ID: 1170407133

View in Genome Browser
Species Human (GRCh38)
Location 20:16050200-16050222
Sequence CTGGCCCCTGTCTGCTTTCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 373}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170407130_1170407133 18 Left 1170407130 20:16050159-16050181 CCAGGGTCACAGTGGCTTGATTG 0: 1
1: 0
2: 0
3: 10
4: 171
Right 1170407133 20:16050200-16050222 CTGGCCCCTGTCTGCTTTCTTGG 0: 1
1: 0
2: 3
3: 44
4: 373
1170407129_1170407133 19 Left 1170407129 20:16050158-16050180 CCCAGGGTCACAGTGGCTTGATT 0: 1
1: 0
2: 0
3: 13
4: 172
Right 1170407133 20:16050200-16050222 CTGGCCCCTGTCTGCTTTCTTGG 0: 1
1: 0
2: 3
3: 44
4: 373
1170407128_1170407133 20 Left 1170407128 20:16050157-16050179 CCCCAGGGTCACAGTGGCTTGAT 0: 1
1: 0
2: 1
3: 14
4: 135
Right 1170407133 20:16050200-16050222 CTGGCCCCTGTCTGCTTTCTTGG 0: 1
1: 0
2: 3
3: 44
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170407133 Original CRISPR CTGGCCCCTGTCTGCTTTCT TGG Exonic
900186135 1:1334123-1334145 CTGGCCTTTCTCTGCTTCCTGGG + Exonic
901152498 1:7113235-7113257 CTGGCCCCAGGGTGCTGTCTAGG - Intronic
902814411 1:18908016-18908038 CTTGCCTCTGTGAGCTTTCTAGG - Exonic
902821402 1:18945466-18945488 CTGCCGCCTGTTTGCTGTCTTGG - Intronic
902851436 1:19160875-19160897 CTGAACTCTGTCTGCTTACTAGG + Intronic
905271540 1:36790842-36790864 CTAGTCCCTGTCTCCTGTCTGGG + Intergenic
905975726 1:42172308-42172330 CTGTCTCCTGTCTCCTTTATGGG + Intergenic
905999390 1:42411031-42411053 CTGGCCCATGTCTTCTTTATGGG - Intronic
906227848 1:44136701-44136723 CTGTGCACTGGCTGCTTTCTGGG - Intergenic
906412416 1:45589413-45589435 CTGCACCCAGTCTGGTTTCTGGG + Intronic
909367642 1:74846479-74846501 CTGGCATCTGTCTGGCTTCTGGG + Intergenic
912738471 1:112171657-112171679 CTGGGCCCTGAAGGCTTTCTGGG - Intergenic
913212804 1:116595381-116595403 CTGGCCTCTGCCTTCTTTCAGGG - Intronic
914406335 1:147377437-147377459 TGGGCCACTGTTTGCTTTCTGGG + Intergenic
915253750 1:154609491-154609513 CTGGGCTCTGTCTTCCTTCTGGG + Intronic
915895795 1:159809715-159809737 CTGACCCCTGCCAGCTTGCTGGG - Intronic
915922577 1:159987777-159987799 CTGGGCCCTGAGTACTTTCTGGG + Intergenic
920118539 1:203638312-203638334 CTGCCACCTGTCTGCTTTCCTGG + Intronic
920396181 1:205647796-205647818 CTGCTCCCTGTCTGCCTCCTCGG + Intergenic
920417105 1:205806194-205806216 CTGTCCCCTGCCTGCTGTCAGGG - Intronic
921180314 1:212626574-212626596 CTGGCCACCCTCTGCTGTCTCGG - Exonic
922159198 1:223066091-223066113 CTGGCCTCTTGCTGATTTCTTGG + Intergenic
922862409 1:228830534-228830556 CTGGGCTCTGACTGCTTTCCAGG + Intergenic
922918429 1:229278159-229278181 CTGGCCCCTTTCTTCTTTTCAGG + Intronic
922957399 1:229614901-229614923 CTGCCTCCTGCCTGCTTTTTTGG - Intronic
923728952 1:236532226-236532248 CAGGCCCCTGGCTGGTGTCTGGG - Intronic
923764996 1:236884892-236884914 CTGGCCTTTGACTGGTTTCTGGG - Intronic
923873450 1:238020893-238020915 TTTTCCCCTGTCTGTTTTCTGGG - Intergenic
924091433 1:240505392-240505414 CTGAGCCCTGTCTTCTTTCTAGG + Intronic
924519602 1:244794584-244794606 TTGGCCCCAGTCTGCTAACTGGG + Intergenic
1063185468 10:3646588-3646610 CTGGGCTCTGTCTGGTTTCCTGG + Intergenic
1066281757 10:33924517-33924539 CTTGCTCCAATCTGCTTTCTAGG + Intergenic
1066447648 10:35498388-35498410 CTGGCCCTTGGCTGGTATCTGGG - Intronic
1066648629 10:37635217-37635239 CTGTCCCCCTTCTGCTCTCTTGG + Intergenic
1067514573 10:46927044-46927066 CTGGCCCTTGGCTGGTGTCTGGG - Intronic
1067647687 10:48124769-48124791 CTGGCCCTTGGCTGGTGTCTGGG + Intergenic
1068104950 10:52602940-52602962 CTGTCCCATGACTGCTTTCCTGG - Intergenic
1069687405 10:70327091-70327113 CTTGCCCCTGTCTGCAGTCTTGG + Intronic
1069909780 10:71751990-71752012 CTGGCTCCTGCCTTCTTGCTTGG - Intronic
1070483961 10:76912061-76912083 CTGGACCCTGGCTGGTCTCTTGG - Intronic
1070492605 10:76991814-76991836 TTGGCCAATGTCAGCTTTCTGGG - Intronic
