ID: 1170430952

View in Genome Browser
Species Human (GRCh38)
Location 20:16276065-16276087
Sequence CTCCTGTGGGCTCCGGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170430948_1170430952 -8 Left 1170430948 20:16276050-16276072 CCTCATCTCAGGTAGCTCCTGTG 0: 1
1: 0
2: 3
3: 15
4: 201
Right 1170430952 20:16276065-16276087 CTCCTGTGGGCTCCGGCTTCAGG 0: 1
1: 0
2: 2
3: 22
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170430952 Original CRISPR CTCCTGTGGGCTCCGGCTTC AGG Intronic
900254647 1:1691734-1691756 CTTGTGTGGTCTCCAGCTTCCGG - Intronic
900263399 1:1745009-1745031 CTTGTGTGGTCTCCAGCTTCCGG - Intronic
900856607 1:5190428-5190450 CTGCTGTGAGCTCTGGCTTTTGG - Intergenic
902717605 1:18283292-18283314 CCCTTGTGGGCCCCGGTTTCTGG - Intronic
902755717 1:18548035-18548057 CTCCCGCTGGCTCCTGCTTCTGG - Intergenic
905215032 1:36400907-36400929 CTGCTGTGGGCACCAGCATCTGG + Intergenic
907161458 1:52373264-52373286 CTCCTGTCGCCTCCTGCTTGTGG - Exonic
908351215 1:63287212-63287234 CCCCAGTGGGCTCAGGATTCAGG + Intergenic
909044922 1:70698452-70698474 CTCCTGTGTCCTCTGGCTTGTGG - Intergenic
910543521 1:88388460-88388482 GTTCTGTGGGCTCCTACTTCTGG - Intergenic
911411237 1:97510170-97510192 CTACTGTTGGCTCTGCCTTCTGG - Intronic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
912488704 1:110049262-110049284 GTCCTGTGGGCTGGGGCCTCGGG + Intronic
912691276 1:111806131-111806153 CTCCTGTGTGCTGCAGCTCCAGG + Intronic
913324701 1:117616541-117616563 CACCTGTGGGCCCTGGCTCCTGG - Intronic
915446024 1:155975537-155975559 CTCCTGGTGGCTGAGGCTTCTGG - Intronic
917494746 1:175530230-175530252 CTCCTGAGGGCTACGGCACCTGG + Intronic
919031786 1:192251795-192251817 CCCCTGTGGGCTCAGGCTCAGGG + Intergenic
919452682 1:197789138-197789160 CTCCTGTGGACTCAGGCTGCAGG + Intergenic
919452708 1:197789253-197789275 CTCCTGTAGACCCAGGCTTCAGG + Intergenic
921286798 1:213616371-213616393 ATCCTCTGGGCTCCAGCTCCAGG - Intergenic
921766844 1:218982848-218982870 CTGCTGTGGGCACCTGCATCTGG + Intergenic
922591630 1:226781713-226781735 CTCCTGAGGGATCAGGCTTCTGG - Intergenic
924421974 1:243918158-243918180 CTTCTGTGAGCTCTGACTTCAGG - Intergenic
1065488003 10:26253626-26253648 CTCCTGTGAGCTCCATCTTTTGG + Intronic
1066065309 10:31757384-31757406 CTCCGGTGGTCTCCGGCCTCGGG + Intergenic
1069274235 10:66569138-66569160 CTCCTTTGTTCTCTGGCTTCTGG - Intronic
1071236625 10:83657312-83657334 TTCCTGTGGACTCAGGTTTCTGG - Intergenic
1072825225 10:98599242-98599264 CTCCTGTGGCCTCAGGCTTCAGG - Intronic
1074780463 10:116798543-116798565 CTCCTGGGGGCTCCAGTTTTGGG - Intergenic
1074979478 10:118608293-118608315 CTGCTGTGGGCACCAGCATCTGG + Intergenic
1075711360 10:124532417-124532439 CTGCTGTGAGCTCGGGCTTTTGG - Intronic
