ID: 1170434221

View in Genome Browser
Species Human (GRCh38)
Location 20:16308567-16308589
Sequence TGTCTTGGGGAGGAGAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 718
Summary {0: 1, 1: 0, 2: 7, 3: 68, 4: 642}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170434221_1170434229 8 Left 1170434221 20:16308567-16308589 CCCTCTTTCTCCTCCCCAAGACA 0: 1
1: 0
2: 7
3: 68
4: 642
Right 1170434229 20:16308598-16308620 CACCTGTAAGATGAAGATAATGG No data
1170434221_1170434231 26 Left 1170434221 20:16308567-16308589 CCCTCTTTCTCCTCCCCAAGACA 0: 1
1: 0
2: 7
3: 68
4: 642
Right 1170434231 20:16308616-16308638 AATGGCAGAACTCACCAAGTTGG 0: 1
1: 0
2: 2
3: 17
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170434221 Original CRISPR TGTCTTGGGGAGGAGAAAGA GGG (reversed) Intronic
900091060 1:920933-920955 TGGGGTGGGGAGGAGAGAGATGG - Intergenic
900573188 1:3370000-3370022 TGTCACAGGGAGAAGAAAGAAGG + Intronic
901400072 1:9009893-9009915 TGTCATGGGAAAGAGAAACAAGG - Intronic
901798872 1:11695790-11695812 TGCCTAGGAGAGGAGGAAGAGGG + Intronic
901850102 1:12009573-12009595 TTCCCTGGGGAGGAGAGAGAAGG - Exonic
901861834 1:12079464-12079486 TGCCCTGGGGAAGAGAGAGAGGG - Intronic
902908789 1:19579716-19579738 CATCTTGGGAAGGAGAAAGTTGG + Intergenic
903510431 1:23870561-23870583 TGTCTTGGGGAAGATAAAATGGG + Exonic
903541074 1:24096663-24096685 TGTCTTGGGCAGTAGACAGGTGG - Intronic
903850454 1:26302705-26302727 TGTCTTGGGGAATACAAAGAAGG - Intronic
904279527 1:29409183-29409205 TGTCTTTGGAAGGGCAAAGAGGG + Intergenic
904599104 1:31664140-31664162 GGTCCTGGGGAGGGGAAGGAAGG + Intronic
904751719 1:32744732-32744754 TGTCTTGTGGGGAAGAAAGGGGG + Intronic
904873639 1:33636846-33636868 TCCCTTGGGGAGGAGCAAGCAGG - Intronic
905290493 1:36918648-36918670 TGTCTGGGGGAGGACACAGCTGG - Intronic
906608918 1:47189006-47189028 TGTCTGGGGCAGGAGAAAGGTGG + Intronic
906928147 1:50141276-50141298 TTTGTTGGGGAGCTGAAAGAAGG + Intronic
907207734 1:52788922-52788944 TTTATTTGGGAGGAGAAAAATGG + Intronic
908352940 1:63303904-63303926 TGTGTTGGGGAGGAGGAAGAAGG + Intergenic
908457866 1:64321706-64321728 TGTCCTGGGGAGGTCAAAGAAGG - Intergenic
908950366 1:69554002-69554024 TGTCTTAGAGAATAGAAAGAAGG - Intergenic
910168275 1:84351167-84351189 TAACTTGAGGAGGAGGAAGAGGG - Intronic
910422208 1:87078574-87078596 TGGCTTGGGGAGAAGAAATAAGG - Intronic
910452307 1:87359781-87359803 AGTTTTGGGGAAGAGATAGAAGG + Intergenic
913483486 1:119312078-119312100 GGTCTTGGGGAGGGTAGAGAGGG + Intergenic
913540808 1:119819026-119819048 TGTCATGGGGTGGGGGAAGAGGG - Intergenic
913675874 1:121139698-121139720 TGCCTTGGGGAGAAAAAGGAGGG - Intergenic
914027770 1:143927638-143927660 TGCCTTGGGGAGAAAAAGGAGGG - Intergenic
914245076 1:145879490-145879512 TGACTTGTGGAAGAGAAAAAGGG - Intronic
914964854 1:152246851-152246873 TGTCTGGTGGAGAAGAAAAATGG - Intergenic
915912661 1:159924312-159924334 TGTAGTGGGGAGGAGAAACTGGG + Intronic
915934438 1:160082477-160082499 TGTCTTGGGGTAGAGAAGGTAGG - Intronic
916003830 1:160641414-160641436 TGATTGGGGGAGGAGAAAGAGGG + Intronic
916796040 1:168168179-168168201 TATTTTGGGAAGGAGAAAAAGGG - Intergenic
916971997 1:170030770-170030792 TGACTTGGGAATGAGGAAGAAGG + Intronic
917613196 1:176710922-176710944 TGTTTTGAGCAGGAGGAAGAAGG - Intronic
917787386 1:178473247-178473269 TGTCTGTGGAAGGAGACAGAAGG + Exonic
917897907 1:179510398-179510420 TGTCTTGGGTCTGAGAAAGAAGG + Intronic
918069555 1:181124911-181124933 TGTCTGGGACAGAAGAAAGATGG - Intergenic
918626622 1:186663092-186663114 TGTGTTGGGGGGGAGGAGGAAGG - Intergenic
918833024 1:189423085-189423107 TGTCTTTGGGAGGCCAAAGCAGG + Intergenic
920185542 1:204156979-204157001 GGTCTTGGGGAGGGGAAGAAAGG - Intronic
920333760 1:205230212-205230234 TGCCTTGGGGAGGAGTGAAAAGG + Intronic
920390031 1:205594096-205594118 TGTCCTGAGTAGCAGAAAGATGG - Intronic
920463242 1:206158535-206158557 TGCCTTGGGGAGAAAAAGGAGGG - Intergenic
920957777 1:210634889-210634911 TATCTGAGGCAGGAGAAAGAGGG + Intronic
921024640 1:211266062-211266084 TGTCTTGGGAAAGAGAAAATAGG + Intronic
921062704 1:211599135-211599157 TGTCTAGTGGAGAAGAAAGTTGG + Intergenic
921614831 1:217253964-217253986 TGACTTTGGGAGGAGGAACAAGG + Intergenic
922024398 1:221737312-221737334 TGTCTTGGGGAGCAAAGAGGAGG - Intronic
922027346 1:221762948-221762970 TGGATTGTGGAGGAGAAACAAGG + Intergenic
923142490 1:231172488-231172510 TGTGGTGTGGAGGAGAGAGAGGG + Intronic
923815408 1:237371892-237371914 TGTCGTGGGGTGGGGAGAGATGG + Intronic
924106500 1:240654447-240654469 TCTCTTCGGGAGGAGGCAGAAGG - Intergenic
924507834 1:244702836-244702858 GGACTTGGGAAGGAGAATGAGGG + Intronic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1063159252 10:3407935-3407957 GCTCTTGGGGAGGATGAAGATGG + Intergenic
1063228553 10:4040910-4040932 TCTCATGTGGTGGAGAAAGAGGG + Intergenic
1063383131 10:5598936-5598958 AGTCTTTGGGTGGAGAAAGCCGG + Intergenic
1063490994 10:6463734-6463756 TGTCATGGGGAGCAGGAAGTGGG + Intronic
1063492218 10:6475014-6475036 TGTCTTGGCAAGAGGAAAGAAGG - Intronic
1064793830 10:18989275-18989297 TGTCATGGGGTGGGGGAAGAGGG - Intergenic
1065036093 10:21639898-21639920 TGTCTTGGGGAGAAAAAGGAGGG + Intronic
1067529858 10:47062215-47062237 TGTCTCAGGAAAGAGAAAGAAGG + Intergenic
1067566311 10:47340204-47340226 TGCTTTGGGGATGAGAAAGCTGG - Intergenic
1068353104 10:55875485-55875507 TGACTTGGGCAAGAGAAAAATGG - Intergenic
1070557998 10:77544970-77544992 TCACTTGGGGAGGAAGAAGATGG - Intronic
1070575007 10:77671058-77671080 AGACTTGGGGGAGAGAAAGAGGG + Intergenic
1070963659 10:80516492-80516514 TGTATTGGGGAGGAGAATGGTGG + Intronic
1071745278 10:88411776-88411798 TGTTTTGGGAAGAAGTAAGAAGG + Intronic
1071990004 10:91092483-91092505 TGTCTAGAGTAGGAGGAAGAGGG + Intergenic
1072372213 10:94775250-94775272 TGTCTTGGGGATGGGGAGGATGG + Intronic
1072387103 10:94942050-94942072 TGTCTTGGGGATGGGGAGGATGG + Intronic
1072845505 10:98825887-98825909 TGACTATGAGAGGAGAAAGATGG + Intronic
1073823540 10:107292465-107292487 GGACTTGGGGTGGAGCAAGATGG - Intergenic
1074542712 10:114378724-114378746 TGTCTTGAGGAGCTGGAAGATGG - Intronic
1074869179 10:117563748-117563770 TGTGTTGGGGAGATGAATGAGGG + Intergenic
1075085413 10:119411331-119411353 TGTCTGGCGGAGGAGAAAGTGGG - Intronic
1075816899 10:125271507-125271529 TGTCTAGGGGAGGGGAATGCAGG + Intergenic
1077377008 11:2209821-2209843 GGTCTTGGAGATGAGACAGAGGG - Intergenic
