ID: 1170438481

View in Genome Browser
Species Human (GRCh38)
Location 20:16353802-16353824
Sequence AGGTATCCATATGGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170438472_1170438481 22 Left 1170438472 20:16353757-16353779 CCTGTATATTCACATCATGTCTG 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1170438481 20:16353802-16353824 AGGTATCCATATGGGGTGGAAGG 0: 1
1: 0
2: 1
3: 9
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170438481 Original CRISPR AGGTATCCATATGGGGTGGA AGG Intronic
901945878 1:12703154-12703176 AGCTTTCCATAGGGGCTGGATGG + Intergenic
902758782 1:18567176-18567198 AGGGATCCATGAGGGGTGAAGGG + Intergenic
904718091 1:32484444-32484466 AGGTGTTCATAAGGGGTGAAGGG + Intronic
913975011 1:143449210-143449232 TGGAATCCATTTGGGGTGAAAGG + Intergenic
914069403 1:144274826-144274848 TGGAATCCATTTGGGGTGAAAGG + Intergenic
914109752 1:144691528-144691550 TGGAATCCATTTGGGGTGAAAGG - Intergenic
915685158 1:157625215-157625237 AGGTACCCATGGGGTGTGGAGGG - Intergenic
915932605 1:160069642-160069664 ACCTGTCCATATGGGGAGGAGGG + Intronic
918716720 1:187798202-187798224 TGGGATCAACATGGGGTGGAGGG + Intergenic
924733137 1:246730538-246730560 AGGTATCCTGATGGGGTTGTGGG - Intronic
1062931577 10:1356361-1356383 AGGCAGCCAGCTGGGGTGGAAGG + Intronic
1067909734 10:50333770-50333792 AGGTACCCATACAGGGTAGATGG + Intronic
1075913121 10:126142913-126142935 GGGTATGTATATGGGGTGCATGG + Intronic
1078864168 11:15281369-15281391 ATGGATCCATCTGGGGTGGGAGG + Intergenic
1079433686 11:20422931-20422953 AGGTCTTCAAATGGGGTGGATGG - Intronic
1081585525 11:44381356-44381378 ACGTGTCCATTTGTGGTGGAGGG + Intergenic
1084647927 11:70471441-70471463 AGGTATTGTTATGGGGTGGAGGG + Intronic
1088629611 11:111762020-111762042 AAGAAGCCAAATGGGGTGGATGG + Intronic
1089890895 11:121879655-121879677 GGGTAGACAAATGGGGTGGAGGG + Intergenic
1091933720 12:4417811-4417833 AGGGATCCAGATGGGGGGAAGGG + Intergenic
1092071348 12:5633911-5633933 AGGCATGCATATAGGGAGGAGGG - Intronic
1092974340 12:13729807-13729829 AGGAAGCCATATGGGGAGGGGGG + Intronic
1093656469 12:21700255-21700277 TGTTATCCACAAGGGGTGGAGGG - Intronic
1104908071 12:132225942-132225964 GGGTGTGCATATGGGGTGTATGG - Intronic
1108435039 13:50393642-50393664 GGGACTCCATATGGGGTTGATGG + Intronic
1109661810 13:65469420-65469442 AGGTAAAGACATGGGGTGGAGGG - Intergenic
1112998280 13:105600734-105600756 ATGTGTCCAAATGGGGTGGTGGG - Intergenic
1116443288 14:44979373-44979395 CTGTGTCCTTATGGGGTGGAAGG + Intronic
1116904607 14:50392619-50392641 AGGTCACCATGTGGGATGGAGGG - Intronic
1118026155 14:61771032-61771054 ATGTATCCATATGAGCTGGGTGG - Intronic
1119385501 14:74255737-74255759 AGGTATCCACACTGGGTGGGTGG + Intronic
1125883639 15:43212952-43212974 AGGGATCCATCTGGGGATGAGGG + Intronic
1132694431 16:1195609-1195631 AGGGATCCCTGTGGGGTGGGCGG - Intronic
1133185089 16:4090180-4090202 AAGTATCCATAGGGCGTGGGGGG - Intronic
1137953543 16:52806458-52806480 AGGTCTCCAAAAGGGATGGAGGG - Intergenic
