ID: 1170403004

View in Genome Browser
Species Human (GRCh38)
Location 20:16007913-16007935
Sequence TAAGTTTCACAGTTGGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170402999_1170403004 28 Left 1170402999 20:16007862-16007884 CCCAACTTTATATAAGTTGGGTA 0: 1
1: 0
2: 0
3: 7
4: 135
Right 1170403004 20:16007913-16007935 TAAGTTTCACAGTTGGAACCTGG 0: 1
1: 0
2: 0
3: 11
4: 108
1170403000_1170403004 27 Left 1170403000 20:16007863-16007885 CCAACTTTATATAAGTTGGGTAT 0: 1
1: 0
2: 1
3: 9
4: 159
Right 1170403004 20:16007913-16007935 TAAGTTTCACAGTTGGAACCTGG 0: 1
1: 0
2: 0
3: 11
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170403004 Original CRISPR TAAGTTTCACAGTTGGAACC TGG Intronic
901936700 1:12631661-12631683 TAGCTTCCACAGTTGGCACCAGG - Intergenic
907496494 1:54848632-54848654 TAAGATTCAGATTTGGAACTGGG + Intergenic
908164461 1:61444409-61444431 AATGTTTTACAGTTGGAATCTGG - Intronic
908661384 1:66439238-66439260 TGGGTTTTACAGTTGGAATCAGG + Intergenic
909832660 1:80212320-80212342 TAAGTTTAGCAATTGGCACCAGG + Intergenic
915685542 1:157628909-157628931 TATTTTTCACAGTTGGAGGCTGG + Intergenic
916689682 1:167178545-167178567 TAAGTTTCCCAGTTGCAAGCTGG + Intergenic
921777717 1:219121815-219121837 TAAGATTCACAGTTGGTTCCTGG - Intergenic
922629643 1:227093059-227093081 CATGTTTCTCAGTTGGATCCTGG - Intronic
1063394367 10:5673087-5673109 TCAGATTCACAGTTGGAAACTGG - Intergenic
1066309455 10:34181910-34181932 AAAGGTGCACAGTTGGAAACAGG + Intronic
1072080288 10:92023204-92023226 TAAGGTTGAAATTTGGAACCTGG - Intronic
1072082176 10:92043541-92043563 TAAGCTTAACAGTTGAGACCAGG + Intergenic
1073035051 10:100558291-100558313 TAAGTTTTTCAGATGAAACCTGG - Exonic
1074291641 10:112142094-112142116 TAAGTTTCACTGCTGGGGCCAGG + Intergenic
1074599676 10:114900949-114900971 TAAGTTGCACCCTTGGAACTGGG - Intergenic
1076224565 10:128763821-128763843 TAACTAGCACAGTTGGAGCCTGG + Intergenic
1078007989 11:7547019-7547041 TCTGTTACACAGTGGGAACCTGG + Intronic
1078320348 11:10328899-10328921 TCCATTTCACAGTTGGAACATGG - Intronic
1079650058 11:22916599-22916621 TATGTTTCACAGCTGGAATATGG + Intergenic
1079698124 11:23509545-23509567 TAAGTTAGACAGTTGAAATCTGG + Intergenic
1079975434 11:27084975-27084997 TAAGTTTCACACTTGGGTCTGGG - Intronic
1086009192 11:82078345-82078367 TAATTGTCACAGCTGGCACCAGG + Intergenic
1086798924 11:91146186-91146208 AAAGTTACAAAGTTGCAACCAGG - Intergenic
1089945542 11:122468760-122468782 TTAGTTTCACAGTTTCAAGCTGG + Intergenic
1096810792 12:54168519-54168541 TCAGTTTCCCTGTTGGACCCTGG - Intronic
1107798606 13:44081536-44081558 TAAATTTCACAAATGGAACCTGG - Intergenic
1109694462 13:65935037-65935059 TAAGTTTCTCATTTGGCAACTGG - Intergenic
1111884347 13:94000567-94000589 CAAGTTGGACAGTTGGAACTGGG + Intronic
1112772686 13:102808254-102808276 TAACTTTCACAGTTGCAATGGGG + Intronic
1117146453 14:52840998-52841020 TGAGTATCTCAGATGGAACCAGG + Intergenic
1119280711 14:73405187-73405209 TAAATATCACAGGTGGATCCAGG + Intronic
1122092054 14:99347299-99347321 TAAGCTTTACAGTTACAACCGGG + Intergenic