1079031162 11:16987398-16987420 TGTCTTAAGGAGGAAAAGGAGGG - Intronic
1080712044 11:34758029-34758051 TGGGTTGGGGAGGAGAGAGTAGG + Intergenic
1081078962 11:38715002-38715024 TGTCATGGGGAATAGAAGGAAGG - Intergenic
1081715890 11:45250132-45250154 TGTATAGGGCAGGAGAAAGCTGG - Intronic
1082285812 11:50317090-50317112 TTTTTTGGGGAGGTGAAGGAAGG - Intergenic
1082943603 11:58734835-58734857 TGTCATGGGGATCAGAAATAGGG - Intergenic
1084508950 11:69590488-69590510 TGTCGTGGGGTGGGGGAAGAGGG + Intergenic
1084715276 11:70869731-70869753 TGTCTGGGGGAGGACAATCAAGG - Intronic
1084966406 11:72746918-72746940 TGGGTTGGGGAGGAGAGAGGGGG + Intronic
1085348032 11:75780671-75780693 TGTTGTGGGGAGCAGAGAGAAGG + Intronic
1085459638 11:76685849-76685871 TGCCTTGGGGAGGAGAGGCAGGG + Intergenic
1085486537 11:76868562-76868584 TGCCTTGGGTAGGTGAAAGAAGG - Intronic
1086001896 11:81993378-81993400 CGTCTAGGGGAGCATAAAGATGG - Intergenic
1086156759 11:83675837-83675859 TTGCTAGGGGAGAAGAAAGAAGG - Intronic
1087934733 11:104019030-104019052 TTTCCTGGTGAGGAGATAGAGGG - Intronic
1088045635 11:105447985-105448007 AGACTTGGGGTGGAGCAAGATGG + Intergenic
1088201917 11:107346461-107346483 TACCTTGGGGAGGAGAAAGAAGG + Intronic
1088246438 11:107822506-107822528 TGTTCTGGGGAGAAGAAAGAGGG - Intronic
1088322377 11:108567456-108567478 GGTTTTGGAGAAGAGAAAGATGG - Intronic
1089915808 11:122154731-122154753 TGTGTTGAGGAGGAAAATGAGGG + Intergenic
1090064518 11:123491612-123491634 TGGCTTGGGCAGGAGGCAGAGGG + Intergenic
1090115618 11:123968908-123968930 TGTCATGGGGTGGGGGAAGAGGG + Intergenic
1091016442 11:132055270-132055292 TGTCTTTGAGAGGTGAAACATGG - Intronic
1091565584 12:1645774-1645796 AGCCTAGGGGAAGAGAAAGAAGG - Exonic
1091813640 12:3419951-3419973 TGGTTTGAGGGGGAGAAAGAGGG + Intronic
1091893856 12:4084545-4084567 TGCCTAGAGGAGGTGAAAGAGGG - Intergenic
1092008060 12:5086299-5086321 TCTCTTGGGCATGAGAAAGCTGG - Intergenic
1092042048 12:5393764-5393786 TTTCAAGGGAAGGAGAAAGAAGG - Intergenic
1092546626 12:9457590-9457612 TGCCTTGGGCAGGTGAAAGGAGG + Intergenic
1094506311 12:31064494-31064516 TGCCTTGGGCAGGTGAAAGGAGG - Intergenic
1095380107 12:41580884-41580906 TATCTTGGGGAGATGAATGATGG + Intergenic
1095460332 12:42436782-42436804 TGTCTTGGGCAGGATGAAGCAGG + Intronic
1096317793 12:50583808-50583830 TGTCATGGGGAGAAAAAAGTGGG - Intronic
1097036826 12:56129602-56129624 TGGAAAGGGGAGGAGAAAGAGGG + Intronic
1097297994 12:57987881-57987903 ATTCTTGGGGAGGACAGAGAAGG + Intergenic
1097308454 12:58093954-58093976 CATCTTGGGGAAGAGAAGGAAGG + Intergenic
1097674713 12:62587114-62587136 TGTTTTTATGAGGAGAAAGAAGG + Intronic
1098213038 12:68186290-68186312 TGTGTTTGGGAGGACAAACAGGG - Intergenic
1099169355 12:79345143-79345165 TGTCTGTGGGAGGAGGAGGAGGG - Intronic
1100231481 12:92612701-92612723 TGTGCTGGGCAGGATAAAGAAGG - Intergenic
1101333532 12:103776774-103776796 TGGCCAGGGGAGGAGGAAGATGG - Exonic
1101346157 12:103888214-103888236 TGTGATGTGGAGGAGAGAGAAGG - Intergenic
1101405248 12:104422862-104422884 TGTCTTTGGAACCAGAAAGAGGG - Intergenic
1101551318 12:105764943-105764965 GAGCTTGGGTAGGAGAAAGACGG + Intergenic
1102731403 12:115114154-115114176 TGTCTGGGGGAAGAGGGAGAGGG - Intergenic
1103367435 12:120393613-120393635 AGTCTTTGGGATGAGATAGAGGG - Intergenic
1103728433 12:123010656-123010678 TGTCTGCGTGAGGAGAAGGATGG + Intronic
1106086628 13:26548485-26548507 TGCGTTGGAGAGGAGAAAGGAGG - Intergenic
1106154302 13:27138411-27138433 TGTCTTGGGCAGCTGAGAGATGG + Intronic
1106323052 13:28659775-28659797 AGTGGTGGGGAGGAGAAGGAGGG - Intronic
1107313521 13:39106027-39106049 TTTCTTGCTGAGGAGAAAGAGGG - Intergenic
1107856675 13:44623194-44623216 TGTCTTTGGAAGGAAAAAAATGG - Intergenic
1107957622 13:45531826-45531848 TGTAGTGGAGAGGAGAAAGATGG + Intronic
1108257605 13:48625782-48625804 TGTCTTGGGAAGCTGAGAGATGG - Intergenic
1109775047 13:67029775-67029797 TGAGTTGGGGAGTAGAAAAATGG - Intronic
1110747474 13:79071288-79071310 AGTCTTGTGGAGGAGACAGAGGG + Intergenic
1110782157 13:79479137-79479159 TGTAATGAGGAAGAGAAAGAGGG - Intergenic
1110799078 13:79673807-79673829 TGGCTCTGGGAGGACAAAGAAGG + Intergenic
1111745470 13:92263420-92263442 TGTATTGGAGAGGAAAAAGAAGG - Intronic
1112913857 13:104522605-104522627 TGTTCTGGGGCGGGGAAAGAAGG - Intergenic
1113085571 13:106567158-106567180 CGGCTTGAGGAGGAGAGAGAAGG - Intronic
1113790859 13:113027421-113027443 CGTCTTGGTGGGCAGAAAGAAGG + Intronic
1114936899 14:27549521-27549543 TGTCATGGGAAGGACTAAGAAGG + Intergenic
1115362847 14:32523172-32523194 TGTCTTGGGGTGGGGGAAGGGGG + Intronic
1115567814 14:34639714-34639736 TGCCTTGGGCAGGTGAAAGAAGG + Intergenic
1116732701 14:48644768-48644790 TGTCGTGGTAAGGAGAAGGAGGG + Intergenic
1117485533 14:56193226-56193248 TGTCTTGGGCTGGGGACAGACGG - Intronic
1117521414 14:56555046-56555068 TTTCTGGGGGAGGGGAAAGGGGG - Intronic
1117901448 14:60538127-60538149 TGTCGTGGGGTGGAGGGAGAGGG - Intergenic
1117938350 14:60933948-60933970 TTTCTTGGGAATGAGAAATAAGG + Intronic
1118390547 14:65291839-65291861 GGTCTTGGGCAGGAAAAGGAAGG - Intergenic
1118935312 14:70282676-70282698 CCTCTTAGGCAGGAGAAAGAAGG - Intergenic
1118980157 14:70709895-70709917 TGGCCTGGGGAGGAGCAAGCTGG + Intergenic
1119302279 14:73580897-73580919 TCACTGGGGGAGGAGAAAGGGGG + Intergenic
1119869976 14:78008676-78008698 TGTCTAGGGCAGGAGACACAGGG - Intergenic
1121214130 14:92234128-92234150 TGTTTTATGTAGGAGAAAGATGG + Intergenic
1121669453 14:95696648-95696670 TGGGAAGGGGAGGAGAAAGAAGG + Intergenic
1122216190 14:100206288-100206310 TGCCTTGGGCAGGTGAAAGGAGG - Intergenic
1122300371 14:100727852-100727874 AGTCTGGGGTAGGGGAAAGAGGG + Intronic
1122642545 14:103168714-103168736 GGTTTGGGGGAGGGGAAAGAAGG - Intergenic
1122645917 14:103193870-103193892 GGTCTTGGGCAGGAGGAAGGAGG + Intergenic
1123978556 15:25577155-25577177 TTCCTTGGGGATGAGATAGATGG + Intergenic
1124785460 15:32674939-32674961 TGTCAAGGGAATGAGAAAGAAGG - Intronic
1125319274 15:38466288-38466310 TGTATTGGGATGGAGAGAGAGGG - Intronic
1125519151 15:40338657-40338679 TGCCCTGGGGAGGATGAAGATGG + Exonic
1125520041 15:40343459-40343481 TGGGTCTGGGAGGAGAAAGAAGG - Intergenic
1126386666 15:48100498-48100520 TGGCTATTGGAGGAGAAAGAGGG - Intergenic
1126948390 15:53851561-53851583 TGCCTTGGGCAGGTGAAAGGTGG - Intergenic
1127323667 15:57872711-57872733 AGTCTTGGGGAGCAGAAAGTAGG - Intergenic
1127611822 15:60644694-60644716 TCTCTTTGGGAAGAGAGAGAAGG - Intronic