1073140495 10:101243988-101244010 TTGGTCCCTGCGTGCTTTCTGGG - Intergenic
1073149009 10:101299004-101299026 CTGGCCTCTGGCTTCCTTCTGGG + Intergenic
1073191136 10:101651295-101651317 CTGGCCTCTGTTTTCTCTCTGGG - Intronic
1073276472 10:102315829-102315851 CTTGTCCCTTTCTGCTTTCCAGG + Intronic
1077210934 11:1370668-1370690 CTGGACCCTGTGTGCTGTCATGG + Intergenic
1077530845 11:3094081-3094103 CTGGGCCCTGTCTGTGTTCCGGG + Intronic
1079231324 11:18651311-18651333 CTGGTTCCTGTGTGCTTCCTTGG - Intergenic
1080100802 11:28456971-28456993 CTGTACCCTGTCTGAATTCTTGG + Intergenic
1080183067 11:29446740-29446762 CTCCCTCCTGTCTGCTTTCATGG - Intergenic
1080758625 11:35226391-35226413 CTGGCCCCTGTGTTCTTTGGAGG - Intronic
1084953774 11:72680726-72680748 CTGCCCCCAGTCCCCTTTCTGGG + Intergenic
1085280412 11:75326268-75326290 CAGGCCCTGGGCTGCTTTCTGGG - Intronic
1085853407 11:80148251-80148273 CAGGGTGCTGTCTGCTTTCTCGG + Intergenic
1086962369 11:92991584-92991606 CTGGCCCTTGACTGTTATCTGGG - Intergenic
1088835843 11:113577495-113577517 CTGCTCCCTGTCTTGTTTCTTGG - Intergenic
1089111538 11:116061684-116061706 CAGTCCCCTGTCTGCTCTCGGGG - Intergenic
1089294658 11:117460434-117460456 CTGGGCCCTCTCTTCTTTCCTGG - Intronic
1089399669 11:118157193-118157215 CTCACTCCTCTCTGCTTTCTAGG + Intergenic
1089505380 11:118958669-118958691 CTGGCCCCTGCCTGCCTCATGGG - Intergenic
1089718788 11:120392072-120392094 CTGGCCCCTGTCTACTTCTGTGG + Intronic
1091046372 11:132329409-132329431 CTGGCCCCTCTCTGCTGCCTAGG - Intronic
1091729126 12:2866771-2866793 CTAGCCCCTGACAGCTATCTAGG - Intronic
1093681682 12:22009952-22009974 CTGTCTCCTGGCTGCTTTCATGG - Intergenic
1093927463 12:24923243-24923265 TTGGCCCTTGTCTGGTGTCTGGG - Intronic
1094314878 12:29128747-29128769 CTGGCCTCTCTCTCCTTTCTGGG - Intergenic
1096198707 12:49665778-49665800 CTGGCCCCAGGCTGCTGGCTGGG - Intronic
1096779066 12:53981897-53981919 CTGGCCCCTTTCTCCCTTCCCGG - Intergenic
1096833990 12:54336619-54336641 CTGCCCCCTGTGGGCCTTCTCGG - Intronic
1097217076 12:57422540-57422562 CTGGCCCCTGTCAGCCTTTCTGG - Intronic
1097499872 12:60388673-60388695 CTGGACCCTCCCTGCTTTATGGG - Intergenic
1097697998 12:62793425-62793447 CGGCCCTCTGTTTGCTTTCTCGG - Intronic
1099312066 12:81038740-81038762 CTTGCCCCTTACTGATTTCTGGG - Intronic
1101143294 12:101818038-101818060 CTGGCCCCTGCCTGCCTCTTCGG + Intronic
1101777195 12:107806004-107806026 AGGGCCCCTGCCTGCCTTCTAGG - Intergenic
1102517558 12:113460019-113460041 CGGGTCCCTGAATGCTTTCTGGG - Intergenic
1102539245 12:113606615-113606637 CTGGCCCCTGTCTACCTTTCCGG - Intergenic
1102928225 12:116842953-116842975 CTGGCTGCTTCCTGCTTTCTCGG + Intronic
1103707669 12:122887385-122887407 CTGGTCCCTGACTGCCTTTTGGG + Intronic
1104225126 12:126824020-126824042 CTGGCACCTGCTTGGTTTCTAGG - Intergenic
1104464959 12:128982813-128982835 CTTGCCCTTGTCTGCCTCCTGGG - Intronic
1105216050 13:18286011-18286033 CTGGCCTCTGCCTTCTTTCAGGG - Intergenic
1105284644 13:18994196-18994218 CTTGCCCTTTTCTGCCTTCTTGG - Intergenic
1105284648 13:18994230-18994252 CTGGCCTCTGTCTTCTCTCCTGG - Intergenic
1106824925 13:33509935-33509957 CTGGCCCTTCACTGCTTTCTGGG - Intergenic
1107226785 13:38059673-38059695 CATGCACCTGTCTGCTTCCTTGG - Intergenic
1109788898 13:67221702-67221724 TTGGCCCCTGTGTGGTTTTTTGG - Intronic
1110173921 13:72534425-72534447 CTGGCTCCTCTCTGCTCCCTTGG - Intergenic
1110566916 13:76966363-76966385 CTGGCCCTTGGCTGGTGTCTAGG - Intergenic
1110649410 13:77925863-77925885 CTCGCCTCTGGCTGCTTTCGTGG - Intergenic
1110917688 13:81043987-81044009 CTGGCATCTGTTTGGTTTCTGGG + Intergenic
1113167794 13:107462604-107462626 CTGGCCCCTGCCTGGCTCCTGGG + Intronic
1113269335 13:108655660-108655682 CCGGCTCCTGGCTGCTTTCATGG - Intronic
1113460429 13:110478616-110478638 CTGTGCCCTGCCTGCCTTCTGGG - Intronic
