTGGTGG + Intronic
1029227467 7:99038531-99038553 GAAATAAGACAGAAGGATGTAGG + Intronic
1029292421 7:99512382-99512404 GAAAGAAATCAGTAGAATCATGG - Intronic
1029429501 7:100521352-100521374 GAAACAAATCAGAAGGTTCTTGG - Intergenic
1029580537 7:101434089-101434111 GAAAGAAAGCAGAAAGAAAGAGG - Intronic
1030174425 7:106636579-106636601 GAAAGAAAAGGGAAGGAGGGAGG + Intergenic
1030195494 7:106849274-106849296 GAAAGACAGCAAGAGGATGGGGG - Intergenic
1030365504 7:108641374-108641396 GAAAGAAAAAAGAGGGAGGGAGG - Intergenic
1030680588 7:112430036-112430058 GATACAAATCAGAGGTATGGTGG + Intronic
1031773544 7:125877365-125877387 GAAAGAAAACAGAAGAAAGCAGG + Intergenic
1032479757 7:132236854-132236876 GAGAGAAAGGAGAAGGCTGGGGG - Intronic
1033444811 7:141411085-141411107 AAAAGAAATTAGAATGGTGGAGG + Intronic
1033444823 7:141411234-141411256 AAAAGAAATTAGAATGGTGGAGG + Intronic
1033957846 7:146874023-146874045 GAAATAAATCAGAAAGAGGTGGG + Intronic
1034044294 7:147911633-147911655 GACAGAAAATAGAACGATGGTGG - Intronic
1034310522 7:150083786-150083808 GAGAGAAAACAGCAGTATGGAGG - Intergenic
1034465259 7:151224263-151224285 GAAAGGAATCCCAAGAATGGGGG - Intronic
1035082415 7:156227949-156227971 GAAAGACATCAAAAGGAGGAGGG + Intergenic
1035491450 7:159282865-159282887 GAAAGAAATTATAAGTTTGGGGG + Intergenic
1035977647 8:4330767-4330789 GAAAGAAATGATAAGTAGGGAGG - Intronic
1036070132 8:5433656-5433678 GAAAGGAATGAGAAGGAGAGTGG - Intergenic
1036160080 8:6379641-6379663 GAAGCAAACCAGAAGGGTGGTGG - Intergenic
1037246825 8:16844980-16845002 GAAGGAAATCAGAGGGGTTGTGG - Intergenic
1037711777 8:21360862-21360884 GAAAAAAAGCAGAAAGATGTGGG - Intergenic
1037774376 8:21823273-21823295 GAAAGAAGAGAGAAGGAAGGAGG - Intergenic
1038038962 8:23707890-23707912 GAAAGAAAGAAAAAGGAGGGAGG - Intergenic
1039557310 8:38485674-38485696 AACAGAAATCAGGAGGGTGGAGG + Intergenic
1039583763 8:38688068-38688090 GAAAGAAAGGAGAAGAAGGGAGG + Intergenic
1040085423 8:43335085-43335107 GAAGGCAATCAGAAGGGTTGGGG - Intergenic
1040535879 8:48309402-48309424 GAGTGACATCAGCAGGATGGAGG + Intergenic
1040660859 8:49573447-49573469 GAAAGAAGCCAGTAGCATGGTGG - Intergenic
1040720018 8:50308574-50308596 AAAAGAAAACAGAAGGAAGATGG - Intronic
1040769073 8:50951023-50951045 GACAGAAAACAGAAGGAGGCAGG + Intergenic
1040963792 8:53064067-53064089 GAAAGACATAAGAAGGAGGAGGG + Intergenic
1041150804 8:54931713-54931735 GGGAGAAATCAGAAGAAAGGAGG - Intergenic
1042215111 8:66423424-66423446 GAAAGAAAGAAAAAGGAGGGGGG - Intergenic
1042237303 8:66625730-66625752 GAAAGAAATCAGAATAACTGAGG + Intergenic
1042821687 8:72936648-72936670 GAAAGCAATTAAAAGGAGGGAGG + Exonic
1043058566 8:75471597-75471619 GAAATTAATAAGAAGGAAGGAGG - Intronic
1044099760 8:88120187-88120209 AAAAGAAAACAGAAGGAAGGAGG + Intronic
1044550023 8:93501562-93501584 GCAAGAAAACAGAAGGAGGAAGG - Intergenic
1044712226 8:95069001-95069023 GAAAGCAATCAGAGGGATGGAGG - Intronic
1044761509 8:95522467-95522489 GACAGAAGTTAGAATGATGGTGG - Intergenic
1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG + Intronic
1044936841 8:97301656-97301678 AAAAGAAATCAGGGAGATGGAGG + Intergenic
1045290729 8:100830390-100830412 GAAAGAAAGGATAGGGATGGAGG - Intergenic