1127905989 15:63376442-63376464 TGTTTGTGTGAGGAGAAAGAGGG - Intronic
1127962730 15:63901846-63901868 TGCCCTAGGGAGGAAAAAGAGGG - Intergenic
1127980247 15:64029652-64029674 TGTGTTGGGGAGGAGACTTAGGG - Intronic
1128106396 15:65048657-65048679 TGTCTTGGGGAGGAGGAGGAAGG - Intronic
1128596049 15:68950595-68950617 TGTGTCAGGGAGGAGAGAGACGG - Intronic
1129076175 15:72998213-72998235 TGTCTTGGGGAAAAAAAAAAAGG - Intergenic
1129540683 15:76345308-76345330 TGCCTAGGGGAGGACACAGATGG + Intergenic
1129888504 15:79055616-79055638 GGTGTTGGGGAGCAGAAAGCAGG - Intronic
1130199449 15:81811324-81811346 TGTGCTGGGGAGGAGAGAGGAGG - Intergenic
1130693171 15:86104178-86104200 GGTATTGGGGAGGATAAAGATGG + Intergenic
1130767087 15:86881598-86881620 TGGCCAGGGGAGGAGGAAGATGG + Intronic
1131018244 15:89075512-89075534 TGTGAAGGGGAGGAGAAGGAGGG + Intergenic
1131064940 15:89428516-89428538 TCTATTAGGAAGGAGAAAGAGGG + Intergenic
1131382607 15:91976183-91976205 TGTACTGGGGAGAAGATAGATGG + Intronic
1131733236 15:95304268-95304290 TGTTCTGGGGAGCAGAAAGCCGG + Intergenic
1131848886 15:96516831-96516853 TGTCTTGGGGTGGAGGGAGGGGG - Intergenic
1131873126 15:96780634-96780656 AGGCCTGGGGAGGAGAAAGGAGG - Intergenic
1132107831 15:99076828-99076850 ACTCTTGGGGAGGTGAAGGACGG - Intergenic
1132330106 15:101006736-101006758 TGTATTTGTGTGGAGAAAGAGGG + Intronic
1133913482 16:10087005-10087027 TGAATTGGGGAGGAGGAACAAGG + Intronic
1135075464 16:19389578-19389600 TGCCTTTGGGAAGAGAAGGACGG - Intergenic
1137247326 16:46716631-46716653 TGCCTTGGGCAGGTGAAAGAAGG - Intronic
1137705146 16:50530250-50530272 TGTATAGGGGATGAGAAAGTGGG + Intergenic
1137791612 16:51179753-51179775 TGTCTTGGGGAGGGGAGAAGAGG + Intergenic
1139363843 16:66421099-66421121 AGTCCTGAGGATGAGAAAGATGG - Intergenic
1140830098 16:78742940-78742962 TGGCTTGTGGAAGAGTAAGAGGG + Intronic
1140906017 16:79409702-79409724 AAACTTGGGGAGGAGGAAGAGGG + Intergenic
1141115212 16:81302759-81302781 GGTTTTGGGAAGGAGAAAGGAGG - Intergenic
1141248647 16:82334568-82334590 TGTCGTGGGGTGGGGAAAGGGGG - Intergenic
1141351571 16:83303105-83303127 CATCTTTGGGAGGAGAAGGAAGG + Intronic
1141483474 16:84322859-84322881 TGTCTTGGGCAGGACAAGGAGGG - Intronic
1141808478 16:86357988-86358010 GGTGGTGGGGAGGGGAAAGAGGG - Intergenic
1142027776 16:87823769-87823791 TGTCTCAGGGAGGAGAAAACAGG - Intergenic
1142782572 17:2192569-2192591 TTTCTTTGGGAGGAGACAGTGGG - Intronic
1143414497 17:6736083-6736105 TATCTTGGGGTGGAGACTGAAGG + Intergenic
1143994871 17:10997641-10997663 TTTCTTGGGTAGGAGAGAAAAGG + Intergenic
1144008535 17:11123445-11123467 TGTTTTGGGGAGACGAACGAAGG - Intergenic
1144146520 17:12404417-12404439 TGTCTTGGGGATGAGGAAATTGG - Intergenic
1144435105 17:15233102-15233124 TGTCTTGGGTTGCAGACAGAGGG - Intronic
1144523212 17:15968122-15968144 TGTCTTGGGGAGAAGTAACAAGG + Intronic
1144765270 17:17729103-17729125 AGTGTTGGGGAGGAGCAAGGTGG - Intronic
1144863006 17:18317545-18317567 TGTATTGGGAAGGAGAGCGATGG + Exonic
1145947409 17:28787344-28787366 AGGCTGGGGGAGGAGAAGGAAGG - Intronic
1146539142 17:33679805-33679827 GCTTTTGGGGAGCAGAAAGAAGG + Intronic
1146809868 17:35894525-35894547 TGCCTTGGGCAGGTGAAAGGAGG + Intergenic
1147168928 17:38606896-38606918 TTTCTTGCGGAGGAGAAGGTGGG + Intergenic
1147576447 17:41602591-41602613 TGTTTCGGGGAGCAGACAGAAGG + Intergenic
1147690042 17:42309304-42309326 TGACTTGGGGAGGGGACCGAGGG - Intronic
1147738860 17:42659165-42659187 TGTGTTGGGGAGGAGAGGAACGG - Intergenic
1148345907 17:46903716-46903738 TGGCTTGGGGAGTAGATGGATGG + Intergenic
1149536178 17:57435352-57435374 TGTGTTGGGGAAGAGGCAGATGG + Intronic
1150232453 17:63564101-63564123 TATCTTGGGGATGACATAGAGGG + Intronic
1150439465 17:65179523-65179545 TTTCCTGGGGAGGAGAGAGAGGG + Intronic
1150475755 17:65473330-65473352 TGTCTTGCTGAAGAGAAAGAAGG - Intergenic
1151221969 17:72619590-72619612 TGTTCTGGGGAGAAGAGAGAAGG - Intergenic
1151412553 17:73940959-73940981 AGTGCTGGGGAGGAGATAGAAGG + Intergenic
1151809106 17:76425957-76425979 TCTTGTGGGGAGGAGATAGAAGG - Intronic
1152354830 17:79801629-79801651 TCTCCTAGGGAGGAGAAAGTGGG - Intronic
1152412277 17:80133486-80133508 TGCCTTGGGGAGGAGATGGCAGG - Intergenic
1152492613 17:80647708-80647730 TGTCTAGGGGAGGAGGCGGAAGG + Intronic
1152627558 17:81394809-81394831 GGTCATGGGGAGGAGAGAGCCGG + Intergenic
1153157973 18:2170503-2170525 TGTATTCAGGAAGAGAAAGATGG - Intergenic
1153245129 18:3065931-3065953 TACCTTTGGCAGGAGAAAGAAGG + Intergenic
1153644633 18:7184344-7184366 TGTCTTTTGAAGGGGAAAGACGG - Intergenic
1153666474 18:7371111-7371133 TGGCCTGGGCAGGAAAAAGATGG + Intergenic
1153705704 18:7743012-7743034 TGTCTGACGGATGAGAAAGAGGG + Intronic
1155233667 18:23798052-23798074 AGGGATGGGGAGGAGAAAGAGGG - Intronic
1155649621 18:28125478-28125500 TGTATTGGGGAGGGAAAAAATGG + Intronic
1155707695 18:28837288-28837310 TGGCTGGAGCAGGAGAAAGATGG + Intergenic
1156476292 18:37407768-37407790 TGTCCTGGAGAGCAGACAGAAGG - Intronic
1156628127 18:38934327-38934349 TGTCTTGAAGAAGAGCAAGAAGG + Intergenic
1157825326 18:50806962-50806984 CGTCTTTAGTAGGAGAAAGAAGG - Intronic
1157931773 18:51831539-51831561 TGTCGTGGGGTGGAGGAAGAGGG + Intergenic
1157977381 18:52341657-52341679 TGGCTAGTGCAGGAGAAAGAGGG + Intronic
1158236876 18:55325604-55325626 TATATTCGGGAGGAGAAAAATGG - Intronic
1158277534 18:55784600-55784622 ATACTTGGGGTGGAGAAAGATGG - Intergenic
1158362311 18:56688723-56688745 TGTCTTGGGGAAAAAAAAAAAGG + Intronic
1158797942 18:60871305-60871327 TGTCATGGGCAGGTGAAAGGAGG - Intergenic
1158847493 18:61459925-61459947 TGTCTGGGGAAGGAGAGACAGGG + Intronic
1158881085 18:61780328-61780350 TGCCTTGGGGAGGAATAAAAAGG - Intergenic
1158966109 18:62623709-62623731 TGTGAAGGGGAGGAGAAACAGGG - Intergenic
1159210470 18:65314729-65314751 AAGCTGGGGGAGGAGAAAGAAGG + Intergenic
1159752065 18:72314885-72314907 TGTCTGGAGTAGGAGAAAGCGGG - Intergenic
1160109034 18:76007380-76007402 TTTCTTAGGGAGGAGAAGAAGGG + Intergenic
1160146532 18:76370269-76370291 TGTATTGGGGAGGAGGAAGTCGG - Intronic
1160539619 18:79613451-79613473 TTTCATAGGGAGGAGAGAGAGGG + Intergenic
1160690173 19:458012-458034 GGTCTTGGGGAGGCGGAAGTAGG + Intronic
1160690188 19:458054-458076 GGTCTTGGGGAGGCGGAAGCGGG + Intronic
1160690195 19:458075-458097 GGTCTTGGGGAGGCGGAAGTGGG + Intronic
1160690210 19:458117-458139 GGTCTTGGGGAGGCGGAAGTGGG + Intronic
1160690263 19:458266-458288 GGTCTTGGGGAGGCGGAAGTGGG + Intronic
