ID: 1170406741

View in Genome Browser
Species Human (GRCh38)
Location 20:16045859-16045881
Sequence CTCAGGTAGCAGTGTAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170406741_1170406746 8 Left 1170406741 20:16045859-16045881 CCTCCTTTACACTGCTACCTGAG 0: 1
1: 0
2: 0
3: 17
4: 155
Right 1170406746 20:16045890-16045912 AATCCTCTTCCATACCCTGAGGG 0: 1
1: 0
2: 2
3: 10
4: 179
1170406741_1170406745 7 Left 1170406741 20:16045859-16045881 CCTCCTTTACACTGCTACCTGAG 0: 1
1: 0
2: 0
3: 17
4: 155
Right 1170406745 20:16045889-16045911 TAATCCTCTTCCATACCCTGAGG 0: 1
1: 0
2: 0
3: 12
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170406741 Original CRISPR CTCAGGTAGCAGTGTAAAGG AGG (reversed) Intronic
900962577 1:5934652-5934674 CTCAGGCAGCAGTGTTAAGAGGG - Intronic
901595678 1:10383545-10383567 CTAAGGTAGTAGAGTATAGGTGG + Intergenic
903377115 1:22873759-22873781 CTCAGGTTGCAGTGGAAGGAGGG + Intronic
904822526 1:33255493-33255515 CTCAGGTAGAAGTGTAAGTTTGG + Intergenic
906539953 1:46577695-46577717 CTCAGGTAAAAGTGTGGAGGGGG - Intronic
907500647 1:54877398-54877420 TTCAGGCAGCAGGGTAAATGTGG - Intronic
907788651 1:57639528-57639550 CTCAGAGGGCAGTGTGAAGGAGG + Intronic
909312559 1:74171627-74171649 CTTTGGTAGCAGTGTAATGCTGG + Intronic
910360062 1:86406977-86406999 CTCATGTTGCAGTATAAGGGAGG + Intergenic
912171223 1:107101719-107101741 GGCAGGTTGCAGTGTGAAGGGGG + Intergenic
912762642 1:112382732-112382754 CTCAGGCTGGAGTGTAATGGTGG - Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
915275293 1:154784209-154784231 CTCTGGCAGCAATGTAAAGATGG - Intronic
917064464 1:171076553-171076575 CTCAGGGAGCAGTGTAATCTAGG - Intergenic
918446307 1:184620582-184620604 CTCATGTAGCATTTTGAAGGGGG - Exonic
919929664 1:202213248-202213270 CTAAGGTGGCAGTGTCTAGGGGG - Intronic
921267571 1:213436115-213436137 CTCAGGTAGAAGGGTAAAGCTGG + Intergenic
921757160 1:218871844-218871866 CTCAGGAAGTAATGTAGAGGAGG - Intergenic
922300316 1:224293400-224293422 CTCAGGAAGCACTGTTGAGGTGG - Intronic
924131596 1:240914999-240915021 ATCAGGGAGCAGTTTTAAGGGGG + Intronic
924699421 1:246436362-246436384 CTCAGGCAGCAGTTTAAAAGGGG + Intronic
924841526 1:247714663-247714685 CTCCTTTACCAGTGTAAAGGAGG - Intergenic
1063303379 10:4874139-4874161 GTCAAGTAACAGTGAAAAGGTGG + Intergenic
1063549070 10:7011826-7011848 CTCAGGCAGCAGTGAAAATGGGG - Intergenic
1067310480 10:45109003-45109025 CTCAGGTAGAAGTTTCCAGGGGG + Intergenic
1067383565 10:45797396-45797418 TGTAGGTAGTAGTGTAAAGGGGG + Intergenic
1067880613 10:50041404-50041426 TGTAGGTAGTAGTGTAAAGGGGG - Intergenic
1067891268 10:50137965-50137987 TGTAGGTAGTAGTGTAAAGGGGG + Intergenic
1069617833 10:69817582-69817604 CACAGGCAGCAGGGTAAAGCGGG - Intronic
1072776289 10:98198046-98198068 CACTGGAAGCAGTGTAGAGGTGG + Intronic
1072962597 10:99942466-99942488 CTCAGGTAGGGGTGTGATGGTGG + Intronic
1073623616 10:105073975-105073997 CTCAGGCAGCAGAGGAAAAGTGG - Intronic
1073850686 10:107614071-107614093 CCCAGGTTGCAGTGTGAATGAGG + Intergenic
1074706814 10:116140142-116140164 CTAAGGTAGAAGTGTGAAGGTGG + Intronic
1081559734 11:44202599-44202621 CCTAGGTAGCAGTGTCAAAGTGG - Intronic