1115009276 14:28524549-28524571 CTTGCCCATGTCTATTTTCTTGG - Intergenic
1115021327 14:28684474-28684496 CTTCCTCCTGTCTGCTTTCATGG - Intergenic
1115545834 14:34464083-34464105 ATGGTCCCTGTTTGCTGTCTAGG - Intergenic
1116287197 14:42988246-42988268 CTGCCTCCAGGCTGCTTTCTTGG - Intergenic
1116564851 14:46432196-46432218 CTCCCTCCTGTCTGCTTTCACGG + Intergenic
1118550748 14:66947100-66947122 CTGGCTCCTCCCTGATTTCTAGG + Intronic
1119381579 14:74232758-74232780 CTGGCCCCCACCTGCTTTCTGGG + Intergenic
1119381592 14:74232796-74232818 CTGGCCCCCACCTGCTTTCTGGG + Intergenic
1119381605 14:74232834-74232856 CTGGCCCCCACCTGCTTTCTGGG + Intergenic
1119381618 14:74232872-74232894 CTGGCCCCCACCTGCTTTCTGGG + Intergenic
1119529651 14:75350819-75350841 CTGGCCCCTTTCTGCTCACAGGG - Intergenic
1120460121 14:84784493-84784515 CTAGCCCCTGACTGCTTTTCTGG - Intergenic
1121685159 14:95830337-95830359 CGGGCCCCTGCCTGCTCTCAGGG + Intergenic
1121902685 14:97708379-97708401 CTGTCCCCTGGCTGTTTTATTGG + Intergenic
1122063897 14:99158616-99158638 CTGGCCACTGTCTCCATTCTGGG - Intergenic
1122138386 14:99647484-99647506 CTGTCCCCTGGCAGGTTTCTTGG + Intronic
1122383177 14:101324740-101324762 CTGCCCCCTGTCTCCTGTCCAGG + Intergenic
1122683921 14:103489330-103489352 CTGGCCCCTGCCATCTCTCTAGG - Intronic
1124630072 15:31331199-31331221 CTGGGCCCTTTCTGGGTTCTGGG + Intronic
1125584326 15:40809579-40809601 CTGGCTCCTGACTGCCCTCTTGG + Intronic
1125833041 15:42729670-42729692 CTGCCAACTGCCTGCTTTCTGGG - Intronic
1125875437 15:43140184-43140206 CTGCCCCCAGTCATCTTTCTGGG - Intronic
1128472795 15:67968975-67968997 CTTGCCACTGCCTCCTTTCTGGG - Intergenic
1128521914 15:68380969-68380991 GTTGCCCCTACCTGCTTTCTGGG + Intronic
1128780792 15:70357474-70357496 CTGACCCCTGCTTTCTTTCTGGG - Intergenic
1129718300 15:77864468-77864490 CTGGCCCTTCTGTGCTGTCTGGG - Intergenic
1131390385 15:92043333-92043355 TTGGCCCCTGTTTGTTTTCATGG - Intronic
1132184617 15:99792392-99792414 CTGCCCCCTGGCTGTGTTCTAGG - Intergenic
1132485704 16:189735-189757 CTGTCCCCTGCCTGCGTCCTGGG - Intronic
1132499399 16:278676-278698 CTGGTCTATTTCTGCTTTCTTGG + Intronic
1132604134 16:786629-786651 CTGGCTCCTGACTGATTCCTTGG - Intronic
1132781961 16:1632109-1632131 CTGTCTCCTTTCTCCTTTCTCGG + Intronic
1133861554 16:9599987-9600009 CTGGCCCCTACATGCTCTCTAGG + Intergenic
1134361831 16:13538311-13538333 CTAGTCCCTGCCTCCTTTCTCGG + Intergenic
1134561365 16:15212942-15212964 TTCTCCCCTGTCTCCTTTCTTGG + Intergenic
1134791017 16:16989374-16989396 CTGGCCCCTTTCTGCCCTCATGG + Intergenic
1134921903 16:18124562-18124584 TTCTCCCCTGTCTCCTTTCTTGG + Intergenic
1136419435 16:30122867-30122889 GGGGCCCCTGAGTGCTTTCTGGG - Intronic
1137294191 16:47074605-47074627 CTGGCCACTGCCTCATTTCTTGG - Intergenic
1137554017 16:49458951-49458973 TTAGCCTATGTCTGCTTTCTAGG + Intergenic
1139041868 16:63007084-63007106 TTGCCCCCAGTCTGCATTCTTGG + Intergenic
1139097934 16:63728044-63728066 CTAACACCTGTGTGCTTTCTGGG + Intergenic
1139405351 16:66713305-66713327 CTGGCAACTGCCTGATTTCTTGG - Intergenic
1139434524 16:66928338-66928360 CTGGCCCCTGGCTGCCTGCAGGG - Intergenic
1139651631 16:68365198-68365220 CTGGCTCCTGGCTGGATTCTGGG + Intronic
1139744835 16:69066001-69066023 CTGGCCCCTTTCTGCTTCCCCGG + Intronic
1141174779 16:81711766-81711788 CTGGCCTTTGTGTGGTTTCTCGG + Intergenic
1141611259 16:85182322-85182344 CTGGAGCCTGCCTGGTTTCTTGG - Intronic
1141674959 16:85513023-85513045 CTTGCCGCTGTCTGCTTTCTCGG + Intergenic
1142232138 16:88904998-88905020 CTTGTCACTTTCTGCTTTCTCGG - Intronic
1143065925 17:4247226-4247248 CTTCCCCCTCTCTGCTCTCTAGG + Intronic
1143341963 17:6218654-6218676 CTGGGCCCTGCCTGCTTCCCCGG + Intergenic
1143386129 17:6531714-6531736 CTGCCCCCTCTCTCCTTGCTGGG + Intronic
1143405786 17:6676519-6676541 CTCTCCCCTGTTTGCTCTCTGGG + Intergenic