1160690279 19:458308-458330 GGTCTTGGGGAGGCGGAAGCGGG + Intronic
1160690324 19:458434-458456 GGTCTTGGGGAGGCGGAAGTGGG + Intronic
1160690402 19:458646-458668 GGTCTTGGGGAGGCGGAAGTGGG + Intronic
1160690428 19:458710-458732 GGTCTTGGGGAGGCGGAAGTGGG + Intronic
1160690469 19:458815-458837 GGTCTTGGGGAGGCGGAAGAGGG + Intronic
1160755496 19:754974-754996 TGGCTTGGGGTGGAGGAAGAGGG + Intronic
1160894135 19:1394916-1394938 TGGCTTGGGGCTCAGAAAGAGGG + Intronic
1161199210 19:3005293-3005315 TGTCTGGGGGACAAGAAAGATGG + Intronic
1162373041 19:10290265-10290287 TGTGTTGGGGAGGAGGGGGAAGG - Intronic
1162472855 19:10882845-10882867 AGTCTTGGGGAGCAGAGAGAAGG + Intronic
1163993144 19:21018125-21018147 TATCATGGGGAGGAGAAGCAAGG + Intergenic
1164037386 19:21466794-21466816 TGTAGTGGGGAGGAGCAAGGAGG - Intronic
1164394209 19:27849914-27849936 TGGCTTGGGGAGTGTAAAGAAGG - Intergenic
1164877238 19:31700085-31700107 TGTCCTGGGAGGGAGACAGATGG + Intergenic
1165707347 19:37985993-37986015 TATCTGGGGAAGGAGAAAGTGGG - Intronic
1165972130 19:39640378-39640400 TGCCTTGGGGAAAAGAAGGAAGG + Intergenic
1167572569 19:50298271-50298293 TGCCTTGTGCAGGTGAAAGAGGG + Intronic
1168115776 19:54220827-54220849 TGTCCTGGAGAGAAGAAGGATGG + Exonic
1168118760 19:54240573-54240595 TGTCCTGGAGAGAAGAAGGATGG + Exonic
1168125091 19:54278559-54278581 TGTCCTGGAGAGAAGAAGGATGG + Exonic
1168127451 19:54293771-54293793 TGTCTAGGGGTGGGAAAAGAAGG + Intergenic
1168136572 19:54356004-54356026 TGTCTTGGGGAGAAAATACATGG + Exonic
1168171371 19:54592071-54592093 TGCCTTGGGCAGGTGAAGGAAGG + Intronic
1168172168 19:54596170-54596192 TGTCCTGGAGAGAAGAAGGATGG - Exonic
1168176068 19:54628836-54628858 TGCCTTGGGCAGGTGAAGGAAGG + Intronic
1168176891 19:54632997-54633019 TGTCCTGGAGAGAAGAAGGATGG - Exonic
1168182610 19:54672329-54672351 TGTCCTGGAGAGAAGAAGGATGG - Intronic
1168187681 19:54710088-54710110 TGTCCTGGAGAGAAGAAGGATGG - Intergenic
925169733 2:1743625-1743647 AGGCTGGGGGAGGAGAAGGAAGG + Intronic
925640150 2:5979321-5979343 TGTTTTGGGGAGGATAATAATGG + Intergenic
925874564 2:8300967-8300989 TGTTTTAGGAAGGAGATAGATGG - Intergenic
926377499 2:12248292-12248314 TGTCTTGGGTTAGAGAAATATGG + Intergenic
926623614 2:15070832-15070854 TTTCTTTGGAAGAAGAAAGAGGG + Intergenic
926659371 2:15446101-15446123 TGTATTGGGAAGGAGAAACAAGG + Intronic
927057873 2:19384116-19384138 TGTCGTGGGGTGGAGAGAGGTGG - Intergenic
927144469 2:20153502-20153524 TCTGTTGGGGAGGGGAGAGAAGG + Intergenic
927256885 2:21047479-21047501 TCTCTTGGGTAGCAGAATGATGG - Intergenic
928275372 2:29895866-29895888 TGGCTTGGGGTGAAGAAAGAGGG + Intronic
928404391 2:31003590-31003612 AGTGGTGGGGAGGAGAGAGATGG - Intronic
928412881 2:31067903-31067925 AGTCTTGGGGAGGAGCAGGCAGG + Intronic
928935780 2:36676552-36676574 AGTCTTTGGGAGCAGTAAGAAGG + Intergenic
928977641 2:37105354-37105376 TGTGCTGGGGAGGAGAAGCAAGG + Exonic
929747534 2:44674344-44674366 AGTCTAGTGGAGGAGACAGATGG - Intronic
930775674 2:55167742-55167764 TGTCTAGAGGAGGAGAAACAAGG - Intergenic
931164349 2:59730330-59730352 TATTTGGGGGAGGAGAGAGAAGG + Intergenic
931506754 2:62936638-62936660 TGTCTTGGCTTGGAGAAAGTTGG + Intronic
931686076 2:64795278-64795300 AGACTTGGAGAGGAGAAAGCAGG + Intergenic
932030793 2:68182446-68182468 TGTGTAGGGTAGGAGATAGAGGG - Intronic
932511401 2:72296270-72296292 TGTTTGGGGGAGAAGAAACATGG + Intronic
932572306 2:72944489-72944511 TGGCATGGGGAGGGGAGAGAAGG - Exonic
932975431 2:76594510-76594532 GTTCTTGGGGAGATGAAAGAAGG - Intergenic
933553876 2:83808152-83808174 TGCCTTGGGCAGGTGAAAGAAGG + Intergenic
933662951 2:84942610-84942632 GGTCTTGTGCTGGAGAAAGAGGG - Intergenic
934498571 2:94833772-94833794 TGTCGTGGGGTGGAGGAAGGGGG + Intergenic
934547943 2:95234349-95234371 TGCCTTGGGCAGGTGAAAGAGGG - Intronic
935386515 2:102505069-102505091 TCTCTTAGGGAGGGAAAAGAGGG + Intronic
936293945 2:111250802-111250824 TGTATCAGGGAGAAGAAAGATGG - Intergenic
937243225 2:120475858-120475880 TGCCGTGGGGAACAGAAAGAGGG + Intergenic
937577164 2:123437723-123437745 TTTCATGGGGGGTAGAAAGAAGG + Intergenic
938323210 2:130379555-130379577 GGCATTGGGGAGGAGAAAGAAGG - Intergenic
938736650 2:134191893-134191915 TGGCGTGAGCAGGAGAAAGAGGG - Intronic
939562683 2:143751218-143751240 TGTCTCCGGGAGGATGAAGATGG + Intronic
939726898 2:145731967-145731989 TGTGTTGGGGAAGAGAAATGAGG + Intergenic
939956626 2:148532833-148532855 CGTGGTGGGGAGGACAAAGATGG + Intergenic
940393623 2:153162449-153162471 AGTTTCGGGGAGGAGAAAAAGGG - Intergenic
940972327 2:159907157-159907179 TGTTTTGAGGAGGAGGAGGAAGG + Intergenic
941453132 2:165683686-165683708 TGTCTTGGGTAGTAAAAAGAGGG + Exonic
942525187 2:176845516-176845538 TGGGTTGGGGTGGAGAAACAGGG + Intergenic
942711892 2:178846116-178846138 TCTCTAGGGGAGAAGAAAGTAGG + Intronic
943343769 2:186712857-186712879 TATTTTGAGGAGGAAAAAGAAGG - Intronic
944661964 2:201928813-201928835 TGACTTGGGAAGAAGAATGAGGG - Intergenic
945423519 2:209669392-209669414 TATGTTGGGGATGAGAGAGAAGG + Intronic
945866833 2:215185403-215185425 TTCTTTGGGGAGGAGAAAGGAGG + Intergenic
946093529 2:217251643-217251665 TGGCATGGTGAGGACAAAGAGGG - Intergenic
946719836 2:222592917-222592939 TGTCCTGGGGAGGTCAGAGAGGG - Intronic
946899430 2:224358004-224358026 TGTCATTGGGAGCACAAAGATGG - Intergenic
947268144 2:228304901-228304923 TGTTTTGGGGAGGAGGAAAGAGG + Intergenic
947295316 2:228624354-228624376 TGTTTTCTGGAGGATAAAGAGGG + Intergenic
947368158 2:229417702-229417724 TTTCTTGGGGAGGAGGCAGGCGG - Intronic
947644584 2:231729075-231729097 TGTGTTGGGGAGGAGAAAGGGGG - Intergenic
947743199 2:232494355-232494377 TGTGCAGGGGAGGAGACAGAGGG + Intergenic
948763010 2:240204215-240204237 TTTCTTGGGGAGGAAATAGCAGG + Intergenic
1168981153 20:2004941-2004963 GGTCTTGAGGAGGACAAAGCAGG - Intergenic
1169354019 20:4892804-4892826 TGACGTGGGGAGGAAAAAGGTGG + Intronic
1169963386 20:11187851-11187873 TGCCTTGGGCAGGTGAAAGAGGG + Intergenic
1170429984 20:16267058-16267080 TCTCTGGGGGAGGAGAGATAAGG - Intergenic
1170434221 20:16308567-16308589 TGTCTTGGGGAGGAGAAAGAGGG - Intronic
1170735879 20:19013805-19013827 TGTCCTGGGGAGAACTAAGAGGG + Intergenic
1170830703 20:19838256-19838278 TGTCTTGAGGAAGAGAGATATGG + Intergenic
1170907662 20:20530420-20530442 GGTGTTGTGGAGGAGAAATAGGG + Intronic
1172028711 20:31967340-31967362 GATCCAGGGGAGGAGAAAGATGG - Intergenic
1172191924 20:33067237-33067259 TGTCTTGGAGAGGAAAGAAAAGG + Intronic