1125839530 15:42785911-42785933 TAAGGGTCACAGTTAGATCCTGG + Intronic
1129678454 15:77644784-77644806 TAAGTTGCACTGGTGGAGCCAGG + Intronic
1130020704 15:80228921-80228943 AAAGTTTCAGATTTTGAACCCGG - Intergenic
1131125830 15:89856048-89856070 TAAATTACACAGTTAGAATCTGG + Intronic
1133153759 16:3857168-3857190 CAAGTTTCAAAGTTGTAAGCAGG + Intronic
1137707332 16:50544717-50544739 TAAGTTTCACTCCTGGAGCCAGG - Intergenic
1141028226 16:80567737-80567759 TAAGTTTCACATTTGTATCCAGG + Intergenic
1141478752 16:84292297-84292319 GAAGTTTCTCAAATGGAACCTGG + Intergenic
1145874927 17:28310686-28310708 TAAGTGTCTTATTTGGAACCTGG - Intergenic
1146928210 17:36759590-36759612 TAAGTTTCCCAGTGGGGAGCAGG + Intergenic
1148351573 17:46945261-46945283 CAAGTTTCCCAGCTGGAACACGG - Intronic
1151751917 17:76044036-76044058 GAAATTTCACATTTGGAAACAGG + Intronic
1153158166 18:2172556-2172578 TAAGTTTGACAGTGAGAATCAGG - Intergenic
1154141963 18:11832028-11832050 AAATTTTCACAGTAGGAACTGGG - Intronic
1156096819 18:33543682-33543704 TAAGATTCACACTTGAAAACAGG - Intergenic
1156295783 18:35789712-35789734 TAAGTTTCACAAATGCAAACTGG + Intergenic
1158238949 18:55354798-55354820 TGAATTTCAGAGTTGGAAACTGG + Intronic
1159358738 18:67371822-67371844 TAAGTTTCACATTTGAGCCCAGG - Intergenic
1164555028 19:29244824-29244846 TCAGTTTCATAGCTGGATCCAGG + Intergenic
1166931284 19:46303157-46303179 TAAGTTTCGCACTTGGCACTGGG + Intronic
1167029516 19:46948111-46948133 TAAGACTCACAGTTGGAAGGTGG + Intronic
926635878 2:15179053-15179075 GAAGTTTCAGAGATGGAAGCAGG + Exonic
928224677 2:29438293-29438315 TAAGTATTAGAGTTTGAACCAGG + Intronic
929732766 2:44513532-44513554 TAAGTTTCACAGTCCAAACATGG - Intronic
930226342 2:48798061-48798083 TATATTTCACAGTAGGAACTTGG + Intergenic
935179695 2:100678280-100678302 TCAGTTTTAAATTTGGAACCGGG - Intergenic
935459684 2:103315010-103315032 TAATTTTCAAAGGTGGAATCTGG + Intergenic
936719772 2:115237050-115237072 TTAGCTTCATAGTAGGAACCTGG - Intronic
937749500 2:125457686-125457708 TAAGTTTGACATGTAGAACCAGG - Intergenic
939241019 2:139559963-139559985 TAAGTTTGAGAGTTGTAATCAGG + Intergenic
939654649 2:144808706-144808728 TAATTTTCAAAATGGGAACCTGG + Intergenic
940809957 2:158231276-158231298 TAAGTTTGACAGGTGGAAGAGGG - Intronic
942443541 2:176061173-176061195 TAAGTTTGACTGGTGGATCCAGG - Intergenic
944168363 2:196747889-196747911 TCAGTTTCAGAGATGGAACATGG - Intronic
945963381 2:216160000-216160022 TAAGTTTCACAATAGCAATCTGG + Intronic
1170403004 20:16007913-16007935 TAAGTTTCACAGTTGGAACCTGG + Intronic
1172940163 20:38648700-38648722 TAAGTTCCACTGTGGGAAACAGG + Intronic
1174756417 20:53162844-53162866 TTAATTTCAGAGTTGGAAGCAGG + Intronic
1177029835 21:15968602-15968624 TATGTTTCAGAGGTGGAAGCGGG + Intergenic
1178928027 21:36792156-36792178 TAGGTTTCACTATTGGCACCTGG - Intronic
1182223020 22:28773295-28773317 AGACTTTCCCAGTTGGAACCTGG + Intronic
1185002991 22:48257429-48257451 TGTGTTTCCCAGTTGGAACAGGG + Intergenic
1185060224 22:48602818-48602840 TGAGCTTCACAGATGGAACCTGG + Intronic