1076395473 10:130135367-130135389 ATGCTGTGGGCTCCGGGTTCAGG + Intergenic
1076756452 10:132575040-132575062 CTCCCGGGGGCTCCGGATTCGGG + Intronic
1077044131 11:537007-537029 CTCGGGTGCGCTCCGGCGTCCGG + Intronic
1077050799 11:565905-565927 CTCCTGGTGGCCCTGGCTTCTGG - Intergenic
1077910443 11:6567897-6567919 CTCCTGTGGGCTGGGGCATGGGG + Intronic
1079888956 11:26026210-26026232 TTGCTGTGGGCTCAGGCTTCTGG + Intergenic
1081189965 11:40091464-40091486 CTCCTGTGGGCTCTTGCTGTAGG + Intergenic
1083127943 11:60591163-60591185 CTCTTGTAGACTCAGGCTTCAGG + Intergenic
1084547436 11:69821414-69821436 CACCTTTGGACTCCTGCTTCAGG - Intergenic
1089253408 11:117180946-117180968 CTCCTCTGGGCTCTGGCCCCAGG + Intronic
1091084150 11:132704125-132704147 CTCCTGTGGACTCAGGCTCTAGG - Intronic
1093182942 12:15988038-15988060 CTGCTGTGGGCACCAGCATCTGG + Intronic
1097066553 12:56324800-56324822 CTTCGGTGGACTCCTGCTTCTGG - Intronic
1101188002 12:102301160-102301182 CTCCTGTGGGCTCAGGGTGATGG + Intergenic
1103764522 12:123271231-123271253 CTCCTTTTTCCTCCGGCTTCTGG - Intronic
1104478809 12:129089867-129089889 CGCCTGTGGCCTCCTGCTCCAGG + Intronic
1104657126 12:130581636-130581658 GTCCTGTGGACTCTGACTTCAGG + Intronic
1104686503 12:130788358-130788380 CTCCGGAGGGCTCCTGCCTCTGG + Intergenic
1107835518 13:44409788-44409810 GTCCTGTGCCCTCTGGCTTCTGG - Intergenic
1110439032 13:75507402-75507424 CTGCTGTGGGCACCCGCATCTGG + Intergenic
1112474075 13:99715133-99715155 ATCCTGTGCTCTCCAGCTTCGGG + Intronic
1112677780 13:101723525-101723547 CTCCTGAAGGCTCTGGCTTATGG - Intronic
1113323373 13:109259259-109259281 CTCCAGTGGGCTTCTGGTTCTGG - Intergenic
1114764743 14:25358172-25358194 CCTCTGTGGCCTCCTGCTTCTGG + Intergenic
1116432914 14:44866990-44867012 CCCCTATGGTCTCAGGCTTCAGG - Intergenic
1121368753 14:93337868-93337890 CTACTGTGGGCACCAGCATCTGG - Intronic
1121788380 14:96680115-96680137 CTCCTGAAGGCTCCAGTTTCTGG - Intergenic
1123216754 14:106815171-106815193 CTCCTGTGGGCTCAAGAGTCAGG - Intergenic
1123419983 15:20123754-20123776 CTTCTAGGGGCTCCAGCTTCTGG - Intergenic
1123445878 15:20329778-20329800 CTTCTAGGGGCTCCAGCTTCTGG + Intergenic
1123493076 15:20798570-20798592 CTCCGGAGGGCTCCAGCTCCTGG - Intergenic
1123529204 15:21130290-21130312 CTTCTAGGGGCTCCAGCTTCTGG - Intergenic
1123549582 15:21367672-21367694 CTCCGGAGGGCTCCAGCTCCTGG - Intergenic
1129853924 15:78811141-78811163 CTCCTCTGCGCTCTGGCTCCCGG - Exonic
1130285434 15:82550659-82550681 TTCCTGTGGGATCCTTCTTCGGG - Intronic
1130537951 15:84800297-84800319 GTCCTGTGTGCTCCCGCCTCAGG - Intronic
1130659231 15:85816982-85817004 CACCTGTGGGTTCCAGATTCAGG + Intergenic
1131160912 15:90104228-90104250 CTCCCTTGGGCTCAGCCTTCTGG - Intergenic
1131568224 15:93505850-93505872 CTGCTGTGGGCCCCAGCGTCTGG + Intergenic