1173004506 20:39129454-39129476 TGTGTTTGGGAGCAGAAAGCTGG + Intergenic
1173024826 20:39298227-39298249 TGTCTTCCGGAGGACACAGATGG + Intergenic
1173162031 20:40659963-40659985 TGTCTTGGGAAGGAAGAATATGG + Intergenic
1173253893 20:41379508-41379530 TGCCTGAGGGAGGAGAAACAGGG - Intergenic
1173283663 20:41651479-41651501 TTTCTTGTGGAGGTAAAAGAGGG + Intergenic
1173361364 20:42347342-42347364 TGAGTTGGGGAGGTGAAGGATGG - Intronic
1173481264 20:43401575-43401597 TGTCGTGGGGTGGAGGGAGAGGG - Intergenic
1173690271 20:44955392-44955414 TGAAGTGAGGAGGAGAAAGAAGG + Intronic
1174012806 20:47464171-47464193 TGTTTTGGGAAGGGGCAAGAGGG + Intergenic
1174036054 20:47668915-47668937 TGTTCTGAGGAGGAGGAAGATGG - Intronic
1174047004 20:47740888-47740910 TGGCTTCGGGAGGAGCAGGAGGG - Intronic
1174273573 20:49387076-49387098 TCTCTGGTGGAGGAGGAAGAGGG + Intronic
1174643430 20:52064993-52065015 TGTGCTGGGGAGGAGGGAGAAGG + Intronic
1175648506 20:60696310-60696332 TGTCTCTGGGAGAAGACAGAAGG - Intergenic
1175919669 20:62444788-62444810 TGCCTGGGGCAGGAGAAGGAGGG + Intergenic
1175923009 20:62458800-62458822 GGCCTGGGGGAGGAGGAAGACGG - Intergenic
1176659869 21:9624167-9624189 AGGCTTTTGGAGGAGAAAGAAGG + Intergenic
1177217657 21:18150703-18150725 TGTCTTGGGGAGAAATAATAAGG - Intronic
1177487882 21:21782889-21782911 TGGCTTAGAGCGGAGAAAGAGGG - Intergenic
1177817716 21:25996283-25996305 CTTCTGGGAGAGGAGAAAGAGGG + Intronic
1178234269 21:30823238-30823260 TGGCTTGAGCAGGAGGAAGAGGG - Intergenic
1178961662 21:37072145-37072167 GGTCTTGTGGAGGAGACAGATGG - Intronic
1179182256 21:39055365-39055387 TCTCTTGGGGAAGAGGAAGATGG - Intergenic
1179298302 21:40082762-40082784 GTTCTTGGAGAGGAGAAAAAAGG + Intronic
1179428776 21:41304328-41304350 TGGCGTGGGGAGGGGAAGGATGG + Intronic
1180094806 21:45550978-45551000 TGTTGTGGGGAGGAGAATGGAGG - Intergenic
1180214018 21:46313582-46313604 TGTGTTTGGGATGAGGAAGATGG + Intronic
1180652430 22:17389242-17389264 TAGCTTGGTGGGGAGAAAGAGGG - Intronic
1181179345 22:21055946-21055968 TGACTTGGGAAGAAGGAAGAAGG - Intronic
1181533162 22:23528653-23528675 TGTTTTGGGGGGGAGTAAGAGGG - Intergenic
1181692263 22:24570221-24570243 TGCCTTGGGCAGGTGAAAGGAGG + Intronic
1182086335 22:27563637-27563659 TGCCTTGGGGAGGGCAGAGAGGG - Intergenic
1182770670 22:32793982-32794004 AGTGTTGGGGAAGAGAAGGATGG + Intronic
1183367099 22:37412654-37412676 TTGTTTGGGGAGGAGAAAGGGGG - Intronic
1184364323 22:44040054-44040076 TTGCTTGGGGAGGAGCAGGAGGG + Intronic
1184366370 22:44054158-44054180 TGCCTTGGGCAGGTGAAAGGAGG + Intronic
1185394861 22:50581713-50581735 TGCCTTGGGGAGGAGAGGGTAGG + Intronic
949118411 3:356719-356741 TGTGTTGAGGAGGAGAAAAGAGG + Intronic
949534447 3:4985164-4985186 TTTCCTGTGGAAGAGAAAGATGG + Exonic
949942725 3:9167144-9167166 TCTCCTGGGCAGGAGAAAGGGGG + Intronic
950265680 3:11571099-11571121 TGTCGTGGGCAGGAAAAAGCTGG + Intronic
950792883 3:15487565-15487587 TTCCATGGGGAGGAGAAAGAGGG - Intronic
951173136 3:19566408-19566430 TGACTAGGGCAGGAGCAAGAAGG - Intergenic
951415794 3:22420002-22420024 TGTTTTGGGCAGGTGAAAGGAGG - Intergenic
951741060 3:25923834-25923856 TGTCTTGTAGAGGATGAAGAAGG + Intergenic
951964829 3:28370550-28370572 ACTATTGGGGAGAAGAAAGACGG + Intronic
951976997 3:28522109-28522131 TGTCATGGGGTGGAGGGAGAGGG + Intronic
951989028 3:28655222-28655244 TGTTTTGAGGTGAAGAAAGAAGG - Intergenic
952773447 3:37022485-37022507 TGGATTGGAGAGGAGCAAGATGG + Intronic
952854948 3:37762427-37762449 TGTCATGGGGGAGAGAAAGAAGG + Intronic
952871820 3:37907292-37907314 GGTCTAAGGGAGGAGAATGAAGG + Intronic
953996594 3:47524549-47524571 TGAACTGGGAAGGAGAAAGAAGG - Intergenic
954806274 3:53222736-53222758 CCTCTTTGGGAGGAGGAAGAGGG - Intergenic
954844458 3:53543352-53543374 TGTCAGGGTGAGGAGAAAGTGGG + Intronic
955042628 3:55332365-55332387 AATCTTGAGGAGGAGGAAGAAGG + Intergenic
955812859 3:62809398-62809420 TTGCTTGAGGAAGAGAAAGAAGG - Intronic
956172453 3:66443503-66443525 TGTGTAGGGGAAGAGAAAGGAGG + Intronic
956345020 3:68269025-68269047 TGTGTTAGAGATGAGAAAGAAGG - Intronic
956496070 3:69827451-69827473 TGTCTTGAATAGGAGAAAAAAGG + Intronic
956501344 3:69888854-69888876 TGTCTTGGTGAAGAGAAAAGGGG + Intronic
956823047 3:72971202-72971224 TTTCTGGGGGATCAGAAAGAGGG + Intronic
957413312 3:79868301-79868323 TGTGATGTGGAGGAGAGAGAAGG - Intergenic
957869040 3:86064201-86064223 TGTCGTGGGGTGGGGGAAGAGGG - Intronic
957938894 3:86978941-86978963 TGGTTTGGGGAGGAAAAAGATGG - Intronic
958030324 3:88100805-88100827 TGTCATGGGGTGGGGAAAGCGGG + Intronic
958433665 3:94071953-94071975 TGTTGTGGGGAGGAGAATGGAGG + Intronic
959801580 3:110501345-110501367 TGTCTGGGGGAGGGGATAAAGGG + Intergenic
959932205 3:111997260-111997282 TATCTTGGGGAGGAGCCATAAGG - Intergenic
959976035 3:112460836-112460858 TGACTTTGGGTGGGGAAAGATGG + Intergenic
960057144 3:113283803-113283825 CGGCTTGGGGAGGAGGAAGGAGG + Intronic
960364442 3:116753752-116753774 TCACTGGGGGAGGAGGAAGAAGG + Intronic
960655475 3:119999169-119999191 TCTCTTGAGAAGGAGAAAGAGGG + Intronic
961048001 3:123722504-123722526 TGTGTGGTGGAGGAGGAAGACGG + Intronic
961337975 3:126195957-126195979 TGTCATGGGGTGGGGGAAGAGGG + Intronic
961628340 3:128279053-128279075 TGAGTTGGGGAGGAGAATGGTGG + Intronic
961723478 3:128910824-128910846 TGTCTTGGGGGAGGGAAGGAAGG + Intronic
961746181 3:129064836-129064858 TGGCTTTGGGAGGACAAAGCAGG - Intergenic
961789928 3:129368405-129368427 AGTCCTGGGGAGGAGACATAGGG - Intergenic
962459042 3:135591768-135591790 GGGATTGGGGAGGAGAAGGAGGG - Intergenic
962911828 3:139859337-139859359 GGAGTTGGGGAGGAGAAAAAGGG - Intergenic
963129407 3:141844440-141844462 TGTGATGGGGCAGAGAAAGAAGG - Intergenic
963225546 3:142858132-142858154 TGGCTCTGGGAGGTGAAAGAGGG - Intronic
963508489 3:146217952-146217974 TGACTGGGAGAGGAGAGAGAAGG + Intronic
964177921 3:153847851-153847873 TGTCTTGGTGAGGATGATGATGG - Intergenic
964394238 3:156228803-156228825 TGTCTGTGGAAGGAGAAATAGGG - Intronic
964681378 3:159343680-159343702 TGTCATCTGGAAGAGAAAGAAGG + Intronic
965076790 3:163989429-163989451 TGTCGTGGGGTGGGGAAAGGGGG - Intergenic
965134590 3:164745726-164745748 TGTCTTGGGGAGGAAAATCACGG - Intergenic
965472319 3:169109940-169109962 TGTTTTAGGGAAAAGAAAGAAGG - Intronic
966302310 3:178493412-178493434 GGTCTTGGCAAGGTGAAAGAAGG - Intronic
967486540 3:190038693-190038715 TGTCTTGGGGATGAAATAAATGG - Intronic
967726791 3:192869657-192869679 TTTTATGGGGAGGAGAAAGGGGG - Intronic