1143735820 17:8911478-8911500 GTGGCCCCTGGCTGCATCCTGGG + Exonic
1143858863 17:9873203-9873225 CTAGCCTCTGTCCACTTTCTGGG - Intronic
1143889770 17:10093900-10093922 CTGAGCCATGTCTGATTTCTTGG - Intronic
1144214305 17:13041615-13041637 CTAGCCCTTCTCTGCTCTCTTGG - Intergenic
1144629175 17:16861662-16861684 CTGGCCCATGGCTCCTTTCTCGG - Intergenic
1146479997 17:33197521-33197543 CTGGGCCCTGTCAGCTGGCTTGG - Intronic
1146697428 17:34920262-34920284 CTCCCTCCTGGCTGCTTTCTTGG - Intergenic
1149455587 17:56785671-56785693 CTGGCCCCTGCCTGCCTCCCAGG + Intergenic
1149534791 17:57424733-57424755 TGGGCCCCTGTCTGCCTTCTCGG + Intronic
1149998801 17:61419166-61419188 TTGGTCCCTGACTTCTTTCTTGG + Intergenic
1151593864 17:75064957-75064979 CTTGTCCCTGTCTGCTTTCCTGG + Exonic
1152310187 17:79545295-79545317 CTGGCCCCTTCCTTCTTTCCTGG - Intergenic
1152539086 17:80965893-80965915 CCGGACCCGGGCTGCTTTCTCGG - Exonic
1152553991 17:81044048-81044070 CTTGCCACTGTCTGCTTTCCTGG + Intronic
1155584166 18:27345669-27345691 CTGGCTCCTGACTGCCTGCTTGG + Intergenic
1155961387 18:31998292-31998314 CTGCCCCCAGTATGCTATCTGGG + Intergenic
1156387824 18:36622436-36622458 GTTGCCCCTAACTGCTTTCTTGG + Intronic
1157500902 18:48189995-48190017 CTGGCTCCTGCCTGCTGTCGTGG + Intronic
1157574124 18:48732374-48732396 CTGGTCCCCTTCTGCCTTCTCGG - Intronic
1158514205 18:58117699-58117721 CTGCCCCCAGCCTGGTTTCTGGG + Intronic
1158514419 18:58119382-58119404 CTGCCCCCAGCCTGGTTTCTGGG + Intronic
1158529058 18:58241736-58241758 CTGGAACCTGTCTCTTTTCTTGG + Intronic
1159357821 18:67359142-67359164 CCCGCCCCTGGCTGCTTTCAAGG - Intergenic
1159921594 18:74231765-74231787 CTGGTCCCTCTCTGTTTTCCTGG + Intergenic
1160070126 18:75621230-75621252 GAGGCCACTGGCTGCTTTCTGGG - Intergenic
1160339419 18:78075066-78075088 CTGTTGTCTGTCTGCTTTCTAGG - Intergenic
1160442701 18:78904385-78904407 CTGACTCCTGGCTGGTTTCTCGG - Intergenic
1161197150 19:2993359-2993381 CAGGCTCCTGCCTGCTTCCTGGG + Intronic
1161301259 19:3544174-3544196 CTGGCTCCTGTCTGCCTGCGGGG - Intronic
1161341492 19:3745591-3745613 CTTGCCCCTATCTGTCTTCTAGG - Intronic
1161624410 19:5317741-5317763 CTGGCCCCTTACTAATTTCTAGG - Intronic
1161929008 19:7323647-7323669 CTGGCCTCTGTCGGGATTCTTGG - Intergenic
1161961115 19:7523601-7523623 CTGGCCCCGTGCTGCTTTCTAGG - Intronic
1162931051 19:13958008-13958030 CTGGCCCCTGGCTTATTTGTGGG - Intronic
1164484241 19:28641140-28641162 CTGGTCCCTATCTGAGTTCTCGG - Intergenic
1164598684 19:29546922-29546944 CTGGCCCCTGGCTACTTGCAAGG - Intronic
1164771573 19:30813637-30813659 CTGCCCCCTGCCAGCCTTCTAGG - Intergenic
925016651 2:532387-532409 CTTTCCACTGTCTGCTTTCCTGG - Intergenic
925792545 2:7507122-7507144 CTGGCCACTGTTTTCTTACTAGG + Intergenic
926772975 2:16394316-16394338 CTTGCCCCTCTCTGGGTTCTGGG + Intergenic
927741565 2:25573990-25574012 CTGTACCCTCTCTGCTATCTTGG - Intronic
927872408 2:26631939-26631961 CTGGCCCCTGGGTGCTTCCCTGG + Intronic
927883861 2:26706730-26706752 CTGTCCCCTGCCTGCTTCCAGGG + Intronic
927943125 2:27118395-27118417 GTAGCCGCTGTCTCCTTTCTTGG - Intronic
928033625 2:27801718-27801740 CTGGCACCTGCGTGGTTTCTGGG + Intronic
928411314 2:31056311-31056333 CTGTCCCCACTCTCCTTTCTCGG + Intronic
929096488 2:38267461-38267483 CTGCCCCAGGTCTGCTTTCACGG - Intergenic
929267378 2:39933281-39933303 CTAGGCTCTGTTTGCTTTCTTGG + Intergenic
929373081 2:41250407-41250429 CTGGTGCGTGTCAGCTTTCTTGG + Intergenic
930363993 2:50416282-50416304 CTTCCTCCTGTCTCCTTTCTTGG - Intronic
931152826 2:59594097-59594119 CTTGACCCTGTCTTCTCTCTTGG - Intergenic
931522953 2:63119278-63119300 CAGGCCCCTCTGTCCTTTCTAGG + Intergenic
932396932 2:71454845-71454867 CTGGGCCCTGGCTGCTCTCCAGG + Intronic
933821362 2:86115162-86115184 CTGGCCCTTGGCTGCCATCTGGG - Intronic
934298275 2:91760714-91760736 CTGGCCTCTGCCTTCTTTCAGGG + Intergenic