1045399718 8:101801074-101801096 GAAAGAAAGAGGAAGGAAGGAGG + Intronic
1045522958 8:102919363-102919385 GAAACAAATCAGAAGGAAGGGGG - Intronic
1045656038 8:104387478-104387500 GAGCGATATCATAAGGATGGGGG + Intronic
1046050306 8:109013999-109014021 GGAAGTACTCAGAATGATGGAGG + Intergenic
1046420613 8:113979093-113979115 GAAAGTAAACAGAAGGAAGTAGG - Intergenic
1047050643 8:121107970-121107992 TACAGAGATCAGAAGGAAGGGGG - Intergenic
1047107316 8:121746762-121746784 GAAAAAAATCAGAAGAGTGGTGG - Intergenic
1047116702 8:121850380-121850402 GAAACAAATCAGAAGGTTCAAGG + Intergenic
1047806067 8:128361175-128361197 GAAAGAAAAGAAAAGGAGGGAGG - Intergenic
1047857715 8:128930483-128930505 GAAAGAAAGAAAAAGGAAGGAGG - Intergenic
1048196336 8:132334884-132334906 GAGAGAAGTCAGAAGTGTGGGGG - Intronic
1048560475 8:135530810-135530832 GAATGGTATCTGAAGGATGGAGG - Intronic
1048790868 8:138102089-138102111 GAGGTAAATCAGAAGGATGGAGG + Intergenic
1050099956 9:2108389-2108411 GCAAGAAACCAGAAGCATGCAGG + Intronic
1050957443 9:11682443-11682465 GAAAGAAAAAAGAAGGAAGGAGG + Intergenic
1050963213 9:11764895-11764917 AATAGAGAGCAGAAGGATGGAGG + Intergenic
1051324822 9:15954202-15954224 GAAAGCTAGCAGAAGGAAGGGGG - Intronic
1051485821 9:17606697-17606719 GAAAGAAAACAGAAGGTGGCAGG - Intronic
1051698090 9:19789873-19789895 GGGAGAGAACAGAAGGATGGAGG - Intergenic
1051840874 9:21396449-21396471 GAGTGAAATGTGAAGGATGGAGG - Intergenic
1052946924 9:34176105-34176127 GAAAGAAGACAGAAAGAGGGAGG + Intergenic
1053193091 9:36090839-36090861 AAAAGAAATCAGAAAGATATAGG + Intronic
1053485010 9:38445794-38445816 CAAAAAAAGCAGAAGGATGTGGG + Intergenic
1055410276 9:76021543-76021565 GAAAGAAGTCAGGAAGATGGGGG + Intronic
1055482740 9:76725926-76725948 GAAAGAAGTCAGCAGGATCTGGG + Intronic
1055699024 9:78920979-78921001 GAGAGAAATCAGAAGGACAAAGG - Intergenic
1056320481 9:85430420-85430442 AAAAGAAATGAGAAGAAGGGAGG + Intergenic
1056373713 9:85986006-85986028 GAAGGAAATCCCCAGGATGGTGG + Intronic
1056381764 9:86062666-86062688 GAAAGGAAGAGGAAGGATGGAGG + Intronic
1058317123 9:103581983-103582005 AAAAGAAAACAGAAAGATGTGGG - Intergenic
1058370243 9:104258249-104258271 GAAAGAAATGAAAGGAATGGTGG + Intergenic
1058471435 9:105283143-105283165 GAAATAGATCAGAACCATGGAGG - Intronic
1058540733 9:106009889-106009911 GAAAGAAATGAGAACTATGACGG - Intergenic
1058579320 9:106437642-106437664 GAAAGAAAGAAGAAGAAGGGGGG - Intergenic
1060414806 9:123422678-123422700 GAAGAATATCAGAAGGCTGGGGG + Intronic
1060546536 9:124465173-124465195 GAGAGAGACCAGGAGGATGGAGG - Intronic
1060592709 9:124828995-124829017 GAAAGAAAGAGGAAGGAAGGAGG - Intergenic
1060696096 9:125710421-125710443 GAAGGAAAGCAGAAGGATGGAGG + Intergenic
1060722498 9:125988463-125988485 TAAAGAAATGAGAAGCAGGGAGG - Intergenic
1060874824 9:127075159-127075181 GGAAGAATGCAGGAGGATGGAGG - Intronic
1062707045 9:137951517-137951539 GAGAGAAACCAGGAGGGTGGTGG - Intronic
1203734194 Un_GL000216v2:120217-120239 CCAAGAAATTAGAAGGGTGGAGG + Intergenic
1185469730 X:375156-375178 TAAGGAAGTGAGAAGGATGGAGG - Intronic
1185611148 X:1394376-1394398 GAAAGAAGTGAAAAGGAAGGCGG - Intergenic
1186430087 X:9497805-9497827 GAAAGAAACGAGAGGGAGGGAGG - Intronic