1202957913 15_KI270727v1_random:94890-94912 CTCCGGAGGGCTCCAGCTCCTGG - Intergenic
1134797655 16:17056724-17056746 CTACTGTGGGCTCAGCCTCCAGG - Intergenic
1136223951 16:28846300-28846322 CTTCTGTGCGCTCGGGCTCCTGG - Exonic
1136514061 16:30757162-30757184 CTCCTCTGGGCTCTGGCCTCTGG + Exonic
1136864576 16:33735685-33735707 TTCCTATGGGCTCCCCCTTCTGG + Intergenic
1136864740 16:33738036-33738058 TTCCTATGGGCTCCCACTTCTGG + Intergenic
1138452563 16:57102412-57102434 CTCCTGGGTGCTGTGGCTTCTGG - Intronic
1141688164 16:85582040-85582062 CTCTTGTGGGATCCGTCTCCTGG + Intergenic
1141894854 16:86952931-86952953 TTCCTGTGTGCTCTGACTTCTGG + Intergenic
1142338360 16:89505253-89505275 CTGCTGTGGGCTGAAGCTTCAGG - Intronic
1203126069 16_KI270728v1_random:1583821-1583843 TTCCTATGGGCTCCCCCTTCTGG + Intergenic
1203126237 16_KI270728v1_random:1586172-1586194 TTCCTATGGGCTCCCACTTCTGG + Intergenic
1143983413 17:10890563-10890585 CTGCTGTGTGCACCTGCTTCGGG - Intergenic
1144639942 17:16931608-16931630 CTCCTGGGGCCTTCAGCTTCAGG + Intronic
1147162686 17:38577265-38577287 CTCCTGTGTGCACTGGCTTGAGG - Intronic
1147559859 17:41502028-41502050 CCCCTGTGGGCTCAGGGCTCAGG - Intronic
1148031802 17:44627253-44627275 CACTTCTGGGCTCCGGCCTCGGG - Intergenic
1150612836 17:66747931-66747953 CTCCTCTGGGCTCCTCTTTCTGG - Intronic
1150647905 17:66991401-66991423 CTCTTATGGGATCTGGCTTCTGG - Intronic
1151829083 17:76539012-76539034 CTCCTGGGAGCTCAGGGTTCAGG + Intronic
1152100165 17:78296767-78296789 CTCCTGTGAACTCCAGCTCCTGG - Intergenic
1152166039 17:78707190-78707212 CTCCTGTGGGCAGTGCCTTCAGG - Intronic
1152227374 17:79098680-79098702 TTGCAGTGGGCTCCGGCTCCAGG + Intronic
1154450616 18:14473103-14473125 CTCCGGAGGGCTCCAGCTCCTGG - Intergenic
1155466395 18:26140289-26140311 CTCCTGTGGACTCAGGTTCCAGG - Intronic
1158215477 18:55096520-55096542 ATCATGTGGGCTCAGGCTGCTGG - Intergenic
1160828449 19:1091513-1091535 CTCCTGTGGGCTCCAGCCCTCGG - Intronic
1160881342 19:1322147-1322169 CCGCTGTGGGCTCCAGCATCGGG + Intergenic
1160940434 19:1618244-1618266 ATCCTGTGGGCCCCGCCTTCAGG + Intronic
1162550047 19:11353647-11353669 CTCAGGTGGGCTCCAGGTTCTGG - Intronic
1163598623 19:18234596-18234618 CTCCTGTGGGCTCTGGGCTTGGG + Intronic
1164432131 19:28197726-28197748 CTCATCTGGGCTCGGGCATCAGG + Intergenic
1167044726 19:47042885-47042907 CACCTGTGGGCTCTGGCCCCGGG - Exonic
1167049256 19:47068588-47068610 CACCTGTGGCCTCTGGCTTCAGG + Intronic
926584076 2:14666073-14666095 CTCCTTTGCTCTCTGGCTTCTGG + Intergenic
926801979 2:16666626-16666648 CTCCTGGGGACCCCGGCTTCGGG + Intergenic
930014774 2:46962779-46962801 CCCCTCTGGGCTGCTGCTTCTGG + Intronic
930226836 2:48802635-48802657 CTCCTGTGGGGTAGGGCTTCGGG + Intergenic