1139163185 16:64535837-64535859 AGGTATCAATGGAGGGTGGATGG + Intergenic
1140627612 16:76813035-76813057 AAGAATCCAAGTGGGGTGGAGGG + Intergenic
1140925968 16:79583831-79583853 AGGTAGCCAAATCGGGTGAAAGG + Intergenic
1141688896 16:85585551-85585573 GGGTCTCCATGTGGGGAGGAGGG + Intergenic
1144188490 17:12820638-12820660 AGGTATCCATGTGGTGTTGAGGG - Intronic
1150772755 17:68055470-68055492 AAGTATCCATATGTGGTGGCAGG - Intergenic
1154323018 18:13369511-13369533 GGGTCTCCAGTTGGGGTGGAGGG + Intronic
1155240125 18:23856857-23856879 AGGTATCCAGATGGGGAGGAGGG - Intronic
1160102005 18:75930284-75930306 TGGTATTCGTGTGGGGTGGATGG + Intergenic
1166300721 19:41910667-41910689 GGGCATGGATATGGGGTGGAGGG - Intronic
927255683 2:21038704-21038726 GGGTGTCCGTATGGGGAGGATGG - Intronic
927764082 2:25788151-25788173 AGATATCCCTACGGGGTGAAAGG + Intronic
928003938 2:27546398-27546420 AGATATCTATATGGGGAGGAGGG - Intronic
929252812 2:39778469-39778491 AGGTATCTTGATGGGGTGTATGG - Intronic
934179716 2:89610183-89610205 TGGAATCCATTTGGGGTGAAAGG + Intergenic
934290006 2:91684444-91684466 TGGAATCCATTTGGGGTGAAAGG + Intergenic
935076347 2:99748239-99748261 AGGTATCTGGATGGGGTGGCAGG - Intronic
938635617 2:133223140-133223162 GGGAAACAATATGGGGTGGAGGG - Intronic
939771407 2:146324354-146324376 AGGTATCCATTTGGGCAGGAAGG - Intergenic
940806026 2:158187355-158187377 ACTTATTCAAATGGGGTGGAGGG + Intronic
942857631 2:180568971-180568993 AAGTATACATGTGGGGTGGTTGG - Intergenic
943128495 2:183826902-183826924 AGGTATCCATGTGAGGTAAAAGG - Intergenic
944428852 2:199611890-199611912 AGGTAACCAAGTAGGGTGGAAGG - Intergenic
945206410 2:207337304-207337326 AGTAATTCATCTGGGGTGGATGG - Intergenic
948785802 2:240352084-240352106 GGGTCTCCAGATGGGGTGGGCGG + Intergenic
1170438481 20:16353802-16353824 AGGTATCCATATGGGGTGGAAGG + Intronic
1182532970 22:30975613-30975635 GGATATCCATCTGGAGTGGAGGG - Intergenic
1184073141 22:42159024-42159046 AGGTATGCATACGGGGGGAAGGG + Intergenic
1185146526 22:49140031-49140053 AGGTGCCCATATGGGAGGGACGG - Intergenic
955877057 3:63502303-63502325 AGGTATGCATGTGGCGGGGAAGG - Intronic
964704247 3:159601518-159601540 AGGTATGCAGAGGGGGAGGAGGG + Intronic
967800928 3:193658633-193658655 AGCTAACCATATGGGGTGCGTGG - Intronic
969453648 4:7288775-7288797 AGGAATTCATGTGGGGTGGGGGG + Intronic
970069778 4:12144538-12144560 AGATATTCACATTGGGTGGATGG + Intergenic
970399009 4:15700316-15700338 AAGTTTCCAAATGTGGTGGAAGG + Intronic
976927052 4:90511903-90511925 AGGTATGAATATGTGGTGGTGGG + Intronic
977573141 4:98650349-98650371 AGGTATCCATATGGGGATGGGGG + Intronic
978898445 4:113919615-113919637 CTGTATCCATATGAGGTAGAAGG + Intronic
979598475 4:122559858-122559880 AGGAAGCCATATTTGGTGGACGG + Intergenic
982580120 4:157166622-157166644 AGGTGCACATGTGGGGTGGACGG - Intronic
984338912 4:178428657-178428679 GGGTATCCATATGCAGTAGAAGG + Intergenic
984900936 4:184585845-184585867 AGTTTTCCACAGGGGGTGGAGGG - Intergenic
993698913 5:91095154-91095176 AGCTACCCAAATGAGGTGGAGGG + Intronic