968348008 3:198027510-198027532 GGGCTGGGGGAGGAGGAAGAGGG - Intronic
968929824 4:3572952-3572974 TGTCAAGGGGTGGAGAAAGATGG + Intergenic
972831017 4:42813847-42813869 TGTGTTGAGGAAGAGAAAAAAGG + Intergenic
972883081 4:43449063-43449085 TGGCCTGGGCAGGAGAGAGATGG - Intergenic
972943310 4:44223296-44223318 TATTTTGGGGTGGAGAAGGAAGG + Intronic
973670310 4:53210820-53210842 TGCCTTGGGTAGGTGAAAGGAGG - Intronic
973791187 4:54379592-54379614 TGGGTTTGGGATGAGAAAGATGG + Intergenic
973802610 4:54493937-54493959 CTTCTTGGTGAGGAGAAGGAAGG - Intergenic
973816927 4:54627549-54627571 TGCCTTGGGCAGGTGAAAGGAGG + Intergenic
975569113 4:75794271-75794293 TTGCTTTGGGAAGAGAAAGAGGG - Intronic
975645061 4:76537783-76537805 TGACTTGGGGTGGAGCAAGGCGG - Intronic
975820402 4:78265366-78265388 TGTCTTGAGGGGGAAAAAAAGGG + Intronic
975947563 4:79726042-79726064 TATCTTGGGGAAAAGAAAGGAGG - Intergenic
976055014 4:81054028-81054050 TGACTTGTGGAGGAAAAACAAGG - Exonic
978728169 4:111995307-111995329 ATTCTTGGGGTGGAGAAAGTGGG - Intergenic
978766375 4:112409212-112409234 GGTCGTGGGGTGGAGAAAAAAGG + Intronic
978991614 4:115089109-115089131 TACCTTGGGGTAGAGAAAGAAGG - Intronic
978992616 4:115104314-115104336 TGCCTTGAGAAGGAGACAGATGG + Intronic
979136363 4:117116655-117116677 GGCTTTGGGGAGGAGAAAGGAGG + Intergenic
979275793 4:118812944-118812966 TCTCTAGGGGAGGATACAGATGG - Intronic
979535677 4:121817859-121817881 GGTCTGGGGGAGAAGAGAGAAGG - Intronic
980538059 4:134155343-134155365 TGTGTTGGGGGAGAGAAAGAAGG - Intergenic
980922952 4:139105452-139105474 TGTTTTGGGGAGTAAAAGGATGG - Intronic
981120033 4:141039301-141039323 TTTCTTTAGCAGGAGAAAGAAGG + Intronic
981310502 4:143293533-143293555 TTTCTGGGGGAGGAGCAAGGGGG - Intergenic
981460714 4:145010668-145010690 TGTCGTGGGGTGGGGAAAGAGGG + Intronic
981576520 4:146211721-146211743 TGTCTGGGGAAAGAGAAAGCTGG - Intergenic
981701625 4:147613675-147613697 TGTGTTGGAAAGGAGAAAAAAGG + Intergenic
981981548 4:150798992-150799014 TTTCTTCGGGAGAAAAAAGAAGG - Intronic
982122694 4:152157853-152157875 CGCCTTGGGGTGGAGATAGATGG - Intergenic
982944242 4:161598617-161598639 TTTCTTGGGACAGAGAAAGAAGG - Intronic
983311826 4:166074585-166074607 AGTTTTAGGTAGGAGAAAGAGGG - Intronic
983427122 4:167599444-167599466 TGATTTGGGGATGAGAAAGTTGG - Intergenic
983848869 4:172554572-172554594 TCTAGTGGGGAGGAGAAAGTAGG - Intronic
983978211 4:173963091-173963113 TGTCGTGGGGTGGGGAAAGGGGG - Intergenic
984302293 4:177937099-177937121 TGGCTTGGTGGGAAGAAAGAGGG + Intronic
984982965 4:185301008-185301030 TGCCTTGGGCAGGTGAAAGGAGG - Intronic
985035858 4:185839266-185839288 TGGCTTGGAGCAGAGAAAGAGGG + Intronic
985038097 4:185861479-185861501 AGGCTGGAGGAGGAGAAAGAAGG + Intronic
985493524 5:192441-192463 AGTCTTGGGGAGGGGACTGAGGG + Intronic
985795861 5:1961819-1961841 TGTCGTGGGGAGGACAGGGAAGG - Intergenic
986294462 5:6425909-6425931 TTTCTTGTGAAGGAGAAAGATGG - Intergenic
986333226 5:6733335-6733357 TCTCATGGGGAGGGGAATGATGG + Intronic
986399736 5:7369166-7369188 TGTGGTGGGGAGGAGGAAGAGGG + Intergenic
987318822 5:16748982-16749004 TGTCTCGGGGTAGAGACAGATGG + Intronic
988469822 5:31527451-31527473 TGTAAAGGGGAGGACAAAGAAGG - Intronic
988563717 5:32303443-32303465 TGGCTTTGGGAGGAGGAATAGGG - Intronic
988695863 5:33622174-33622196 TCTCTTGGGAATGAGAAAGAGGG - Intronic
989272319 5:39547893-39547915 TATCTTAGGGGGGAAAAAGAAGG + Intergenic
989523061 5:42423693-42423715 AGGCTTGGGGAGGAGAGAGGGGG - Intergenic
989720757 5:44525455-44525477 TGTCTTGTGGTGGGGAAAGAGGG + Intergenic
990067560 5:51737282-51737304 TGTTTTGGGGTGGAGAGAGGGGG - Intergenic
990177744 5:53126714-53126736 TGCCTTGGTGAGGAGAAAGGAGG - Intergenic
990671481 5:58135336-58135358 TGTCTTGGGGAGGAAAACAGAGG - Intergenic
991431765 5:66555459-66555481 TGGCAGGTGGAGGAGAAAGACGG - Intergenic
993443121 5:87980067-87980089 TCTCTAGGGAAGGAGAAAAAGGG - Intergenic
993443381 5:87981740-87981762 GATCTTGGGGAGGAGAATGTGGG - Intergenic
993906779 5:93632230-93632252 TGAGGTGGGAAGGAGAAAGAAGG + Intronic
994183341 5:96791569-96791591 TCTCTTGGGGAAGAAAAAGGAGG - Intronic
994240917 5:97419594-97419616 TGATGTTGGGAGGAGAAAGAGGG + Intergenic
995824188 5:116275099-116275121 TGCCTTGGGCAAGTGAAAGATGG - Intronic
996093719 5:119376569-119376591 TTTCTGGGGGAGCAGAAAGACGG - Intronic
997102850 5:130987800-130987822 TGACCTGGGGAGGGGAAGGAGGG - Intergenic
997639371 5:135438575-135438597 TGTCTTGGGCTGGGGGAAGAGGG + Intergenic
997963265 5:138338374-138338396 GGGCTGGGGGAGGGGAAAGAGGG - Intronic
998761344 5:145435403-145435425 TGTCTTGAGGAACAGAAAGAAGG + Intergenic
998947237 5:147352835-147352857 TGTCTTGGGGAGAAGGGAGGTGG + Intronic
999134609 5:149310171-149310193 TGGCTTGGGGAAGAGAGAAAGGG - Intronic
999234323 5:150081337-150081359 ATTCCTGGGGAGTAGAAAGATGG - Intronic
999411401 5:151353025-151353047 TGCCTTGGGCAGGTGAAAGGAGG + Intergenic
999508819 5:152226472-152226494 TCTCATTGGGAGGAGAATGAGGG + Intergenic
999549039 5:152663663-152663685 TGTGTAGGAGAAGAGAAAGAGGG + Intergenic
999866376 5:155704890-155704912 TGTCTTGGTGAGGAGGCAAAAGG - Intergenic
1000970194 5:167705576-167705598 TGTGGTGGGGAGGGGAAATAAGG + Intronic
1001118415 5:168958816-168958838 TGTATTGGGAGGGAGAAGGATGG - Intronic
1001162583 5:169334109-169334131 GGTTTTGGAGAGAAGAAAGAAGG - Intergenic
1001374140 5:171238633-171238655 TTTCTTGGGAAGGGGAAGGAGGG + Intronic
1002163719 5:177332244-177332266 TGTCTGGGGGAGAAGAAACGGGG + Exonic
1002340548 5:178514061-178514083 GGGCTGGGGGAGGAGAAAGTGGG - Intronic
1002524970 5:179810264-179810286 TGTCGTGGGGTGGGGGAAGAGGG - Intronic
1002626494 5:180533190-180533212 TGCCTTGGGCAGGGGAAAGGAGG + Intronic
1002982865 6:2159213-2159235 TGTGAGGGGGAGGAGACAGAGGG + Intronic
1002988810 6:2218339-2218361 GGACTTGAGGTGGAGAAAGATGG - Intronic
1003020929 6:2508827-2508849 TATTTTGGGGAGAAGGAAGAGGG + Intergenic
1003044582 6:2721597-2721619 AGTCTTGGGTAGCAGGAAGAAGG - Intronic
1003171785 6:3726191-3726213 TGTCTTGGGGAGAAGACAGATGG - Intronic
1003417237 6:5921470-5921492 GGGCTTGGGGAGGAGAAATGAGG + Intergenic
1004415909 6:15423913-15423935 TGTCTTGGGGAAAACAAAAACGG - Intronic
1004755394 6:18605141-18605163 TGTAGTAGGGAGGAGAGAGAAGG + Intergenic
1004919522 6:20363401-20363423 AGCCTTGGGGAGGAGAACAATGG + Intergenic
1005210236 6:23452335-23452357 TGTTTTGTGGAGAAGCAAGAAGG - Intergenic
1005378053 6:25205027-25205049 TTTCTTGGAAAGGACAAAGAAGG + Intergenic