1083095944 11:60251608-60251630 CTCTGGAGGCAGTGTAAAGCTGG - Intergenic
1085699194 11:78731121-78731143 CTCAGGGAGCACTGTAAAGAGGG + Intronic
1085707491 11:78799911-78799933 CTCATATAGCAGTGGAAATGAGG + Intronic
1086602092 11:88645798-88645820 TTCAGGTAACAATGAAAAGGAGG + Intronic
1087634170 11:100684855-100684877 CTCAAGTAGCTGTGTTAATGTGG + Intergenic
1088446786 11:109939286-109939308 TTCAGGTAACAGTGGAAAGCTGG + Intergenic
1090808254 11:130216349-130216371 CTGAGGTTGCAGTGTGAGGGAGG + Intergenic
1092313726 12:7387644-7387666 CTCAGGTAGCATGGCAAAAGGGG - Intronic
1093554419 12:20453507-20453529 CTGAGGTACCAGTATACAGGTGG + Intronic
1093933272 12:24975441-24975463 GCAAGGTAGTAGTGTAAAGGAGG - Intergenic
1096981942 12:55733132-55733154 CTCAGATCGCAGGGTGAAGGAGG + Intergenic
1100770934 12:97922267-97922289 CTCAGGGTGAAGTGCAAAGGAGG - Intergenic
1103311261 12:120010657-120010679 CTCAGGTTGAAGTGAAAATGGGG - Intronic
1107291049 13:38853272-38853294 CTCAGGCTGGAGTGTAATGGCGG - Intronic
1107384481 13:39893402-39893424 CTCTGGTAGCAGTGAAGAGGTGG - Intergenic
1111881259 13:93960056-93960078 CTCAGGAGGTAGTGAAAAGGTGG + Intronic
1112569160 13:100578328-100578350 CTCAGGTTGCGGTGTAGTGGTGG - Intronic
1114259492 14:21026345-21026367 CTCAGGAACCAGTCTGAAGGGGG - Intronic
1119206891 14:72801104-72801126 CACAGGTAGCTGTGAAAAGCTGG + Intronic
1120748898 14:88179205-88179227 GTCAGGTAGTAGTGGAATGGGGG + Intergenic
1121662997 14:95649848-95649870 CTCTGGAAGCAGAGTGAAGGGGG + Intergenic
1126317980 15:47391204-47391226 CTCAGAGAGCAGAGGAAAGGAGG - Intronic
1128067844 15:64775562-64775584 CGCCGGTCGCAGTGAAAAGGCGG - Exonic
1130189934 15:81724323-81724345 TTCAGGTAGAAGGGTTAAGGAGG - Intergenic
1130346266 15:83048561-83048583 CTCAGGAAGAAGTGTATAAGAGG - Intronic
1131704432 15:94977318-94977340 CTAAGGATGCAGTGAAAAGGTGG + Intergenic
1132275450 15:100559324-100559346 CTCAAGTAGCACAGTGAAGGTGG + Intergenic
1133103209 16:3491538-3491560 CTCAGGAAGCAGTGTCAAGACGG - Intergenic
1133368868 16:5232979-5233001 CTCAGGCTGCAGTGTAATGGCGG + Intergenic
1135519291 16:23161656-23161678 CTCAGGTACAAGTTTTAAGGGGG - Intergenic
1135701613 16:24637654-24637676 CTCAGGCAGCAGTGAGAATGAGG + Intergenic
1136510925 16:30737932-30737954 TTCAGGCAGCACTGTAAGGGTGG - Exonic
1138831822 16:60383528-60383550 CCCAGGCAGGAGTGTAATGGTGG - Intergenic
1140333757 16:74083539-74083561 GCCAGTTAGCAGTGTAAATGAGG - Intergenic
1149715846 17:58789170-58789192 CTCTGGTAACAGTGTAGAGCTGG - Intronic
1152471319 17:80491394-80491416 CTCGGGAAGCAGGGTGAAGGGGG + Intergenic
1153529439 18:6029969-6029991 TTCATGTTGCTGTGTAAAGGAGG - Intronic
1153588678 18:6650680-6650702 CACAAGAAGCAGTGTAGAGGAGG - Intergenic
1157820224 18:50761874-50761896 CTCAGGCAGGAGTGTGAAGGAGG + Intergenic
1159917389 18:74199055-74199077 CTCAGGCCACAGTGCAAAGGAGG + Intergenic
1167849108 19:52188650-52188672 TTCAAGTAGCAGAATAAAGGAGG + Intergenic
1168293554 19:55368653-55368675 CTCAGGTGGCAGAGTGAGGGAGG - Intronic
924967211 2:89137-89159 CTGAGGTATTAGTGTAAAGTTGG + Intergenic
926841111 2:17081286-17081308 CTCATGTAGCTGTGTAAATTTGG - Intergenic