1186822273 X:13302698-13302720 GAAAGAAATGAGAGAGTTGGGGG - Intergenic
1186843124 X:13505225-13505247 GAAAGAAAAGAAAAGGAGGGTGG + Intergenic
1187025670 X:15433572-15433594 GAAAGAAATGAGGAGGAGGAAGG + Intronic
1187046361 X:15651109-15651131 GAAAGAAATTGGGGGGATGGGGG + Intronic
1187102927 X:16213389-16213411 TTAAGAACTCAGAAGGATAGAGG + Intergenic
1187230791 X:17420887-17420909 GTAAGAAGTCAGAAGAATGCAGG - Intronic
1187896930 X:23990772-23990794 GAAAGAGAGGAGAAGGAAGGGGG - Intronic
1187938331 X:24357447-24357469 TGAAGCAATTAGAAGGATGGTGG + Intergenic
1188220047 X:27530360-27530382 TATAGAAAACAGAAGAATGGCGG - Intergenic
1188297950 X:28472773-28472795 AAAAGAAATCAGAAAAATGACGG + Intergenic
1189224077 X:39398200-39398222 GAAAGAGAAAAGAAGGAGGGAGG - Intergenic
1190123400 X:47682643-47682665 GAAAGAAAGAAGGAGGAAGGAGG - Intergenic
1190239196 X:48644255-48644277 GAAACAAAACACTAGGATGGTGG + Intergenic
1190536517 X:51433594-51433616 GAGAAAAATCAGCAGGAGGGGGG - Intergenic
1192017185 X:67343844-67343866 GAAGTTAATCATAAGGATGGTGG - Intergenic
1192115086 X:68402488-68402510 TAAAGAAGTCAGTAGGATGTGGG + Intronic
1192360534 X:70435940-70435962 GAAAGAAATAAAAAGAATGGCGG - Intergenic
1192656327 X:72998826-72998848 GGGAGAAATCAGAAGGAGTGGGG - Intergenic
1192665793 X:73084175-73084197 GGGAGAAATCAGAAGGAGTGGGG + Intergenic
1193085271 X:77443314-77443336 CAAAGAAAACAGAAGGAGAGAGG + Intergenic
1193203947 X:78725843-78725865 GAAAGAAAAGAGAGGGAGGGAGG - Intergenic
1193388542 X:80899502-80899524 GAAAGAAAACAGAAAAATGGAGG - Intergenic
1194785292 X:98076488-98076510 GGAAGAAATCAGAATGATATGGG - Intergenic
1194793521 X:98181186-98181208 AAAAGAAAGGAGGAGGATGGAGG - Intergenic
1195211163 X:102653015-102653037 GCAAGAAATAAAAAGGATGCTGG - Intronic
1195217315 X:102713974-102713996 GCAAGAAATAAAAAGGATGCTGG - Intronic
1195889370 X:109675413-109675435 ATAGGAAATCAGAAGGATGCAGG - Intronic
1196103408 X:111871034-111871056 GGATGAAATCAGAATGAAGGAGG + Intronic
1196729196 X:118924065-118924087 GATAGAGAGTAGAAGGATGGTGG - Intergenic
1196834495 X:119801932-119801954 GAAAGAAAAAAGAAAGAAGGAGG - Intergenic
1197316269 X:124970136-124970158 GAAAGAAAATAAAAGGATAGTGG - Intergenic
1197334416 X:125194463-125194485 GAAAGACATCACCAGTATGGAGG - Intergenic
1197464465 X:126785564-126785586 AAAAAAAAATAGAAGGATGGTGG + Intergenic
1197700741 X:129597741-129597763 GCAAGAAAGAAGAAGGAGGGAGG + Intergenic
1198188032 X:134273275-134273297 GGAAGAACTCAGAGGGATGAAGG + Intergenic
1198427459 X:136534058-136534080 TAAAGCAATGAGAAGCATGGAGG - Intronic
1198653456 X:138888872-138888894 CAAAGATATCAGAAGAATGATGG - Intronic
1198926760 X:141805599-141805621 GAAAAGAATCAGAGGGAAGGTGG - Intergenic
1199126445 X:144127677-144127699 GGCAGAAATCAGAGGGATAGAGG - Intergenic
1199251911 X:145673251-145673273 GATAGAAATCAGAGGGAGAGTGG + Intergenic
1199397745 X:147359391-147359413 GTAAGAAAGTAGAAGAATGGGGG - Intergenic
1200053781 X:153447923-153447945 AAAAGAAACCAAAAGGATGGTGG + Intronic
1200363784 X:155638870-155638892 GAAGGAAATCAGAATGAGAGAGG + Intronic
1201538898 Y:15084727-15084749 GAAAGAAAAAAGAGGGAGGGAGG + Intergenic
1202626819 Y:56868206-56868228 CCAAGAAATTAGAAGGGTGGAGG - Intergenic