ID: 1170401799

View in Genome Browser
Species Human (GRCh38)
Location 20:15993891-15993913
Sequence GTGAATAGAAAGCTGGTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170401797_1170401799 3 Left 1170401797 20:15993865-15993887 CCTGTACAGATGTGTAAAATAGT 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1170401799 20:15993891-15993913 GTGAATAGAAAGCTGGTCAAAGG 0: 1
1: 0
2: 0
3: 16
4: 151
1170401796_1170401799 10 Left 1170401796 20:15993858-15993880 CCTTCTACCTGTACAGATGTGTA 0: 1
1: 1
2: 1
3: 12
4: 127
Right 1170401799 20:15993891-15993913 GTGAATAGAAAGCTGGTCAAAGG 0: 1
1: 0
2: 0
3: 16
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170401799 Original CRISPR GTGAATAGAAAGCTGGTCAA AGG Intronic
901187209 1:7382235-7382257 AGGAAGAGAAAGCTGGGCAAAGG + Intronic
902463695 1:16600968-16600990 GTGAGGAGACAGCTGATCAAAGG - Intronic
907606718 1:55825626-55825648 ATGAAATGAAAGCTGCTCAAGGG - Intergenic
908155110 1:61345367-61345389 GTGTACACAAAACTGGTCAAAGG + Intronic
909908301 1:81226612-81226634 GTGACTAGAAAACTGCTTAATGG + Intergenic
912128145 1:106566438-106566460 CTGGATAGAAAGGTGTTCAATGG + Intergenic
913462252 1:119100003-119100025 GTGAATAGACACCTGTTGAATGG + Intronic
916478254 1:165190860-165190882 GTAAATAGACAGCTGATCCAGGG + Intergenic
919896991 1:202015182-202015204 GTGAAGAGAAGGATGGTCAGAGG - Intronic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
922443336 1:225675894-225675916 GAGAATAGAAAGGTGTTTAATGG + Intergenic
1062829719 10:597474-597496 GTGAATGGAGACCTGGTGAATGG + Intronic
1063088246 10:2838883-2838905 GTGAGTAGAAAGCTTGTGGATGG - Intergenic
1064273053 10:13882171-13882193 GGGTATAGGAAGCTGGCCAAAGG + Intronic
1066299179 10:34081800-34081822 CTGAAGTGAAGGCTGGTCAAAGG + Intergenic
1067165215 10:43860966-43860988 GTGATGAGAAAGCTTTTCAAAGG + Intergenic
1069308838 10:67007367-67007389 GCCAATAAAAAGTTGGTCAAGGG - Intronic
1069618881 10:69824014-69824036 GCGTATAGAATGCTGGTCAAGGG + Intronic
1071155342 10:82681992-82682014 CTGAATAGAACACTGGGCAAGGG + Intronic
1072831225 10:98660793-98660815 GTGAAGAGAAAATTGCTCAAGGG - Intronic
1073479187 10:103775509-103775531 TTGAATAGAGAGCTGGGAAATGG + Intronic
1074191025 10:111137719-111137741 ATGAATAGTGAGCTGGGCAAGGG - Intergenic
1075428977 10:122364961-122364983 CTGCCCAGAAAGCTGGTCAAAGG - Intergenic
1076222403 10:128745147-128745169 GTAAGTAGAAAGTTGGTTAAAGG - Intergenic
1080287450 11:30631875-30631897 GTAAATAGAAAACTGGTAAATGG - Intergenic
1082131360 11:48493410-48493432 GTGAATAGAATGGTGGTAATCGG + Intergenic
1082564856 11:54664284-54664306 GTGAATAGAATGGTGGTTACCGG + Intergenic
1084773455 11:71359118-71359140 GTGAATAGAAAGATGATGGATGG - Intergenic
1087372186 11:97299181-97299203 ATGAACAGAAAGCTGGTAATTGG + Intergenic
1089804485 11:121071139-121071161 GTGGATAGACATCTGATCAAGGG - Intronic
1092043102 12:5402972-5402994 GTGTACAGAGAGCTAGTCAAGGG + Intergenic
1095040180 12:37432653-37432675 GTTAATAGGAGGCTGGTCTAAGG + Intergenic
1096887200 12:54729959-54729981 TTGAAAAGAATGCTGGGCAAAGG - Intergenic
1101200109 12:102426910-102426932 GTGAATAAAAAGAATGTCAAAGG - Intronic