929631586 2:43468550-43468572 CTTTGGTAGCAGTGAAAATGAGG - Intronic
930501760 2:52230003-52230025 TATAGGTAGCAGTGTAGAGGAGG - Intergenic
935648224 2:105359630-105359652 CTCAGATAGCAGTATACAGTTGG - Intronic
938752850 2:134350961-134350983 TTCAGGTAGCTGTGTACAAGGGG - Intronic
938846179 2:135211496-135211518 CTCAGGTTGCAGTGCAGTGGCGG - Intronic
939300535 2:140331736-140331758 CTTAGGCAGGAGTGTAATGGTGG + Intronic
941795725 2:169596510-169596532 CTCACTGAGCAGTCTAAAGGAGG - Intronic
942564599 2:177254001-177254023 CTGAGATAGGAGAGTAAAGGGGG - Intronic
944395981 2:199266659-199266681 CTCAGTTAACAGGGGAAAGGAGG - Intergenic
944793295 2:203155543-203155565 CTCAGGAAGCTGTGGCAAGGAGG - Intronic
947859458 2:233348426-233348448 TTAAGGGAGCAGGGTAAAGGGGG + Intergenic
1169190864 20:3658560-3658582 CTCTGGGAGCAGAGTAAAAGTGG + Intergenic
1169583915 20:7058837-7058859 CTAATGGAGCTGTGTAAAGGGGG - Intergenic
1170406741 20:16045859-16045881 CTCAGGTAGCAGTGTAAAGGAGG - Intronic
1173007506 20:39151384-39151406 CTTTGGAAGCAGTGTAATGGGGG - Intergenic
1173223213 20:41146122-41146144 CTCAGGATGCAGAGTAAACGGGG + Intronic
1176113311 20:63420471-63420493 CTCAGGAAGCAGTGGCAAGGAGG - Intronic
1182025077 22:27111463-27111485 CACAGGCAGCACTGTAATGGAGG + Intergenic
1183281825 22:36936341-36936363 CTCAGGTAGCAGGGACATGGGGG + Intronic
1185052020 22:48559068-48559090 CTCATGTAGCAGTGAGAGGGAGG - Intronic
951041519 3:17993541-17993563 CCTAGGTAGCAGTGGGAAGGTGG + Intronic
951051755 3:18101703-18101725 CTCAGGTAGAAGTGGAAAGATGG + Intronic
951515133 3:23550626-23550648 CTAAGGTAGGAGTGTAAATCTGG - Intronic
952139036 3:30458039-30458061 CTCAGGGAAGAGTGCAAAGGGGG - Intergenic
953381991 3:42478904-42478926 CTGGGGTAGAAGTGGAAAGGAGG - Intergenic
954217194 3:49131245-49131267 CTCGGGTGGCAGTGTATAGGAGG - Intronic
954441320 3:50523751-50523773 CTCAGGTGGGAGTGGAAGGGCGG + Intergenic
955232671 3:57112859-57112881 ATCAGGTGGCAGTGTCAAAGCGG + Intronic
956016489 3:64889248-64889270 CTCAAGTGGCATTGAAAAGGCGG + Intergenic
956486933 3:69732889-69732911 CTTTGGTAGCTATGTAAAGGAGG + Intergenic
960581492 3:119282872-119282894 CTCATGGAGCAGTGAAAAGGGGG + Intergenic
962573848 3:136737685-136737707 TCTAGGTAGCAGTATAAAGGAGG + Intronic
963968758 3:151405283-151405305 CTCAGGTAGCAATGTAGAGATGG + Intronic
966462851 3:180196841-180196863 GTGAGGTCGCAGTGTGAAGGTGG + Intergenic
967148776 3:186629041-186629063 TTTAGGTAACAGTGAAAAGGAGG - Intergenic
968765733 4:2468274-2468296 CTCAGGCAGCAGGGACAAGGTGG + Intronic
970023964 4:11601240-11601262 CTCAGGGTGCAGTGAAAGGGAGG + Intergenic
974284870 4:59851409-59851431 TTCTGGTTGCAGTGTGAAGGTGG + Intergenic
974726137 4:65800876-65800898 TTCAAGTAGCAGAGTAAATGAGG + Intergenic
977528298 4:98170753-98170775 CTCAGGCTGCAGTGTGAAGATGG - Intergenic
978571660 4:110144602-110144624 GTTAGGTACCAGTGTAAAGTTGG - Intronic
981225195 4:142285674-142285696 CTCACGTATCAGAGTAAAGTTGG + Intronic
988024371 5:25665984-25666006 ATCAGGAAGCAGTGCAAAGGGGG + Intergenic
988446154 5:31288065-31288087 CACAGGTTGCAATGTAAATGAGG - Intronic
989220020 5:38947676-38947698 CTCAGGTAAAGGTGAAAAGGTGG + Intronic