1006029335 6:31167944-31167966 CGTCTTGGTGGGGAGAAAAAGGG - Intronic
1006132360 6:31877297-31877319 TGCCATGGGGAGGGGAAGGAAGG + Intronic
1006137153 6:31902068-31902090 GGACTCGGGGAGGAGGAAGAGGG + Intronic
1006388444 6:33745252-33745274 TGTGGAGGGCAGGAGAAAGAAGG + Intronic
1006825269 6:36930177-36930199 TATAGTGGGGTGGAGAAAGAAGG - Intergenic
1007048940 6:38806193-38806215 TGACCCGGGGAGGAGAAAGCAGG - Intronic
1007091575 6:39187979-39188001 GGTCGGGGGGAGCAGAAAGAGGG + Intergenic
1007167471 6:39839028-39839050 TCTCTGTGGGAGGAGAGAGAGGG - Intronic
1007368292 6:41409460-41409482 TGGAGTGGGGAGGAGAGAGAGGG + Intergenic
1007440905 6:41859214-41859236 AGTCATGGGGTAGAGAAAGAGGG - Intronic
1008887280 6:56444852-56444874 TGCCTTGGGGAAGAAATAGAAGG - Intergenic
1010048923 6:71480890-71480912 TGCCTTGAGTAAGAGAAAGAGGG + Intergenic
1010484885 6:76398407-76398429 AGACCTGGGCAGGAGAAAGAAGG - Intergenic
1011704836 6:89990460-89990482 TGTCTGGGAGAGGAGACACAGGG - Intronic
1011709125 6:90033202-90033224 TGTTTTGGGGAGGAGGGAGGGGG + Intronic
1012979048 6:105810811-105810833 GGTGGTGGGGAGCAGAAAGAGGG + Intergenic
1013074919 6:106762933-106762955 TGCCTTGGGCAGGTGAAAGAAGG - Intergenic
1013303169 6:108823068-108823090 TTTCTTGGGGGGCAGAAACAAGG - Intergenic
1013609769 6:111783712-111783734 TCTTTTGGGAAGAAGAAAGAGGG - Intronic
1014276751 6:119397381-119397403 GGTTTTGGGGAGGGGAAAGGAGG + Intergenic
1014610167 6:123533479-123533501 GGTTTTGGGGACTAGAAAGACGG + Intronic
1016112562 6:140243527-140243549 TGTCTTCAGGAGGAGAACAATGG + Intergenic
1016505478 6:144773925-144773947 TCACTTTGGAAGGAGAAAGAGGG + Intronic
1017368743 6:153678738-153678760 TGTCGTGGGGTGGGGAAAGGGGG - Intergenic
1017557237 6:155584299-155584321 TGTCTGGGGCAGGAAAAAAATGG + Intergenic
1017957893 6:159194100-159194122 TGTCTTTGAGTGGAGACAGATGG - Intronic
1018205713 6:161435904-161435926 TGACTTGGGGAGGAGGGAGTGGG + Intronic
1018560795 6:165099255-165099277 GGTTTTGGGGAGGGGAAAGGAGG - Intergenic
1018986876 6:168644430-168644452 TGGCTGGGGAGGGAGAAAGAGGG - Intronic
1019012269 6:168851367-168851389 TGTTTTGGGGAGCAGAAGGAGGG + Intergenic
1020823033 7:12994253-12994275 CATAATGGGGAGGAGAAAGAAGG - Intergenic
1021055384 7:16041096-16041118 TGGCTGGAGCAGGAGAAAGAGGG - Intergenic
1021682579 7:23149289-23149311 ATTCTTGGGGAGGAAAAAAAAGG + Intronic
1021719460 7:23491571-23491593 AGTCTTGTGGAGGATAGAGATGG + Intergenic
1021810247 7:24395857-24395879 TGTGTTAGGGAAGAGAAACAGGG + Intergenic
1022048469 7:26643001-26643023 TGCCTTGGGGAGAAAAAGGAGGG - Intronic
1022536168 7:31099994-31100016 AGTCATGTGGAGGAGAATGAGGG - Intronic
1023059809 7:36316215-36316237 TGGCCTGGGGACGAGGAAGAAGG + Intergenic
1023605742 7:41929230-41929252 TGTCCTGGGGAGGTCAAAAAGGG + Intergenic
1023721396 7:43099034-43099056 AGTTTTGGGGAGGAGTTAGAGGG + Intergenic
1025836623 7:65100322-65100344 TTTTTTGGGGAGGTGAAGGAAGG - Intergenic
1025863300 7:65354053-65354075 TGTCGTGGGGTGGGGGAAGAGGG + Intergenic
1025906398 7:65789759-65789781 TTTTTTGGGGAGGTGAAGGAAGG - Intergenic
1025951970 7:66152519-66152541 TGCCTTGGGGAGAAGAAACATGG + Exonic
1025988956 7:66480286-66480308 TTTTTTGGGGAGGTGAAGGAAGG + Intergenic
1025999676 7:66551159-66551181 TGTCTTGGGAAAAAAAAAGAAGG - Intergenic
1026081378 7:67224546-67224568 TGTTTTGGGGAGAAAAAAGAAGG - Intronic
1026565582 7:71487296-71487318 TGTCTGGAGGAGGAAAAACATGG + Intronic
1026595229 7:71729160-71729182 TCTCTAAGGGAGCAGAAAGATGG - Intergenic
1026694310 7:72577441-72577463 TGTCTTGGGAGAGAGAATGATGG - Intronic
1026695703 7:72589453-72589475 TGTTTTGGGGAGAAAAAAGAAGG + Intronic
1028697475 7:93731892-93731914 AGTCTAGAGGAGGAGATAGAAGG - Intronic
1030095005 7:105890954-105890976 TGTCTTGGGGATGAGCACCAAGG + Intronic
1030378258 7:108779737-108779759 ATTCTTGGGAGGGAGAAAGAAGG + Intergenic
1032441149 7:131944102-131944124 TGTGGTGGGGAGGAGGAAAAAGG - Intergenic
1032442813 7:131955079-131955101 TGTCCTGGGAAGGAGAAAGAGGG + Intergenic
1033519035 7:142141392-142141414 TGTCTTGGGAAAGAGAAATTTGG - Intronic
1033940945 7:146652811-146652833 TGTGGTTGGGAGGAAAAAGAAGG + Intronic
1034658537 7:152748889-152748911 TGTCAGGGGCAGGAGCAAGATGG - Intergenic
1035110347 7:156476351-156476373 TTTCTTTTGGAGGAGAAGGAAGG - Intergenic
1035278074 7:157759860-157759882 TCTCTTGGGGAGGAGCTGGATGG + Intronic
1035630316 8:1102764-1102786 TGATGTGGGGAGGAGAAAAAGGG + Intergenic
1036519641 8:9479246-9479268 TGTCTCTGTGAGGAGAAGGAGGG - Intergenic
1036527415 8:9548120-9548142 TGTCTTGTGGAAGAAAAAGGTGG + Intergenic
1037547512 8:19939268-19939290 TCCCTTGAGGAGGAGGAAGAGGG - Exonic
1037635822 8:20700410-20700432 TGGCGTGGGGAGGGGAAAGGAGG + Intergenic
1038460406 8:27711403-27711425 TAACTTGAGGAGGACAAAGATGG - Intergenic
1038656680 8:29459206-29459228 TGTCTGGGGGAGGGGGAAGCTGG - Intergenic
1038770595 8:30475724-30475746 AGTGTTGGGGAGGAGGAAGGAGG + Intronic
1038779281 8:30556828-30556850 AGTCTAGGGGAGGAGAGGGAGGG - Intronic
1039091813 8:33838179-33838201 AGTCTTTTGGAGGGGAAAGAAGG - Intergenic
1039373938 8:37014420-37014442 AGACTTGGGCAGAAGAAAGAGGG - Intergenic
1039438751 8:37579991-37580013 TCTCTTTGGGTGGAAAAAGATGG - Intergenic
1039777747 8:40753250-40753272 GGTCTTTGGAAGGAGTAAGAAGG - Intronic
1040040621 8:42913292-42913314 TTGCTTGGGGATGGGAAAGAGGG - Intronic
1040056942 8:43067150-43067172 TGTCTTGGGCAGGAGACAAGTGG - Intronic
1040658656 8:49543750-49543772 TGCCTTGGGTAGGTGAAAGGAGG - Intronic
1041043265 8:53867735-53867757 TGTCTTGGGGAAAAGAAAGAAGG - Intronic
1041152867 8:54954678-54954700 TGATCTGGGGAGGAAAAAGAGGG - Intergenic
1041329851 8:56713276-56713298 TGTCTGTGGGGGGAGCAAGAAGG - Intergenic
1042023422 8:64396625-64396647 TGTCTTGGGGAGAGGAGAAAAGG + Intergenic
1042057157 8:64776713-64776735 TGCTTTGGGGAGAAGAAAGGAGG - Intronic
1042299746 8:67264490-67264512 TGTTTTGGGTAGGAGAACTAAGG + Intronic
1042654211 8:71077770-71077792 TGTGTTTGTGAGGAGAAGGAGGG + Intergenic
1043180904 8:77085365-77085387 TGACAGGGAGAGGAGAAAGAAGG + Intergenic
1043398453 8:79860538-79860560 TGTCATGGGGTGGGGAGAGAGGG - Intergenic
1044278158 8:90326058-90326080 TGTCTTGGAGTGGAGAATGAAGG + Intergenic
1044320198 8:90792423-90792445 GGTCTGGGGGAGGATAACGAGGG - Intronic
1044861093 8:96524733-96524755 TGTATTGGAAAGGAGAAAAAAGG - Intronic
1044884544 8:96762678-96762700 TGTTTTACGGGGGAGAAAGAAGG + Intronic
1044999412 8:97867513-97867535 TGTCTTTGGGAGGAGGTAGGTGG - Intergenic
