ID: 1170418617

View in Genome Browser
Species Human (GRCh38)
Location 20:16170533-16170555
Sequence GGCACCTGGCCAATAACACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170418617_1170418625 23 Left 1170418617 20:16170533-16170555 CCGTGTGTTATTGGCCAGGTGCC No data
Right 1170418625 20:16170579-16170601 CAGTGGCTTCACTCACATGTCGG No data
1170418617_1170418621 -5 Left 1170418617 20:16170533-16170555 CCGTGTGTTATTGGCCAGGTGCC No data
Right 1170418621 20:16170551-16170573 GTGCCTTCATTAAGGAAAGGAGG No data
1170418617_1170418626 24 Left 1170418617 20:16170533-16170555 CCGTGTGTTATTGGCCAGGTGCC No data
Right 1170418626 20:16170580-16170602 AGTGGCTTCACTCACATGTCGGG No data
1170418617_1170418620 -8 Left 1170418617 20:16170533-16170555 CCGTGTGTTATTGGCCAGGTGCC No data
Right 1170418620 20:16170548-16170570 CAGGTGCCTTCATTAAGGAAAGG No data
1170418617_1170418623 6 Left 1170418617 20:16170533-16170555 CCGTGTGTTATTGGCCAGGTGCC No data
Right 1170418623 20:16170562-16170584 AAGGAAAGGAGGAGCCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170418617 Original CRISPR GGCACCTGGCCAATAACACA CGG (reversed) Intergenic
No off target data available for this crispr