950325303 3:12103138-12103160 TAAGGTCCACAGTTAGTACCTGG + Intronic
956717433 3:72090735-72090757 GAATTTTGACAGTTGGAAGCAGG + Intergenic
961750620 3:129092128-129092150 TAAGTTTCACACTTTGAAACTGG - Intronic
963653226 3:148011666-148011688 TAAATTTTACAGTTGGAAGGAGG - Intergenic
965189640 3:165511752-165511774 GAAGATTCACACTTGGAAGCTGG - Intergenic
965319685 3:167237508-167237530 TCAGTTCCATAGTTAGAACCAGG + Intergenic
968842704 4:3019715-3019737 GAAGTTTCACATTTACAACCTGG + Exonic
969402856 4:6968543-6968565 TAAGTAGCACAGCTGGAAACCGG + Intronic
969510194 4:7613219-7613241 TTAATTTCTCAGTGGGAACCAGG - Intronic
975016181 4:69423828-69423850 TAAATTTTACAGTAGGAAGCAGG - Intergenic
976167305 4:82269616-82269638 TGAGTTTCACAATTGGTAGCTGG + Intergenic
982476593 4:155859442-155859464 TACTTTTCACAATTGGTACCAGG - Intronic
982545307 4:156725294-156725316 TAGCTTCCACAGTTGGCACCAGG - Intergenic
983070881 4:163266218-163266240 TATGTTTCTCTGTTGGGACCAGG + Intergenic
992634913 5:78718111-78718133 GCAGGTGCACAGTTGGAACCTGG + Intronic
995909012 5:117163361-117163383 TAACTATCACAGTTGGAAATAGG - Intergenic
996587458 5:125106459-125106481 TTAGTTTTTCATTTGGAACCAGG - Intergenic
996776988 5:127143294-127143316 TATGTTTCTCCATTGGAACCAGG + Intergenic
997973741 5:138426061-138426083 TAAGCTACACAGTTGGCACCAGG - Intronic
1002684185 5:180994750-180994772 TAAGTTTCATTGTTGTATCCTGG + Intronic
1004379735 6:15122447-15122469 TAACTTCCACAGTTTGAACCGGG + Intergenic
1007925612 6:45647184-45647206 TATGTTTCAAAGTTGGTCCCTGG + Intronic
1008818936 6:55607840-55607862 TTAGTGGCACAGGTGGAACCAGG - Intergenic
1011091389 6:83605438-83605460 TTATTTTAACAGTTGGAACAAGG - Intronic
1014636621 6:123855319-123855341 TAAGTCTGACATTTAGAACCCGG + Intronic
1014737169 6:125106941-125106963 ATAGTTTCACTTTTGGAACCAGG - Intergenic
1016403141 6:143701997-143702019 TAAGTAGCAGAGTTGGAACTAGG + Intronic
1021216795 7:17925896-17925918 AAATTTTCCCAGTTAGAACCAGG - Intronic
1022332202 7:29390704-29390726 TCAGTTTCACAGGTGGGTCCTGG + Intronic
1022832227 7:34079309-34079331 CAAGTCCCGCAGTTGGAACCTGG - Intronic
1024168950 7:46764573-46764595 GAAGCTTCACAGTGGGAAACAGG - Intergenic
1024925444 7:54608378-54608400 TAAGTTTAACAGGTGGGACTAGG - Intergenic
1028986335 7:97011960-97011982 AAAGTTTCACAGTAGGAAGGGGG - Intergenic
1030484388 7:110148330-110148352 TAGCTTTCACAGCTGGCACCAGG + Intergenic
1032578162 7:133077798-133077820 TCAGATTCAAAGTTGGAATCAGG + Intronic
1039949878 8:42161810-42161832 TAAGTTTCAGTGTTGGAACTTGG + Intronic
1040797667 8:51303634-51303656 CAAGTTTCACAAGAGGAACCCGG - Intergenic
1043287217 8:78547932-78547954 TCATGTTCACAGTTTGAACCAGG + Intronic
1044692081 8:94891085-94891107 GAAGTAACACAGTGGGAACCTGG + Intronic
1057011118 9:91602152-91602174 TAAGTTTATCAGTTGTAACCAGG - Intronic
1057291126 9:93808112-93808134 TATTTTTCACATTTTGAACCAGG + Intergenic
1059447966 9:114350835-114350857 TAAGTTAGACACTTGGATCCTGG - Intronic
1193724382 X:85021647-85021669 TAGGTTTTATATTTGGAACCTGG - Intronic
1197032697 X:121836826-121836848 GAAGTTTCACAGTTAAAATCGGG + Intergenic