ID: 1170421711

View in Genome Browser
Species Human (GRCh38)
Location 20:16199941-16199963
Sequence CTTTCCTTTTCTCTTTCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170421704_1170421711 21 Left 1170421704 20:16199897-16199919 CCCTCATCCTGATTCAGTCAGCT No data
Right 1170421711 20:16199941-16199963 CTTTCCTTTTCTCTTTCTTTAGG No data
1170421709_1170421711 -3 Left 1170421709 20:16199921-16199943 CCACATGGAGGCTGCCATCTCTT No data
Right 1170421711 20:16199941-16199963 CTTTCCTTTTCTCTTTCTTTAGG No data
1170421703_1170421711 22 Left 1170421703 20:16199896-16199918 CCCCTCATCCTGATTCAGTCAGC No data
Right 1170421711 20:16199941-16199963 CTTTCCTTTTCTCTTTCTTTAGG No data
1170421706_1170421711 14 Left 1170421706 20:16199904-16199926 CCTGATTCAGTCAGCTACCACAT No data
Right 1170421711 20:16199941-16199963 CTTTCCTTTTCTCTTTCTTTAGG No data
1170421705_1170421711 20 Left 1170421705 20:16199898-16199920 CCTCATCCTGATTCAGTCAGCTA No data
Right 1170421711 20:16199941-16199963 CTTTCCTTTTCTCTTTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170421711 Original CRISPR CTTTCCTTTTCTCTTTCTTT AGG Intergenic
No off target data available for this crispr