930730626 2:54724750-54724772 CACCTGCGGGCTCCGGCCCCCGG - Exonic
934632901 2:95949430-95949452 TTCCTATGGGCTCCCCCTTCTGG + Intronic
934713009 2:96527739-96527761 CCCCTGTGGGCACTGGCTCCGGG - Intergenic
934800237 2:97148424-97148446 TTCCTATGGGCTCCCACTTCTGG - Intronic
934800600 2:97153819-97153841 TTCCTATGGGCTCCCCCTTCTGG - Intronic
937636957 2:124166895-124166917 ATCCTGTGGGCTCCATCTTGGGG - Intronic
938392302 2:130915785-130915807 CTGCTTTGGGCTCCAGCTGCCGG - Intronic
938480818 2:131659774-131659796 CTCCGGAGGGCTCCAGCTTCTGG + Intergenic
939084804 2:137707150-137707172 CTGCTGTGGGCACCAGCATCTGG + Intergenic
940398576 2:153221832-153221854 CTGCTGTGGGCACCTGCATCTGG + Intergenic
941062031 2:160857641-160857663 CTCCTGGGGGCTCCGCCTTTGGG - Intergenic
945710653 2:213290354-213290376 GTACTGTGGGCTGTGGCTTCAGG + Intronic
947537947 2:230952750-230952772 CTCCTGTGGGGGCCGGCCTGAGG - Intronic
948051473 2:234982461-234982483 CTCCTGTGCCCTCCAGCTGCTGG - Intronic
948106828 2:235421308-235421330 CACCTCTGGGCTCCTGCCTCAGG - Intergenic
948318537 2:237049882-237049904 GTCCTGTGAGCTCCTGCCTCTGG + Intergenic
948481322 2:238252214-238252236 CACCTCCGGGCTCCTGCTTCTGG - Intronic
948846888 2:240687565-240687587 CTCCTCTGGCCTCCGTCTACAGG + Intergenic
1168835155 20:872925-872947 CTCCTGTGTGGTCCAGCCTCTGG + Exonic
1169074948 20:2754767-2754789 CTCCTGGGGGCTCAGGCCTGGGG - Intronic
1170430952 20:16276065-16276087 CTCCTGTGGGCTCCGGCTTCAGG + Intronic
1172996215 20:39072223-39072245 CTCCTGGGGGCCGGGGCTTCTGG + Intergenic
1173953890 20:47015840-47015862 CCCCTGTGGGCTCCCAATTCAGG - Intronic
1174102513 20:48138329-48138351 CCCTTGTGGCCTCTGGCTTCTGG + Intergenic
1174154415 20:48507296-48507318 CTCCCGGGGTCTCCAGCTTCCGG + Intergenic
1174155165 20:48511313-48511335 CTCCCGGGGTCTCCAGCTTCCGG + Intergenic
1174156164 20:48516726-48516748 CTCCCCTGGGCTCCAGCTCCAGG + Intergenic
1176445579 21:6817279-6817301 CTCCGGAGGGCTCCAGCTCCTGG + Intergenic
1176823746 21:13682312-13682334 CTCCGGAGGGCTCCAGCTCCTGG + Intergenic
1180289564 22:10784394-10784416 CTCCTGTGGTCTCTGGTCTCTGG - Intergenic
1180305334 22:11068405-11068427 CTCCTGTGGTCTCTGGTCTCTGG + Intergenic
1180822470 22:18840176-18840198 CTCTTGTGGTCCCTGGCTTCGGG - Intergenic
1181036333 22:20171540-20171562 CTCCTGTGGGCTCCTGGCTGGGG + Intergenic
1181190496 22:21135850-21135872 CTCTTGTGGTCCCTGGCTTCGGG + Intergenic
1181208708 22:21274671-21274693 CTCTTGTGGTCCCTGGCTTCGGG - Intergenic
1181322554 22:22019516-22019538 CTCCTCTGGGCTCCAGCCTGGGG + Intergenic
1182149835 22:28020154-28020176 CTCCTGGGGGCTGCGGCTCCGGG + Intronic
1182770150 22:32789048-32789070 CTCCAGCTGGCTCCGGCTCCAGG + Intronic
1184296101 22:43526540-43526562 CTCCTGCTGGCTCCTCCTTCTGG - Intergenic