934473676 2:94578142-94578164 CTGGCCCCTGTGCCCTTTCTGGG - Intergenic
935122477 2:100195045-100195067 CTGGCCCCTGGGTGTTTACTGGG - Intergenic
935504316 2:103881366-103881388 CAGGATCCTGTCTGCTTACTTGG + Intergenic
935758986 2:106301067-106301089 GTAGCCACTGTCTGCATTCTGGG - Intergenic
935812507 2:106812588-106812610 CTGGCCCTTGGCTGATGTCTGGG - Intronic
936029969 2:109063020-109063042 ATGTCCCCTTTCTCCTTTCTTGG + Intergenic
936250051 2:110861467-110861489 CTGCTCCCTGGCTGCTTTCAGGG + Intronic
936644076 2:114348870-114348892 CTTGCCCCTGTGGGTTTTCTTGG + Intergenic
937204350 2:120225924-120225946 ATGGCCTCTGTCTCCTTCCTGGG + Intergenic
939222234 2:139317160-139317182 CTGGTCCCTGGATGATTTCTGGG + Intergenic
941300453 2:163794835-163794857 CTGGCACCTGTCCTCTTTCTTGG + Intergenic
942045102 2:172095424-172095446 CTGGAGGCTGTCTGCGTTCTTGG + Intergenic
942106672 2:172640564-172640586 CTGGCAGCTGTTTGCTTCCTTGG + Intergenic
942114202 2:172712370-172712392 CTGGGCTCTTTCTGCTCTCTTGG + Intergenic
944053294 2:195495956-195495978 CTGGCCCCTGGCTGCTTCTCTGG + Intergenic
944285984 2:197950282-197950304 CTTGCCCCTCTCAGCTTTGTGGG + Intronic
945318936 2:208399333-208399355 CTGGCCCTTGGCTGGTTTCTGGG + Intronic
945943436 2:215972121-215972143 CAGGACCCTGTCTCCTTCCTAGG + Intronic
946059121 2:216926680-216926702 CTGACTCCTCTCTGCTCTCTGGG + Intergenic
946641596 2:221789562-221789584 CTGGCCAATGGCTGCTTGCTGGG + Intergenic
947096107 2:226568628-226568650 CTGGCACCTGTTTGGCTTCTGGG - Intergenic
947795455 2:232891276-232891298 CCGGGCCCTGTCAGCTTTCTAGG - Intronic
948600466 2:239105105-239105127 GTGGCCCCTTCCTGCTTTCTTGG + Intronic
948861219 2:240753479-240753501 CCAGCCCCTGTCTGATTTGTGGG - Intronic
948920252 2:241063006-241063028 GTGGCCACTGCATGCTTTCTCGG + Intronic
948982633 2:241502237-241502259 CTGGCCTCTTTATACTTTCTGGG - Intronic
1168852639 20:987211-987233 CTGGCCCCTGGCCCCTGTCTGGG + Intronic
1168891749 20:1299538-1299560 CTGGCACCTGACTGCCCTCTGGG + Intronic
1170129320 20:13001617-13001639 CAGGCCTCTTTCTGGTTTCTTGG + Intergenic
1170407133 20:16050200-16050222 CTGGCCCCTGTCTGCTTTCTTGG + Exonic
1172160650 20:32865819-32865841 CTGGCACCAGTCATCTTTCTAGG - Intronic
1172225529 20:33302824-33302846 CTGGCCCCTGCCTGCCTTCCTGG - Intronic
1173581725 20:44151765-44151787 CTGGCCCTGGGCTGCCTTCTCGG + Intronic
1174347180 20:49938869-49938891 CTGGACCCTCTGTGCTCTCTTGG + Intronic
1174948382 20:55014334-55014356 GTGGTCCCAGTCTGCTTTCGTGG - Intergenic
1175924728 20:62466115-62466137 CTGGCCCCTGGCAGCTCTGTCGG - Intronic
1176054117 20:63135191-63135213 CTGGGCCCTGCCTCCTCTCTGGG - Intergenic
1176163906 20:63663011-63663033 CTGGGCCCTGTCTTCTGACTCGG + Intronic
1177232255 21:18337351-18337373 CAGGCCCCTGGCTTATTTCTGGG - Intronic
1177761083 21:25402708-25402730 CTCGCTCCTGGCTGCTTTCATGG - Intergenic
1178175060 21:30087263-30087285 CTGGGCCATGCCTGCTTCCTGGG + Intergenic
1178383780 21:32133517-32133539 CTGGCCCCTTCCTTCTGTCTTGG - Intergenic
1179465483 21:41568948-41568970 GTGCTCCCTGTCTGCTTTATAGG - Intergenic
1179553647 21:42159225-42159247 CTGGCCCCTGGCTGCCTCGTTGG + Intergenic
1179791069 21:43756317-43756339 CGGGCCCCTGTTTGCCATCTCGG + Exonic
1180879352 22:19192893-19192915 CTAGCACCTGTCAGCCTTCTAGG + Intronic
1182517734 22:30868568-30868590 CTGGCCACTGTCTTCCTTCTGGG + Intronic
1183513668 22:38250777-38250799 CTGGCTCGGGTCTGCTCTCTGGG - Intronic
1183763648 22:39849015-39849037 GTGGCCCAGGTCTGTTTTCTAGG + Intronic
1184369074 22:44071074-44071096 CTGGCCCCAGGATGCTCTCTGGG - Intronic
1184768789 22:46586316-46586338 CTGGCGCCTCCCTGCTTTCCAGG + Intronic
949901826 3:8821499-8821521 CTGGTCCCTGCCTGCCTTCCTGG + Intronic
950272891 3:11633370-11633392 CTGGCCCTCCTCTGCCTTCTTGG - Intronic
950359914 3:12442890-12442912 CTGGCACCTGTCGGGTGTCTTGG - Intergenic