1106331345 13:28742462-28742484 GAGAATAGGGAGCTGTTCAATGG - Intergenic
1106898658 13:34332392-34332414 GAGAATAGTATGGTGGTCAAAGG + Intergenic
1107570806 13:41656352-41656374 GGGAATACAAAGCTGTTGAAGGG - Intronic
1108935361 13:55875134-55875156 GTGATTAGAAAACAGGTCATGGG - Intergenic
1112740377 13:102466419-102466441 GGGAATAGAAAGCTGCTGAAGGG + Intergenic
1114988346 14:28258300-28258322 CTGAAAGGAAAGATGGTCAAAGG - Intergenic
1115483046 14:33881127-33881149 GAGAATATAAAGCTGGATAAGGG + Intergenic
1118461808 14:65994089-65994111 GTCTAAAGAAAGCTGGTCAATGG + Intronic
1121978476 14:98429927-98429949 GTGAATACAGAGCTGGGCAGGGG + Intergenic
1122600890 14:102921260-102921282 GTGAATAGATAGATGGTAAATGG - Intergenic
1125101531 15:35918700-35918722 GTGAATAGAATGGTGGTTATTGG + Intergenic
1125378839 15:39064463-39064485 AGGAATAGAAAGCTGTTCAGGGG - Intergenic
1127023194 15:54774432-54774454 GTGAATGGACAACTGGTAAAAGG + Intergenic
1127157424 15:56142671-56142693 GTGAATATCAAGCTGGTATATGG - Intronic
1130807876 15:87345687-87345709 GTGAATATAATGCTGTGCAATGG - Intergenic
1138112948 16:54339044-54339066 GTGAATAAAATCCTGGTCTATGG + Intergenic
1143341877 17:6217729-6217751 CTTAATAGAAAGCTGGGCAAAGG - Intergenic
1143685609 17:8513185-8513207 GGAAATAGAAAAATGGTCAAAGG - Intronic
1144588101 17:16500984-16501006 GTGTGGAGAGAGCTGGTCAAGGG + Intergenic
1146479916 17:33196958-33196980 CTCAATAGAAAGCTGGTACATGG + Intronic
1156438480 18:37159251-37159273 GTGATTTGAATCCTGGTCAAAGG + Intronic
1159031606 18:63237661-63237683 TTTTATGGAAAGCTGGTCAAAGG + Intronic
1159584437 18:70270248-70270270 GTCAATACATAGCTGATCAATGG + Intergenic
1163236267 19:16032281-16032303 TTCAATAGAAAGGTGGTCAGTGG + Intergenic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1168468147 19:56620425-56620447 GAGAATAGAAAGTGGGTCGAAGG + Intronic
1202679356 1_KI270711v1_random:38408-38430 GTGAGGAGACAGCTGATCAAAGG - Intergenic
926361337 2:12090607-12090629 ATGATTAGAAAGCTGCTAAATGG + Intergenic
937416029 2:121715169-121715191 TTGAGTAGCAAGCTGGTCAGGGG + Intergenic
937471569 2:122178293-122178315 CTGAAAAGAAAGATGGTGAAAGG - Intergenic
937471576 2:122178350-122178372 CTGAAAAGAAAGATGGTGAAGGG - Intergenic
942862624 2:180634736-180634758 GTCAATAGAAAAATGGACAAAGG + Intergenic
947516228 2:230807334-230807356 GTGAATACTAAGCTGGGAAAAGG - Intronic
947772241 2:232679765-232679787 CTGAATAGAAACGTGGGCAAAGG + Intronic
949075206 2:242052819-242052841 GAGAATGGAAAGGTGGTCACTGG + Intergenic
1169518497 20:6345137-6345159 ATGGATAGGAAGCAGGTCAAAGG - Intergenic
1170050345 20:12136355-12136377 GTGAATAGAATGGTGGTTACTGG - Intergenic
1170401799 20:15993891-15993913 GTGAATAGAAAGCTGGTCAAAGG + Intronic
1171457431 20:25279927-25279949 ATAAATAGAAAACTGCTCAATGG + Intronic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172499926 20:35418467-35418489 GTGAAGAGAAAGATGGGCAGAGG - Intergenic
1172689230 20:36778994-36779016 GTGTCCAGAAAGCTGGTGAAGGG + Exonic
1173642191 20:44611435-44611457 AAGGATGGAAAGCTGGTCAACGG - Intronic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1182033279 22:27177099-27177121 GTTAATAGAAAGATAGTTAAAGG - Intergenic