1184412110 22:44331531-44331553 CTCCCGCGGGCGCCGGCTCCCGG - Intergenic
1184470404 22:44692516-44692538 CTCCTGGGGGCTCCTCCTCCCGG + Intronic
1184501771 22:44878913-44878935 CTCCTGTGACCTCCAGCTCCCGG - Intergenic
1185053360 22:48565157-48565179 GGCATGTGGGCTCCGGCTTGAGG + Intronic
1203218230 22_KI270731v1_random:20774-20796 CTCTTGTGGTCCCTGGCTTCGGG + Intergenic
949938682 3:9136747-9136769 CTCCGGTGGACTCTGGCATCAGG - Intronic
950452444 3:13072945-13072967 CCCCTCTGGCCTCTGGCTTCAGG + Intronic
950847223 3:16026777-16026799 CTCCTGTGTGCCCTGGCTGCAGG + Intergenic
951022336 3:17793963-17793985 CTCCTGCAGTCTCAGGCTTCAGG - Intronic
954454522 3:50590594-50590616 CTCCTGTGGGGTGGGGCATCTGG + Intergenic
955660591 3:61294907-61294929 TTTCTGTGGGCTCCATCTTCAGG + Intergenic
957417993 3:79930203-79930225 CTGCTGTGGGCACCTGCATCTGG - Intergenic
957614146 3:82506313-82506335 CTGCTGTGGGCACCAGCATCTGG - Intergenic
958996540 3:100912179-100912201 CTGCCGTCGGCTCAGGCTTCAGG + Intronic
965844524 3:172946384-172946406 CTCCTGTGGTCCCCAGTTTCAGG + Intronic
967838442 3:193984052-193984074 CTTCTGTTGGTTCCAGCTTCTGG - Intergenic
968199399 3:196739787-196739809 CCCCGGGGAGCTCCGGCTTCGGG + Intergenic
968702554 4:2063751-2063773 CCCCTGCAGGCTCCTGCTTCTGG + Exonic
969136492 4:5033341-5033363 TTCCTGTGGACTCCAGCTTCTGG + Intergenic
969697379 4:8742247-8742269 CTGCTCTGGGCTCTGGCTACTGG + Intergenic
970124732 4:12796548-12796570 CTCCTCTGGCTTCTGGCTTCTGG + Intergenic
970354774 4:15240785-15240807 TTCCTGTGACCTCTGGCTTCCGG - Intergenic
970709230 4:18842722-18842744 CTGCTGTGGGCACCAGCATCTGG + Intergenic
973140750 4:46765620-46765642 CTCCTGTGGTCTCAGGCTCCAGG + Intronic
973152539 4:46906294-46906316 CCCCTGGAGGCTCAGGCTTCAGG - Intronic
975195440 4:71518531-71518553 CCCCTGTGGCCTCAGGCTCCAGG - Intronic
976441911 4:85085596-85085618 CTCCCTTGCCCTCCGGCTTCTGG - Intergenic
979674781 4:123398687-123398709 CCCCTGGGGGCCGCGGCTTCTGG + Intronic
981052066 4:140319058-140319080 CTACTGTGAGCTCAGGCTTCTGG + Intronic
981606422 4:146545856-146545878 CTCCTGCGGGCTCCACCTCCAGG + Intergenic
984526597 4:180866067-180866089 CTGCTGTGGGCACCAGCATCTGG + Intergenic
985674587 5:1224478-1224500 CTCCTGGGGGGTCTGGCTTTGGG + Exonic
986424256 5:7614667-7614689 CTCCTTTGCCCTCTGGCTTCAGG + Intronic
988065263 5:26224098-26224120 CTCCTGGGGGCTCCAGCTCTGGG + Intergenic
988940488 5:36140142-36140164 CTGCTGTGGGCACCTGCATCTGG - Intronic
989282925 5:39665518-39665540 CTGCTGTGGGCGCCGGTGTCTGG - Intergenic
990176588 5:53114753-53114775 CTACTTTGGGCTGCGGTTTCAGG + Intergenic
990507209 5:56456440-56456462 CTCCTGTAGGGTCAGTCTTCAGG - Intergenic
993088333 5:83392657-83392679 CTCCCGTGGGCTCAGGCCTTCGG - Intergenic
995647574 5:114329947-114329969 CTCCTGGGGGCTCAGGGTTGTGG - Intergenic