950460654 3:13120380-13120402 TTGGCCCGTGTCTCCCTTCTGGG - Intergenic
950872996 3:16245427-16245449 CTGGGCCCTGTTTCCGTTCTAGG - Intergenic
950965477 3:17143024-17143046 CTGGCCCCAGCCTGCTCACTTGG - Intergenic
950976059 3:17246877-17246899 CTGGCCCTTGACTGATTCCTGGG + Intronic
952153008 3:30612903-30612925 CTTGCCACAGTCAGCTTTCTAGG + Intronic
953742465 3:45549297-45549319 CTGGCCCCTGTCTTCCCTTTTGG - Exonic
953851031 3:46465491-46465513 GAGGTCCCTGTCTGTTTTCTGGG - Intronic
954458038 3:50610622-50610644 CTTCCTCCTGTCTGCATTCTGGG - Intronic
955363582 3:58293222-58293244 CTGTCCCCTTTCTGCTCTCCCGG + Intronic
959193851 3:103151616-103151638 CTGGCCCCTCTCTATTTTCAAGG - Intergenic
959689057 3:109178681-109178703 CTGGGCTTTCTCTGCTTTCTGGG - Intergenic
960033406 3:113078223-113078245 CTGGCCCATGTTTGCCTTCAAGG + Intergenic
960308725 3:116094343-116094365 TGGACCCCTGTCTGCTATCTTGG + Intronic
960484695 3:118237772-118237794 CTGTCCCGTGTCTCCTTTCAGGG + Intergenic
962046745 3:131768238-131768260 CTGGGCTCTGACAGCTTTCTGGG - Intronic
962273803 3:133997283-133997305 CTGCCCCCAGTCTCCTTGCTAGG + Intronic
962745787 3:138396505-138396527 CTGACCCCTTTCTGCCCTCTGGG - Intronic
963104309 3:141632969-141632991 CTGCCTCCTGCCTGCCTTCTGGG + Intergenic
965799551 3:172477519-172477541 CTGCCCCCTGTCTGGTTTCAAGG + Intergenic
967519812 3:190416437-190416459 CTGCCTCCTGGCTGCTTTCATGG + Intergenic
968438774 4:610868-610890 CTTGCCCCAGGCTGTTTTCTAGG - Intergenic
968950136 4:3687081-3687103 CTGGCCCATTTCAGCTTTCTTGG - Intergenic
969025606 4:4169743-4169765 CGGGCCCCTTCCTTCTTTCTGGG + Intergenic
969228573 4:5814667-5814689 CTGGTCCCTGTCTTCTCTCATGG + Intronic
971052117 4:22873280-22873302 CTGTCCACTGTCAGCTTCCTGGG + Intergenic
971965163 4:33544769-33544791 CTGACTCCTGTCTCCTTGCTTGG + Intergenic
973058582 4:45691072-45691094 GTGTACCCTGTCAGCTTTCTAGG - Intergenic
974172296 4:58281840-58281862 CTGCCTCCTGGCTGCTTTCATGG - Intergenic
975907746 4:79235020-79235042 CTGGCCCCTTTCTCCTTTCTTGG - Intronic
976945235 4:90757624-90757646 CTGGCACTTGTCTGCTTCCTTGG - Intronic
979867700 4:125776812-125776834 CTGCCTCCTGGCTGCTTTCATGG - Intergenic
982696812 4:158611442-158611464 CAGGCCCCTGCCTGCCTCCTAGG + Intronic
983078473 4:163355173-163355195 CTTGCCCCTTTCTGGCTTCTGGG + Intergenic
984055752 4:174927830-174927852 CTGGCCCCTCTATGTTTACTGGG + Intronic
984442606 4:179791857-179791879 CTACCCCCTGTCTGCTTTCACGG - Intergenic
984867229 4:184291880-184291902 GTGGCACCTCTCTGCTCTCTTGG + Intergenic
985183949 4:187296167-187296189 CTGCCCTCTGGCTGCTTTCATGG + Intergenic
985511484 5:316443-316465 CTGGCCTTCGCCTGCTTTCTAGG - Intronic
985840033 5:2299092-2299114 TTGGCTCCTGTCTGCCCTCTTGG - Intergenic
986215720 5:5717115-5717137 TTGGCCCCAGGCTGCTTCCTGGG + Intergenic
986705134 5:10448328-10448350 CAGGCCTGTGTCTGTTTTCTGGG - Exonic
986713775 5:10507613-10507635 CTGGCCCTTGACTACCTTCTGGG + Intronic
987856708 5:23427885-23427907 CTTGCCCCTTTGTGCCTTCTTGG - Intergenic
989532614 5:42525194-42525216 CTCCCTCCTGTCTGCTTTCATGG - Intronic
990675861 5:58183906-58183928 CTGGTCCCTGCCTGTTTTCCTGG - Intergenic
992472049 5:77067502-77067524 CTGGCCACTGCCAGCTTTCCTGG + Intergenic
994068295 5:95568702-95568724 TTGGCCCCTGTCTGGCATCTAGG + Intronic
994198841 5:96949612-96949634 CTGGCCCAGGTATGCTTTCATGG + Intronic
995775779 5:115723725-115723747 CTTTCCCCTGTCTGAATTCTAGG - Intergenic
996087454 5:119319640-119319662 CTGGAACCTCTCTGGTTTCTTGG + Intronic
997350096 5:133224904-133224926 CTGGGCTCTGTCTGCTGTCCAGG + Intronic
998413889 5:141931332-141931354 CTGACCCCTGCCTGCTTTTCTGG - Intronic
998761950 5:145442035-145442057 CTGGCCACTGTTTCCTTTGTTGG - Intergenic
998786098 5:145710594-145710616 CTGCCTCCTGACTTCTTTCTTGG - Intronic
1001240630 5:170067338-170067360 CTGGGGGCTGTCTGCTCTCTGGG - Intronic
