ID: 1170415233

View in Genome Browser
Species Human (GRCh38)
Location 20:16132745-16132767
Sequence TCTTATAGGGAGAAAATTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170415233_1170415240 9 Left 1170415233 20:16132745-16132767 CCCTCAATTTTCTCCCTATAAGA No data
Right 1170415240 20:16132777-16132799 TAATGATACACACCTCAAAGGGG No data
1170415233_1170415238 7 Left 1170415233 20:16132745-16132767 CCCTCAATTTTCTCCCTATAAGA No data
Right 1170415238 20:16132775-16132797 AGTAATGATACACACCTCAAAGG No data
1170415233_1170415242 29 Left 1170415233 20:16132745-16132767 CCCTCAATTTTCTCCCTATAAGA No data
Right 1170415242 20:16132797-16132819 GGGTTATCATAAAAATTGAAAGG No data
1170415233_1170415239 8 Left 1170415233 20:16132745-16132767 CCCTCAATTTTCTCCCTATAAGA No data
Right 1170415239 20:16132776-16132798 GTAATGATACACACCTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170415233 Original CRISPR TCTTATAGGGAGAAAATTGA GGG (reversed) Intergenic
No off target data available for this crispr