1182366253 22:29781371-29781393 GAGAGTAGAAAGCTGGGCAGGGG - Intergenic
1183321888 22:37169940-37169962 GTGGATAGAAGGGTGGTTAATGG + Intronic
949404486 3:3700031-3700053 GAGATAAGAAAGCTGGTAAATGG + Intergenic
949466688 3:4351817-4351839 GTGGATTTAAAGCAGGTCAAAGG + Intronic
952010239 3:28892465-28892487 GTTAATAGAAAGCAGGTCAGAGG + Intergenic
953593793 3:44287912-44287934 GTGAATAAAAGGCAGCTCAAGGG - Intronic
955696723 3:61644423-61644445 GAGAATTTAAAGCTGCTCAAGGG + Intronic
956436548 3:69239689-69239711 GTGAATAGGGAGCTGTTTAATGG + Intronic
956607138 3:71084093-71084115 GTGAACTGAAACCTGGTGAATGG - Intronic
956783845 3:72625770-72625792 GCGAATCCAATGCTGGTCAAGGG + Intergenic
958665554 3:97132707-97132729 GAGAATACAAAGCTGAACAAAGG + Intronic
958812580 3:98878775-98878797 GTGAATGGAAAGCTGCAGAAAGG - Intronic
959110660 3:102118529-102118551 GGGAATGGGAAGATGGTCAAAGG - Intronic
961373372 3:126446299-126446321 GTAAATAGCAAAGTGGTCAAGGG + Intronic
961588749 3:127958810-127958832 GGCAAGAAAAAGCTGGTCAAGGG + Intronic
964245320 3:154645438-154645460 GTGTATAGAAGGCAGATCAATGG + Intergenic
964439346 3:156689872-156689894 GTGTCAAGAAAGGTGGTCAAGGG - Intronic
964844238 3:161028447-161028469 GAGAAAAGAAAGCGGGCCAAGGG + Intronic
966674445 3:182570265-182570287 GAGAACAGAAAACTGGTCATTGG - Intergenic
968431034 4:558928-558950 GTGAGCAGAAGGCAGGTCAAAGG + Intergenic
968445099 4:648475-648497 GTGGAAGGAAAGCTGGTCACTGG + Intronic
971417224 4:26442866-26442888 GTGAAGAAAAAGCAGGTCAAGGG - Intergenic
974560941 4:63517184-63517206 ATGAAGAAAAATCTGGTCAATGG - Intergenic
975850720 4:78569239-78569261 GTGGATGGAAATCTGATCAAAGG + Intronic
977915241 4:102585246-102585268 GTTACTAGAAAGCTGTTCAAAGG - Intronic
983004110 4:162461322-162461344 GTGAGTAGAAAGATGGAAAAGGG + Intergenic
985332430 4:188853310-188853332 TTCAATATAAAGCTGGTCAAGGG + Intergenic
987944145 5:24582698-24582720 GTCAATAGAAAGATTGACAAAGG + Intronic
992478473 5:77127058-77127080 TGGAATAGAAAGCTGGATAATGG - Intergenic
992683097 5:79172462-79172484 GTGAAGAGAAATCTGGCCAGTGG - Intronic
993010796 5:82480196-82480218 GTGATTTGAAAAGTGGTCAAGGG + Intergenic
995552904 5:113298134-113298156 GTGAAAAGAAAAGTGGTCTAAGG + Intronic
995719187 5:115112074-115112096 TTGAATAGAAAGTTGGGCTAGGG - Intergenic
996618614 5:125472236-125472258 GTGAATATAGAGGTGGTTAATGG - Intergenic
996920775 5:128765225-128765247 GTGAATAGAATTTTGGTTAATGG + Intronic
1000137444 5:158366421-158366443 GCCAATAGAAATCTGGTCGAGGG - Intergenic
1002161675 5:177317714-177317736 GTCAATAGAGAGCTGTTCATAGG + Intergenic
1003846358 6:10178170-10178192 ATGGATAGAAACATGGTCAATGG + Intronic
1005507885 6:26485592-26485614 GTGGATAGAAAGCTGGGAGAGGG + Intergenic
1006060645 6:31416118-31416140 GTGACAAGAAAGCTGGTCCTGGG - Intergenic
1006073096 6:31511004-31511026 GTGACAAGAAAGCTGGTCCTGGG - Exonic
1008778241 6:55067459-55067481 GAGAATAGAATGGTGGTTAACGG - Intergenic
1009751890 6:67886088-67886110 ATGAAAAGAAAGCAGGTCATGGG + Intergenic
