ID: 1170420633

View in Genome Browser
Species Human (GRCh38)
Location 20:16189532-16189554
Sequence TAATCCAATCACTTGTAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170420633_1170420640 25 Left 1170420633 20:16189532-16189554 CCACCCTACAAGTGATTGGATTA No data
Right 1170420640 20:16189580-16189602 AAACAGAAGCCTGGTTTTAAGGG No data
1170420633_1170420639 24 Left 1170420633 20:16189532-16189554 CCACCCTACAAGTGATTGGATTA No data
Right 1170420639 20:16189579-16189601 AAAACAGAAGCCTGGTTTTAAGG No data
1170420633_1170420637 16 Left 1170420633 20:16189532-16189554 CCACCCTACAAGTGATTGGATTA No data
Right 1170420637 20:16189571-16189593 AGCCTCTCAAAACAGAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170420633 Original CRISPR TAATCCAATCACTTGTAGGG TGG (reversed) Intergenic
No off target data available for this crispr