1045078443 8:98597072-98597094 TGTTTTGGAGAGGTGAAAAAAGG + Intronic
1045396485 8:101765637-101765659 TATGTTGGGGAGGAGTAGGAAGG + Intronic
1045487790 8:102645769-102645791 TGTCTTGGGGGGGAAAAAAAGGG + Intergenic
1045518309 8:102880678-102880700 TGTGTTGGGGATTAGAAAGCTGG - Intronic
1045561051 8:103263471-103263493 AGTTGTGGGGAGGAGAAAAAGGG + Intergenic
1045715054 8:105033335-105033357 TGTCTCTGAGAGGAGAAAGATGG - Intronic
1045791870 8:105993038-105993060 AGTCCTGGAGAGGAGAAAGCAGG - Intergenic
1045875606 8:106977501-106977523 TGTCTTGGGTGGGACAAAGCAGG - Intergenic
1046031505 8:108787760-108787782 AGTGCTGGGGAGGAGTAAGAGGG - Intergenic
1046206175 8:111000699-111000721 TGTCGTGGGGTGGAGGAAGGGGG - Intergenic
1046300125 8:112276457-112276479 TATCTTGGTGAAGAGAAACATGG - Intronic
1046423322 8:114012790-114012812 TGTCCTGGGCAGGATAAAGTGGG + Intergenic
1046818979 8:118616002-118616024 TGTTTTAGGAAGGAGAATGACGG - Intronic
1047521814 8:125600754-125600776 TGTCTTGGGGAGCAGAAGGGAGG + Intergenic
1047764939 8:127982817-127982839 TGTCCCAGGGAGGAGAAACAGGG - Intergenic
1048090953 8:131239673-131239695 TGTCTTAAGGAGGAGGAAAAAGG - Intergenic
1048107709 8:131429494-131429516 GGTCCCGGGCAGGAGAAAGAAGG - Intergenic
1048321051 8:133400363-133400385 AGACCTGGGGAGGAGAGAGAGGG - Intergenic
1048776219 8:137949474-137949496 TTTCTAGGGCAGGAGAAAAAAGG - Intergenic
1048906291 8:139092698-139092720 AGTGTGGGGGAGGAGCAAGAGGG + Intergenic
1049055286 8:140231696-140231718 TGTGTGGTGGAGGAGAGAGAGGG - Intronic
1049721521 8:144117959-144117981 TGCCTTGGGGAGAAAAAGGAGGG + Exonic
1050004989 9:1120173-1120195 TGACTTGGGCTGGAGTAAGAAGG + Intergenic
1050230811 9:3524986-3525008 TGTGGGGGGGGGGAGAAAGAGGG + Intronic
1050820779 9:9877336-9877358 TGTCATGGGGAGGATAAGGGAGG + Intronic
1050871009 9:10570143-10570165 TGATTTGTGAAGGAGAAAGATGG - Intronic
1051180460 9:14406361-14406383 TGTGTTGGGGAGGAGGCAGTAGG + Intergenic
1051518321 9:17955608-17955630 TGTCCTGGGTAGGACAAAGGAGG - Intergenic
1051988508 9:23121411-23121433 AGTTTTGGAGAGGATAAAGATGG + Intergenic
1052040910 9:23738017-23738039 TGTTTGAGGGAGGAGAGAGAAGG - Intronic
1052499976 9:29276182-29276204 TGTCGTGGGGTGGGGGAAGAGGG + Intergenic
1052850123 9:33373162-33373184 TGTCTTGGAGAGGCCAGAGAAGG + Intergenic
1053122944 9:35560009-35560031 TGTCTAGGGGAAAAGAGAGAGGG - Exonic
1053362742 9:37500945-37500967 TTTCTTGTGCAGGAGAAAGTAGG + Intronic
1053441415 9:38119358-38119380 CATCTTGGGAGGGAGAAAGATGG - Intergenic
1053908959 9:42876030-42876052 TGTCGTGGGGTGGAGGAAGGGGG - Intergenic
1054460455 9:65459520-65459542 TGTCAAGGGGTGGAGAAAGATGG - Intergenic
1054723480 9:68626737-68626759 TATCTTGGAGAAGAGAAATATGG - Intergenic
1055693490 9:78858406-78858428 TGGGATGGGGAGAAGAAAGAGGG - Intergenic
1055799796 9:80022603-80022625 TGCCTTGGGCAGGTGAAAGGAGG - Intergenic
1057943256 9:99303295-99303317 TGTGCTGGGGAGGAGCAGGAAGG + Intergenic
1059661256 9:116403848-116403870 TGTTTAGGGCTGGAGAAAGATGG - Intergenic
1060396591 9:123320879-123320901 GGGCTTGAGGAGAAGAAAGAAGG + Intergenic
1060531213 9:124347961-124347983 TGACTTGGAGAGGGGAAAGTAGG + Intronic
1060913191 9:127367108-127367130 TGTCTTGGGAAAAAGAAATATGG - Intronic
1061035250 9:128110007-128110029 GGTCTTGGGGTGGAGAGTGAAGG - Intergenic
1061333267 9:129911242-129911264 TGCCTTGGGCAGGTGAAAGAAGG - Intronic
1061560371 9:131398535-131398557 TATCTTGGAAAGGAGGAAGACGG - Intronic
1062463535 9:136671619-136671641 TGTCCTGGTGGGGACAAAGATGG - Intronic
1203491354 Un_GL000224v1:108416-108438 TGTCTGGAGCAGGAGAAAGTGGG + Intergenic
1203503978 Un_KI270741v1:50286-50308 TGTCTGGAGCAGGAGAAAGTGGG + Intergenic
1203637432 Un_KI270750v1:126011-126033 AGGCTTTTGGAGGAGAAAGAAGG + Intergenic
1186379550 X:9043597-9043619 TGTCATGGGGTGGAGGGAGAGGG - Intronic
1187056049 X:15742311-15742333 TGCCTTGGGGAGTAGAAACAGGG - Intronic
1187197172 X:17098856-17098878 GGTGTTGGGGAAGGGAAAGAGGG - Intronic
1190887167 X:54540253-54540275 TGCCTTGGTGGGGAGAGAGAGGG + Intronic
1191610692 X:63108899-63108921 TGTCGTGGGGTGGGGGAAGAGGG + Intergenic
1192501220 X:71653935-71653957 TGTCTTGGGGTGGGGGAAGGGGG - Intergenic
1193001313 X:76565542-76565564 TGTCGTGGGGTGGAGGAAGTGGG + Intergenic
1194280901 X:91953013-91953035 GGACTTGGAGAGTAGAAAGATGG + Intronic
1194834308 X:98661996-98662018 TGAATTGGGGAAGAAAAAGACGG + Intergenic
1194974030 X:100375243-100375265 TGTCTTGGGGTGGAGGGAGGGGG - Intronic
1195626742 X:107011344-107011366 TGTCATGGGGTGGAGGGAGAGGG + Intergenic
1195721718 X:107874791-107874813 GGTTTTGGGGAGGGGAAAGGAGG + Intronic
1195748206 X:108139153-108139175 TGTGTTGGGGAGGATAACTAAGG - Intronic
1195853382 X:109306795-109306817 AGTTTTGGTGAGGGGAAAGAAGG + Intergenic
1196187432 X:112759666-112759688 TGTCCTGGGCAGGATAAAGCAGG - Intergenic
1196203650 X:112914528-112914550 TGTCATGGGGTGGAGGAAGGGGG - Intergenic
1196487626 X:116232023-116232045 TGTCTTGGGGAGCATAGAAATGG + Intergenic
1196531408 X:116791190-116791212 TGTCTGGGGGTGGAGAACTAGGG + Intergenic
1197058230 X:122146018-122146040 TGTCCTGGGGTGGGGAAAGGGGG + Intergenic
1197419789 X:126224606-126224628 GGCCTTGGTGAGGAGGAAGAGGG - Intergenic
1197595872 X:128463505-128463527 GGACTTGGGGAGGTGGAAGAGGG - Intergenic
1197617492 X:128710782-128710804 TGTCATGGGGTGGGGAAAGGGGG + Intergenic
1198135730 X:133748558-133748580 TGTGTTGGGGGGAAGAGAGATGG - Intronic
1198301601 X:135339064-135339086 TTTCTTGGGGAGGAAGACGAGGG - Intronic
1198511081 X:137352432-137352454 TGTGTTGGGGAGGGGATTGAAGG - Intergenic
1198777670 X:140197939-140197961 TGTCTTTGGGAGATGAGAGATGG + Intergenic
1198968387 X:142251469-142251491 GGTCCTGGGGAGGAGAATGCTGG - Intergenic
1198987058 X:142466767-142466789 TGTCGTGGGGTGGGGAAAGTGGG + Intergenic
1199718118 X:150521658-150521680 TGTATTTGGGAGAAGAAAGAGGG + Intergenic
1199869014 X:151879535-151879557 TGTGGTGGGGGGGAGAAAAACGG + Intergenic
1199949998 X:152699514-152699536 AGTCATGGGGAGGAAGAAGAGGG + Intronic
1199959676 X:152768947-152768969 AGTCATGGGGAGGAAGAAGAGGG - Intronic
1200079560 X:153569247-153569269 TGTGTTGGAGAGGAAAAACAAGG + Intronic
1200598493 Y:5177673-5177695 GGACTTGGAGAGTAGAAAGATGG + Intronic
1200969180 Y:9131896-9131918 TGTTTTGGGAATGGGAAAGAAGG + Intergenic
1201538489 Y:15079734-15079756 TGTCTTTGGGAGGCCAAAGCGGG + Intergenic
1202141649 Y:21730602-21730624 TGTTTTGGGAATGGGAAAGAAGG - Intergenic
1202145216 Y:21773200-21773222 TGTTTTGGGAATGGGAAAGAAGG + Intergenic