ID: 1170417940

View in Genome Browser
Species Human (GRCh38)
Location 20:16164356-16164378
Sequence GTCCCTGGGGCCAAAAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170417940_1170417949 12 Left 1170417940 20:16164356-16164378 CCAACACTTTTGGCCCCAGGGAC No data
Right 1170417949 20:16164391-16164413 AGACAATTATTCCACAGGTGGGG No data
1170417940_1170417951 20 Left 1170417940 20:16164356-16164378 CCAACACTTTTGGCCCCAGGGAC No data
Right 1170417951 20:16164399-16164421 ATTCCACAGGTGGGGGTGAGAGG No data
1170417940_1170417950 13 Left 1170417940 20:16164356-16164378 CCAACACTTTTGGCCCCAGGGAC No data
Right 1170417950 20:16164392-16164414 GACAATTATTCCACAGGTGGGGG No data
1170417940_1170417946 7 Left 1170417940 20:16164356-16164378 CCAACACTTTTGGCCCCAGGGAC No data
Right 1170417946 20:16164386-16164408 ATGGAAGACAATTATTCCACAGG No data
1170417940_1170417947 10 Left 1170417940 20:16164356-16164378 CCAACACTTTTGGCCCCAGGGAC No data
Right 1170417947 20:16164389-16164411 GAAGACAATTATTCCACAGGTGG No data
1170417940_1170417948 11 Left 1170417940 20:16164356-16164378 CCAACACTTTTGGCCCCAGGGAC No data
Right 1170417948 20:16164390-16164412 AAGACAATTATTCCACAGGTGGG No data
1170417940_1170417953 25 Left 1170417940 20:16164356-16164378 CCAACACTTTTGGCCCCAGGGAC No data
Right 1170417953 20:16164404-16164426 ACAGGTGGGGGTGAGAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170417940 Original CRISPR GTCCCTGGGGCCAAAAGTGT TGG (reversed) Intergenic
No off target data available for this crispr