ID: 1170412191

View in Genome Browser
Species Human (GRCh38)
Location 20:16103896-16103918
Sequence ATGTTGAAGGATAGAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170412182_1170412191 12 Left 1170412182 20:16103861-16103883 CCTCAGATAGGGCTGAATTTCCC No data
Right 1170412191 20:16103896-16103918 ATGTTGAAGGATAGAGAAGAGGG No data
1170412183_1170412191 -8 Left 1170412183 20:16103881-16103903 CCCAGTCCCCACTCCATGTTGAA No data
Right 1170412191 20:16103896-16103918 ATGTTGAAGGATAGAGAAGAGGG No data
1170412184_1170412191 -9 Left 1170412184 20:16103882-16103904 CCAGTCCCCACTCCATGTTGAAG No data
Right 1170412191 20:16103896-16103918 ATGTTGAAGGATAGAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170412191 Original CRISPR ATGTTGAAGGATAGAGAAGA GGG Intergenic
No off target data available for this crispr