1001330894 5:170761657-170761679 CTGGTACCTCTCTGCTTCCTAGG - Intergenic
1001602338 5:172937265-172937287 CTTGGCCTTGTCTGCTTTTTTGG - Intronic
1002322273 5:178383015-178383037 CTGGCTCCTGTCAGCTTTTCAGG - Intronic
1002416264 5:179122421-179122443 CTCGCCCCTCCCTGCTTTCAGGG - Intronic
1002456723 5:179349551-179349573 CTGGCCCCTGTCTGGGGTCGGGG + Intergenic
1006294408 6:33163682-33163704 CTGGGGCCTGTCTGCTTCATGGG - Exonic
1006423363 6:33949136-33949158 CTGGCCCCACGCTGCTCTCTGGG + Intergenic
1006436443 6:34028089-34028111 CTGGCCCCGTTCTGCCCTCTCGG - Intronic
1007784693 6:44272891-44272913 CTGGCCCCTGGCTCCCATCTTGG + Intronic
1007922858 6:45626473-45626495 CTGCCCACTCTCTGCCTTCTGGG - Intronic
1007951510 6:45876730-45876752 CTGACCCCTGCCTTCCTTCTTGG + Intergenic
1008789533 6:55213659-55213681 TTGGCTCCTGACTACTTTCTTGG + Intronic
1009945876 6:70341370-70341392 CTGCCTCCTGGCTGCTTTCATGG + Intergenic
1012083093 6:94785417-94785439 CTGGCCTCTGTCCCCTTTCCAGG + Intergenic
1015311181 6:131768702-131768724 CTGGCATCTGTCTGGCTTCTGGG - Intergenic
1015587688 6:134792716-134792738 CTGGTCCCGGGCTGCTTTTTTGG - Intergenic
1017106172 6:150890335-150890357 TTGGCCCCTTTCTGCTGTCAGGG + Intronic
1017728247 6:157290999-157291021 ATGGCCCCTGGCTCCTTCCTAGG + Exonic
1019336191 7:484059-484081 CCGGCCCCTCTCTGCAGTCTGGG - Intergenic
1019948988 7:4355614-4355636 CTGGCATCTGTTTGCCTTCTGGG - Intergenic
1020244419 7:6419740-6419762 CTGGCCCCTGACGGGTTTCTGGG + Intronic
1021453659 7:20805794-20805816 CTGTCATCTGTCTGCCTTCTGGG + Intergenic
1021493189 7:21243305-21243327 CAGCCACCTGTCTGATTTCTAGG - Intergenic
1021869608 7:24991494-24991516 CTGGCCCCTGACTGGCCTCTGGG - Intergenic
1023845789 7:44119417-44119439 CTCGCCTCTGTCTGCTCCCTAGG - Intronic
1026202252 7:68224415-68224437 CTGGCCCATTTCTTGTTTCTTGG + Intergenic
1026384733 7:69834980-69835002 CTGCCGCCTGTCTGCTTGCTTGG + Intronic
1026393659 7:69928655-69928677 CTGGCCTCTCCCTGCTCTCTCGG - Intronic
1026765477 7:73156993-73157015 CAGCCCCCTGGCTGATTTCTCGG + Intergenic
1027041951 7:74966687-74966709 CAGCCCCCTGGCTGATTTCTCGG + Intronic
1027081691 7:75235668-75235690 CAGCCCCCTGGCTGATTTCTCGG - Intergenic
1027253081 7:76411268-76411290 CTGGCCACTGTTTGCTTTAATGG - Intronic
1029390278 7:100270249-100270271 CAGCCCCCTGGCTGATTTCTCGG - Intronic
1030085719 7:105813734-105813756 TTGGCCACTTTCTGTTTTCTGGG + Intronic
1030317862 7:108134740-108134762 CTGGCCACTGCCTGCTTTTATGG + Intergenic
1032125932 7:129192882-129192904 GTGGCCACTGTGTGCTTCCTTGG + Intronic
1033237520 7:139649874-139649896 CTTACCCCTGTCTGCTTCCAGGG - Intronic
1033741198 7:144277071-144277093 CTGCCCACTGCCTGCTTGCTTGG - Intergenic
1033752705 7:144372543-144372565 CTGCCCACTGCCTGCTTGCTTGG + Intronic
1034217709 7:149421059-149421081 CTAGGCCCTGCCTGCCTTCTCGG - Intergenic
1034415795 7:150963671-150963693 CTGGCCCAGTTCTGCTTCCTGGG + Intronic
1034552733 7:151831907-151831929 CTGGCCCCTCTCTCCCGTCTCGG - Intronic
1037519953 8:19671044-19671066 CTGGCTTCTGTCTCCTTTCTAGG - Intronic
1037807934 8:22068877-22068899 CTGGGCCACCTCTGCTTTCTTGG - Intronic
1037880925 8:22573034-22573056 CTGGCCACTCTCTTCTCTCTGGG - Intronic
1038777163 8:30541565-30541587 CTGCCCTCTTTCTGCTTACTGGG + Intronic
1039662066 8:39478547-39478569 GTGGCCCCTGATTTCTTTCTTGG + Intergenic
1040548296 8:48419237-48419259 CAGGCCCCTGCTTGCTTTCCAGG + Intergenic
1041025729 8:53684269-53684291 CTGAACCATGTTTGCTTTCTGGG - Intergenic
1041232775 8:55770380-55770402 CTGGCCCATGTCATTTTTCTTGG - Intronic
1043776588 8:84277874-84277896 CTCGCTCCTGGCTGCTTTCATGG + Intronic
1044494088 8:92855871-92855893 CTGGCCCCTGTGTACTGGCTTGG - Intergenic
1044619663 8:94176523-94176545 CTGGCCCCTGCCTGTTACCTGGG + Exonic
1044656472 8:94553644-94553666 CTGCCCCCCCTCTGCGTTCTAGG - Intergenic
1045340204 8:101246987-101247009 CTGACCCTTGGCTGGTTTCTAGG - Intergenic