993724884 5:91355859-91355881 AGGAATCAATAAGGGTTGGAAGG + Intergenic
998105660 5:139467592-139467614 AGGCATCCACATGGTGGGGAAGG - Intergenic
1000766359 5:165295679-165295701 AGGGATCATTATGGGGTGGTGGG + Intergenic
1004463550 6:15862054-15862076 AGGGCTCCATAGCGGGTGGAAGG + Intergenic
1005317930 6:24622135-24622157 AGGTTTCCCTCTGGGGTGTACGG - Intronic
1006961998 6:37941460-37941482 AGGTGTGCATATGTGGTGGGGGG + Intronic
1011108548 6:83811014-83811036 AGGGATCCATATAAGGTGGGAGG - Intergenic
1014737050 6:125105748-125105770 AGGTATCAATACAGGGTGGTTGG + Intergenic
1014993476 6:128111665-128111687 AGTTAGCCAGATGGGGTGGTTGG - Intronic
1015634605 6:135263315-135263337 TGGTATACAAATGTGGTGGAAGG + Intergenic
1026693998 7:72574437-72574459 AGGTATATATATGGGGTACATGG - Intronic
1028399872 7:90413312-90413334 AAGTATGCATACTGGGTGGATGG - Exonic
1028567322 7:92246752-92246774 ATGCATCCAGATGGGGAGGATGG - Intronic
1032305807 7:130732324-130732346 AGGAATCCAAATGGGGAGAAGGG + Exonic
1033681926 7:143603336-143603358 ATATATCTCTATGGGGTGGAAGG - Intergenic
1033702964 7:143858577-143858599 ATATATCTCTATGGGGTGGAAGG + Intronic
1034287080 7:149892504-149892526 AGGGCTCCATGTGGGGTGAAGGG + Intergenic
1034664044 7:152800404-152800426 AGGGCTCCATGTGGGGTGAAGGG - Intronic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1035604348 8:919922-919944 AGTTATAGACATGGGGTGGAAGG - Intergenic
1038770971 8:30479404-30479426 GGGTTTCCATATGAGGTGGTGGG + Intronic
1040429997 8:47330269-47330291 AGCTATGCATATGTGGGGGAGGG - Intronic
1041381013 8:57254474-57254496 GGGTGTAGATATGGGGTGGAGGG - Intergenic
1044370501 8:91404652-91404674 TGGTATCCAGATGAGGTGGCTGG + Intergenic
1049464512 8:142744780-142744802 AGGGATGAATATGGGATGGATGG + Intergenic
1051397103 9:16635017-16635039 AGGTTTCCATATGGAGTATACGG - Intronic
1056640650 9:88367685-88367707 ATGTATGGACATGGGGTGGAAGG + Intergenic
1057571015 9:96204275-96204297 TGGGATCCAGATGGGATGGAGGG + Intergenic
1057761270 9:97876517-97876539 AGGTTTCTGTATGGGGTGGCTGG + Intergenic
1059075570 9:111190043-111190065 AGGTATATATATGGGGTATAAGG - Intergenic
1059289485 9:113210097-113210119 CGGTGTCCATATGGGGCAGAAGG + Intronic
1060551305 9:124486647-124486669 AGGTCTCCAGATGAGGAGGAAGG - Intronic
1188026806 X:25218457-25218479 TGGTATCTGTAGGGGGTGGAGGG + Intergenic
1188575808 X:31648588-31648610 AGGTTTCCCTACGGGGTGAAAGG + Intronic
1191150010 X:57210190-57210212 TTGTGTCCTTATGGGGTGGAGGG + Intergenic
1193624876 X:83805903-83805925 AGGTATCCATTAGTGGTGGAAGG - Intergenic
1195535622 X:106006116-106006138 AGGTGTGCATGTGAGGTGGAAGG - Intergenic
1195780682 X:108460391-108460413 AAGTATCTTTAGGGGGTGGAGGG - Intronic
1196745461 X:119067941-119067963 AGGTATCCAGCTGAGGTGTAGGG - Intergenic
1197196421 X:123706518-123706540 AGGTATCCATGGGTGGGGGAGGG - Intronic
1198305987 X:135383545-135383567 GGGTATCCTTATGGTGTGCAAGG - Intergenic
1201199832 Y:11529596-11529618 ATGTATCCAAATGGAATGGAAGG + Intergenic
1201297490 Y:12476860-12476882 ATGTATACATATAGGTTGGAAGG - Intergenic