1010678989 6:78777144-78777166 GTGAAAGGAAGGCTGGGCAATGG + Intergenic
1010925498 6:81740393-81740415 GTGAAAAGCAAGTTGGTCAAAGG + Intronic
1012612640 6:101234663-101234685 GGGAAGAGAAAGATGGTAAAGGG + Intergenic
1012756435 6:103237921-103237943 GTGCATATAAAGCTGGGCAAGGG - Intergenic
1015240927 6:131022423-131022445 TTGAATATAAAGCTGGTGGAGGG - Intronic
1018879697 6:167864791-167864813 GTGAAGAGACAGCTTGTCCAGGG + Intronic
1022290687 7:28999745-28999767 GGGAAGAGAAAGCTTGTTAAGGG + Intronic
1023200224 7:37688735-37688757 TTGAATAGAAATGTGGTCCATGG + Intronic
1024028171 7:45432139-45432161 GAAAATAGAAAGTTGGACAAAGG + Intergenic
1026425857 7:70292843-70292865 GTTAATAGAAAGCTGCACAAGGG - Intronic
1028253284 7:88560461-88560483 ATGAAAAGAAAGCTTGACAAAGG + Intergenic
1030873834 7:114789278-114789300 TTGAATAGAAAAATGGGCAAAGG - Intergenic
1031717974 7:125132498-125132520 GTCAAAAGAAAGGTGGTTAAAGG - Intergenic
1032955581 7:136968207-136968229 GGGAACAGAGAGATGGTCAAGGG - Intronic
1033004516 7:137546951-137546973 CTGACTAGAAACCTGGTCATTGG + Intronic
1033038504 7:137896931-137896953 GAGAATAGAAAGGTGGTCACTGG + Intronic
1033368989 7:140692174-140692196 GGGAATGGGGAGCTGGTCAATGG - Intronic
1038502142 8:28054019-28054041 TTGAATATAGAGCTGGTCATCGG + Intronic
1040836787 8:51740627-51740649 GTGAATAGAAAAATTCTCAAAGG - Intronic
1040860116 8:51990422-51990444 GAGAAAGGAAAGATGGTCAAAGG + Intergenic
1041594852 8:59637194-59637216 GTGCATAGAAAGATGCTCAAAGG + Intergenic
1044968560 8:97597312-97597334 GTGACTAGAAAGCAGATTAAAGG + Intergenic
1045818493 8:106306377-106306399 GTGACTAGAAAGCAGGTAATAGG + Intronic
1046696099 8:117341260-117341282 GAGAATAGAAAGGTGGTTACCGG + Intergenic
1047041340 8:120999633-120999655 GTGAATAGATATGTGGTAAAAGG - Intergenic
1048523023 8:135174457-135174479 GTGTTTAGAAAGGTGGTTAATGG + Intergenic
1052248671 9:26370285-26370307 ATGAAAATAAAGCTGGTCACTGG + Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1057880435 9:98788836-98788858 GAGGGAAGAAAGCTGGTCAAAGG - Intronic
1058352831 9:104046646-104046668 GTGAAGAGACAACTGGTAAATGG + Intergenic
1059227759 9:112688528-112688550 GTGAATGGAGGGCTGGGCAATGG + Intronic
1059524740 9:114980216-114980238 GGGACTAGAAAGATGGTCTATGG + Intergenic
1059533866 9:115063083-115063105 CTGAATAGTAAACTGGTCATAGG + Exonic
1061504555 9:131024576-131024598 GAGAATAGAAAGCCGGCCATGGG + Intronic
1062218884 9:135403803-135403825 GTGGAAAGAGGGCTGGTCAAGGG + Intergenic
1186365577 X:8889610-8889632 GTGAATAAAAAGCTTGTGAAAGG + Intergenic
1194921219 X:99767661-99767683 GTGAGTAGAAGGATGGTCACTGG + Intergenic
1195979897 X:110566622-110566644 GTTAATAGTAATATGGTCAAGGG - Intergenic
1196006821 X:110845384-110845406 GTAGATAGAAATCAGGTCAAGGG - Intergenic
1197085904 X:122474853-122474875 GGAAACAGAAAGATGGTCAAAGG + Intergenic
1198159908 X:133997615-133997637 GTGAATAGAATACTGCTCATAGG - Intergenic
1199331413 X:146564906-146564928 GGGAATAGAATGCTGGTCTGTGG - Intergenic
1199399625 X:147382627-147382649 GTTAAGAGAGAGCTGGTCCAGGG + Intergenic
1199800131 X:151242468-151242490 GTGACTTGAGAGCTGGTCCAGGG - Intergenic