1046175519 8:110570823-110570845 CTCCCTCCTGGCTGCTTTCTTGG + Intergenic
1046892715 8:119440680-119440702 CTGGCCCCTGCCTATTCTCTAGG - Intergenic
1047569358 8:126081238-126081260 CTGGCCCCTTTATGTTTTCAAGG - Intergenic
1048006403 8:130422708-130422730 CTGGCTCCTGTCCCCTTTATGGG - Intronic
1048198770 8:132354202-132354224 CTGGCTCCTGTGTGCTCTCATGG + Intronic
1049239843 8:141531779-141531801 CTGGCCCCCACCTCCTTTCTGGG - Intergenic
1049436562 8:142588797-142588819 CTGGCATCTGCCTGATTTCTGGG - Intergenic
1050197793 9:3106706-3106728 CTGGGCTCTGTCTAGTTTCTGGG - Intergenic
1051613097 9:18980627-18980649 CTGGGCCCTGCCTGCCTTCTGGG + Intronic
1052235723 9:26211661-26211683 CTGGCCCCTTTCAGAATTCTGGG - Intergenic
1052608754 9:30740896-30740918 CTTGTCCCTGTCTGCTTCCCTGG + Intergenic
1053684654 9:40510370-40510392 CTGGCCCCTGTGCCCTTTCTGGG + Intergenic
1053934620 9:43138648-43138670 CTGGCCCCTGTGCCCTTTCTGGG + Intergenic
1054279072 9:63114595-63114617 CTGGCCCCTGTGCCCTTTCTGGG - Intergenic
1054297748 9:63345832-63345854 CTGGCCCCTGTGCCCTTTCTGGG + Intergenic
1054358351 9:64086937-64086959 CTGGCCCTTGGCTGCTGTTTAGG - Intergenic
1054395764 9:64650343-64650365 CTGGCCCCTGTGCCCTTTCTGGG + Intergenic
1054430408 9:65155538-65155560 CTGGCCCCTGTGCCCTTTCTGGG + Intergenic
1054499972 9:65865983-65866005 CTGGCCCCTGTGCCCTTTCTGGG - Intergenic
1055191519 9:73530317-73530339 CTGGCCTCTGCCTGGCTTCTGGG - Intergenic
1055364027 9:75525116-75525138 CTTCCTCCTGTCTGCTTTCACGG - Intergenic
1055659833 9:78491737-78491759 CTGGTTTCTGTCTGGTTTCTGGG - Intergenic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1056534937 9:87519108-87519130 TTTGTCCCTGTCTGCTTTCCTGG + Intronic
1056958211 9:91099451-91099473 CTGGCCCCGGACAGCTTGCTGGG - Intergenic
1057955792 9:99406801-99406823 GTTGCCTCTGTCTGCTTTCTGGG - Intergenic
1059813054 9:117877885-117877907 CTGGCACTTGTCTGGTTTCCAGG - Intergenic
1059937839 9:119329449-119329471 GTGTCCCCTGCCTTCTTTCTTGG - Intronic
1060072867 9:120565537-120565559 CTGGCCCCTGCCTGCTTCAATGG + Intronic
1060612498 9:124980399-124980421 TTGGCCCCTGGCTGGCTTCTGGG + Intronic
1060731184 9:126038030-126038052 CTGGCTGCTGTCTGCAGTCTTGG + Intergenic
1061138767 9:128751835-128751857 CTGGCCCCAGCCTGCTTTAATGG - Intronic
1061706117 9:132454735-132454757 CTGGCCCCTGGCTACGTTATAGG - Intronic
1062191821 9:135251753-135251775 CTGGCCCCCGACTGCTGTCTTGG - Intergenic
1062702725 9:137916465-137916487 CTGGTCCCTGGCTGCCTGCTCGG + Intronic
1186193071 X:7085021-7085043 CTGGACCGTGTGTGCTCTCTGGG - Intronic
1186514791 X:10158784-10158806 CTGGCCCCTGCCCGCTTTCTCGG - Intronic
1187448459 X:19377158-19377180 ATGGCCCCTGTGTTATTTCTGGG - Intronic
1188210351 X:27416659-27416681 GTGGCCCATTTCTGCTTTGTGGG - Intergenic
1189019062 X:37315902-37315924 CTAGCCCCTCTCTCCTTCCTGGG + Intergenic
1190560104 X:51678588-51678610 CTGGCCCCTCTCTGTTTTCATGG - Intergenic
1190564187 X:51714733-51714755 CTGGCCCCTCTCTGTTTTCATGG + Intergenic
1194756354 X:97743644-97743666 CTGCTCCCTGGCTGCTTTCATGG - Intergenic
1198975971 X:142336113-142336135 CTGGCCCCTGTATGACTTTTGGG + Intergenic
1199203804 X:145124259-145124281 CTGCCTCCTGGCTGCTTTCACGG + Intergenic
1200034454 X:153318872-153318894 CTGGCCTCTGTCTGCCTCCAGGG + Intergenic
1200045067 X:153396840-153396862 CTGGCCTCTGTCTGCCTCCAAGG + Intergenic
1200697822 Y:6376586-6376608 CTTGCCCCGGTCTGATTTCCAGG - Intergenic
1200709198 Y:6468668-6468690 CTGGCCCCACTGTGATTTCTAGG - Intergenic
1200926412 Y:8658834-8658856 CTTGCCCCTCTGTGATTTCTAGG + Intergenic
1201024914 Y:9696040-9696062 CTGGCCCCACTGTGATTTCTAGG + Intergenic
1201036290 Y:9788113-9788135 CTTGCCCCGGTCTGATTTCCAGG + Intergenic
1202183173 Y:22156877-22156899 CTGGCCCCACTGTGATTTCTAGG - Intergenic
1202208186 Y:22429524-22429546 CTGGCCCCACTGTGATTTCTAGG + Intergenic