997717995 5:136056415-136056437 CTCCTGTGGCCTCTGACGTCTGG + Intronic
998164701 5:139836382-139836404 CTCATGGGGGCCCAGGCTTCAGG + Intronic
999762461 5:154713057-154713079 CACCTGTGGGCTCCTTCCTCGGG - Exonic
1003231383 6:4256754-4256776 CTACTGTGGGCCTCTGCTTCTGG + Intergenic
1004427504 6:15516454-15516476 CTCCTGTGGCCTCAGGCAGCAGG + Intronic
1006284733 6:33083934-33083956 CTCCTCTGTGCTGCGTCTTCAGG - Intronic
1006745295 6:36337330-36337352 CTCTTGTGGGCTCTTCCTTCTGG - Intergenic
1006766150 6:36508900-36508922 CTGCTGTGGGCACCTGCATCTGG + Intronic
1007214885 6:40229126-40229148 CTGCTGTGGGCACCTGCTTCTGG - Intergenic
1007930893 6:45689792-45689814 CTCCTGTGTGCAGAGGCTTCAGG + Intergenic
1007966703 6:46009947-46009969 CTCTAGTGGGCTCCAGCTTATGG + Intronic
1008430968 6:51416243-51416265 CTCCAGTGGACTCTGCCTTCTGG + Intergenic
1010074272 6:71782892-71782914 GTCCTGTAGGCTTCTGCTTCTGG + Intergenic
1010206055 6:73323439-73323461 CTCCTGTGGCTTCAGGCATCTGG - Intergenic
1010628527 6:78168576-78168598 GTCCTGTGGGCACGGGCTTCAGG + Intergenic
1012247136 6:96938420-96938442 CTCTTCTGGGCTCCACCTTCCGG + Intronic
1013623965 6:111919005-111919027 CTCCTGTGCTCTGCCGCTTCTGG + Intergenic
1016590122 6:145735213-145735235 CTCCTCCCGGCTCCCGCTTCAGG + Exonic
1018087260 6:160314117-160314139 CTCTTGTGGACCCAGGCTTCAGG - Intergenic
1018544422 6:164919295-164919317 CTCCTGAGGCCCCAGGCTTCAGG - Intergenic
1023101908 7:36726513-36726535 CTCTAGTGTGCTCAGGCTTCGGG + Intergenic
1023830455 7:44036277-44036299 CTCCTGGGGGCTCAGGCCCCTGG + Intergenic
1024924949 7:54602576-54602598 AGCCCGTGGGCTCTGGCTTCCGG + Intergenic
1025233126 7:57216245-57216267 CTCCCCTGGGCTCCAGCTCCAGG - Intergenic
1026490050 7:70855505-70855527 CTCTTCTGGGCTCCTGCTTGTGG + Intergenic
1027681858 7:81232428-81232450 CTGCTGTGGGCTGCAGCATCTGG + Intergenic
1028128851 7:87147060-87147082 CCACTGTGGGCACCGGCGTCTGG + Intergenic
1028279164 7:88898830-88898852 TGCCTCTGGGCTCCTGCTTCAGG + Intronic
1029740778 7:102490571-102490593 CTCCTGGGGGCTCAGGCCCCTGG + Intronic
1029758772 7:102589744-102589766 CTCCTGGGGGCTCAGGCCCCTGG + Intronic
1030733226 7:113014317-113014339 CTCCTGTGGACACAAGCTTCAGG - Intergenic
1031979027 7:128112510-128112532 CTGCTGTGGGCCACGCCTTCTGG - Intergenic
1032355600 7:131207703-131207725 CCTCTGTGGGCCCAGGCTTCTGG - Intronic
1032781218 7:135166662-135166684 CTCCTCAGGGCTCCTGCTACAGG + Exonic
1034236128 7:149571038-149571060 CTCCTGTGCGTTGCGGCTTTGGG - Intergenic
1034991029 7:155548343-155548365 CACCTGTGGGCCCGGGATTCTGG - Intergenic
1036793621 8:11740113-11740135 CTCCTGGGGCTTCCGGCTTCAGG - Intronic
1039750074 8:40470486-40470508 GTACTGTGGGCTAGGGCTTCAGG - Intergenic
