ID: 1170421706

View in Genome Browser
Species Human (GRCh38)
Location 20:16199904-16199926
Sequence ATGTGGTAGCTGACTGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170421706_1170421711 14 Left 1170421706 20:16199904-16199926 CCTGATTCAGTCAGCTACCACAT No data
Right 1170421711 20:16199941-16199963 CTTTCCTTTTCTCTTTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170421706 Original CRISPR ATGTGGTAGCTGACTGAATC AGG (reversed) Intergenic
No off target data available for this crispr