ID: 1170420490

View in Genome Browser
Species Human (GRCh38)
Location 20:16187565-16187587
Sequence GTCTCCCTTAGTCCCCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170420490_1170420494 19 Left 1170420490 20:16187565-16187587 CCATCATGGGGACTAAGGGAGAC No data
Right 1170420494 20:16187607-16187629 ACTGAGCTGCCTGAGCCACATGG No data
1170420490_1170420495 20 Left 1170420490 20:16187565-16187587 CCATCATGGGGACTAAGGGAGAC No data
Right 1170420495 20:16187608-16187630 CTGAGCTGCCTGAGCCACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170420490 Original CRISPR GTCTCCCTTAGTCCCCATGA TGG (reversed) Intergenic
No off target data available for this crispr