1040559550 8:48512195-48512217 CACCTGAGGGCTCCAGCCTCAGG - Intergenic
1042483107 8:69325194-69325216 CTCCTGGGGGCTCAAGCTCCAGG - Intergenic
1042795177 8:72654160-72654182 CTCCACTGGGCTCTGACTTCAGG + Intronic
1044607194 8:94057716-94057738 CTCCCTTGTGCTCTGGCTTCTGG - Intergenic
1044731077 8:95229186-95229208 CCCCTGTGGGCTGCGTGTTCAGG - Intergenic
1047343948 8:124009422-124009444 CTCCCCTGGGCTCCAGCTCCAGG - Intronic
1047527736 8:125648014-125648036 CTCCTTTGGGCTCTGCCTTTGGG + Intergenic
1048828107 8:138449374-138449396 CTCCTGTGGGCTCCTCTCTCTGG - Intronic
1049297058 8:141846873-141846895 CTCCTGGGGCCTCCAGCCTCTGG - Intergenic
1049388375 8:142355522-142355544 CTCCCGTGGGCTGCAGCTCCAGG + Intronic
1056119810 9:83476567-83476589 CTCCTCTGGGCTCTAGCTTTGGG - Intronic
1056998597 9:91487251-91487273 TTCCTGTGGGCTCTAACTTCAGG + Intergenic
1057233826 9:93342750-93342772 CTCTTCTGGGCACCGGCCTCTGG - Intronic
1057252023 9:93511273-93511295 CTCTTCTGGGCGCCGGCCTCTGG + Intronic
1057551507 9:96054047-96054069 CTCCTGGGCCCTCTGGCTTCTGG - Intergenic
1057618951 9:96618859-96618881 TTCCTGTGGATTCCGCCTTCAGG - Intronic
1057935557 9:99235866-99235888 CTGCTTTGGGCTCCTGCTTTAGG - Intergenic
1058356268 9:104087077-104087099 CTCCTGTGGGCAACTTCTTCGGG - Intergenic
1058908574 9:109499973-109499995 CTCCAGGGGGCTCCTCCTTCCGG - Intergenic
1060157470 9:121329697-121329719 CTCTAGAGGGCTCCTGCTTCTGG + Intronic
1060405107 9:123369103-123369125 CTACAGTGGGCTATGGCTTCTGG + Intronic
1061743122 9:132721937-132721959 CTGCTGTGGGCACCCGCGTCTGG + Intergenic
1062085855 9:134647881-134647903 CCGCTGTGGGCTCCGCCTGCAGG - Intronic
1062468288 9:136691137-136691159 CTCCTGTTGGCTCCTACATCTGG - Intergenic
1062469089 9:136694476-136694498 CTCCTGTGGGCTCCCGCGTCTGG - Intergenic
1062611148 9:137374080-137374102 CTGTTTTGGGCTCTGGCTTCCGG + Intronic
1203523616 Un_GL000213v1:67246-67268 CTCCGGAGGGCTCCAGCTCCTGG - Intergenic
1203664901 Un_KI270754v1:15493-15515 CTGCTGTGTGCTCCGGACTCCGG + Intergenic
1185505703 X:631180-631202 TTCCTTTGCGCTCCGGCTCCAGG + Intronic
1188771827 X:34162733-34162755 CCCCTGTGGGCCCAGACTTCAGG - Intergenic
1189324807 X:40105851-40105873 CACCCCTGGGATCCGGCTTCTGG + Intronic
1190717226 X:53114829-53114851 CTCCTGTGGACTGAGGCTCCAGG - Intergenic
1194916850 X:99717929-99717951 CCCCTGTAGACTCAGGCTTCAGG + Intergenic
1195057499 X:101160308-101160330 CTACTTTTGGCTCCTGCTTCAGG - Intronic
1196905414 X:120427396-120427418 CTGCTAATGGCTCCGGCTTCTGG - Intergenic
1197043746 X:121970930-121970952 CCCCTGTAGACTCAGGCTTCAGG + Intergenic
1197649855 X:129052572-129052594 CTGCTTTGGGCTCCGGCTTTTGG - Intergenic
1198523607 X:137476569-137476591 CTCCTGTGGTCTCCTGCTTTAGG + Intergenic
1202587114 Y:26442703-26442725 TTCCTATGGGCTCCCACTTCTGG - Intergenic