993399510 5:87431600-87431622 CTCTGGTGGCAGTGTATAGAAGG - Intergenic
999094673 5:148967199-148967221 CCCAGGTAGGAGGGTTAAGGGGG + Intronic
1000374829 5:160569605-160569627 CGCAGGTGGCATTGTACAGGAGG + Exonic
1001152554 5:169244965-169244987 GTCAGGTAGAAGTGTGCAGGCGG - Intronic
1001330854 5:170761362-170761384 CTCAGCCAGCAGTGTGAACGTGG + Intergenic
1002827700 6:788192-788214 CTCAGGAAGGAGTGAACAGGTGG + Intergenic
1004242969 6:13944322-13944344 CTCAGGTAGGCATGTTAAGGAGG + Intronic
1007240295 6:40420026-40420048 CTCCGATTGCATTGTAAAGGAGG - Intronic
1008818951 6:55608144-55608166 CTAAGGAAGCAGTGTAGAGTGGG - Intergenic
1011700293 6:89949319-89949341 CACAGGTAGCAGTCTCAAGCTGG + Intronic
1011865061 6:91815611-91815633 GTCAGGCAGAAGTGTAGAGGAGG + Intergenic
1011978754 6:93343782-93343804 GGCAGGCAGCAGTCTAAAGGAGG + Intronic
1013503804 6:110779069-110779091 CTGATACAGCAGTGTAAAGGTGG - Intronic
1016404513 6:143716290-143716312 CTCAGGTAGGAGTATTTAGGTGG + Intronic
1016791229 6:148068933-148068955 CGCACGTAGCAGTGTAAGGCCGG - Intergenic
1017638397 6:156466130-156466152 CCCAGGAAGCAGGGTATAGGTGG - Intergenic
1018616823 6:165694577-165694599 CTCAGGTAGCAGAGAGATGGGGG - Intronic
1022235390 7:28455745-28455767 CCCAGGGGACAGTGTAAAGGAGG + Intronic
1023895194 7:44427319-44427341 CTCAGGAAGCAGTGTGAACAGGG + Intronic
1024354026 7:48396127-48396149 CTGAGGTAGCAGTGGAGGGGAGG - Intronic
1024728386 7:52227342-52227364 CTCAGGTAGTGGTTTAAAGAGGG - Intergenic
1028730883 7:94147035-94147057 TTCTGGAAGCAGTGTAGAGGAGG - Intergenic
1032734328 7:134677043-134677065 CTAAGGTTGCAGTGTGAGGGTGG + Intronic
1036389205 8:8310084-8310106 CTCTGGTAGCAGTTTGATGGAGG - Intergenic
1037748515 8:21664839-21664861 CCCAGGTAACAGTGGAAAGCTGG + Intergenic
1038579961 8:28739367-28739389 CCCAGGTTGGAGTGTAATGGTGG + Intronic
1038709954 8:29934110-29934132 GACAGGTAGCATTGTAAAAGAGG + Intergenic
1040477033 8:47787758-47787780 CTGAGGTAGCAGTGTGCTGGGGG + Intronic
1040860291 8:51991708-51991730 CCCAGGCTGCAGTGTAATGGTGG - Intergenic
1041631135 8:60088494-60088516 CTCAGTTAACACTTTAAAGGAGG - Intergenic
1046957401 8:120075828-120075850 CTGAGGTCACAGTGTAAAGGAGG - Intronic
1049309546 8:141926138-141926160 GTCAGGTAGCAGTTTAATAGTGG + Intergenic
1049776241 8:144406741-144406763 ATCAGGTAGCAGTGCAGAGCAGG - Intronic
1052436784 9:28439771-28439793 CTCAGGTAGCAGTTTGAAAATGG + Intronic
1056057744 9:82845225-82845247 CCCAGGTAGCATTGAGAAGGAGG - Intergenic
1057433909 9:95021853-95021875 CTCAGTGGGAAGTGTAAAGGTGG + Intronic
1057885478 9:98826613-98826635 CCCAGGTGGCAGAGCAAAGGAGG + Intronic
1059154955 9:111981349-111981371 CTTAGGGAGGAGTGGAAAGGAGG - Intergenic
1059717909 9:116930849-116930871 CTCAGGAAGCAATCTAATGGAGG - Intronic
1060993614 9:127862754-127862776 CTCAGGGAGGAGTGTGGAGGAGG - Intergenic
1195722955 X:107884563-107884585 CTCAGGCAGCAGAGTAGAGTGGG - Intronic
1195969820 X:110461127-110461149 CTGAGGGAGAAGTGAAAAGGAGG - Intergenic
1197131301 X:123008493-123008515 CTCAGGTTGAGGAGTAAAGGAGG + Intergenic
1199950196 X:152700426-152700448 CTCAGGTCACAGAGTAGAGGGGG + Intronic
1199959480 X:152768035-152768057 CTCAGGTCACAGAGTAGAGGGGG - Intronic