ID: 1170443328

View in Genome Browser
Species Human (GRCh38)
Location 20:16400054-16400076
Sequence CAGGCACTCCTTGGACTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170443324_1170443328 -4 Left 1170443324 20:16400035-16400057 CCATGCTGCTCCTTGGCTACAGG 0: 1
1: 0
2: 1
3: 20
4: 246
Right 1170443328 20:16400054-16400076 CAGGCACTCCTTGGACTGACTGG 0: 1
1: 0
2: 1
3: 14
4: 131
1170443322_1170443328 19 Left 1170443322 20:16400012-16400034 CCTTTCAATGCAAGGATGAATGA 0: 1
1: 0
2: 1
3: 23
4: 191
Right 1170443328 20:16400054-16400076 CAGGCACTCCTTGGACTGACTGG 0: 1
1: 0
2: 1
3: 14
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170443328 Original CRISPR CAGGCACTCCTTGGACTGAC TGG Intronic
901762840 1:11481661-11481683 CAGGCAGTCCTTTAACAGACGGG - Intronic
901935310 1:12622486-12622508 GAGGCATTCCTTGGACTGAGGGG - Intergenic
902123604 1:14189466-14189488 CAGGCAATCCATAGACTTACAGG - Intergenic
904200398 1:28815700-28815722 CAGGCCCTGCTTGGGCTGCCAGG - Intronic
905457355 1:38097351-38097373 CAGGCACTTCTTGGCCTGGAAGG - Intergenic
906103155 1:43275974-43275996 CAGGCTCTCCTGGGAAGGACGGG + Intergenic
907990133 1:59572845-59572867 CAGGCATTCCTTGGACAGACTGG + Intronic
910477186 1:87619968-87619990 CAGGCAGGCCATCGACTGACGGG + Intergenic
911116433 1:94250454-94250476 CAGGCAGTCCTTGGACTCCCTGG + Intronic
921209545 1:212881556-212881578 CACGAACTCCTTGGCCAGACTGG + Intronic
922424171 1:225478419-225478441 GAGACACTCCTTGGAGTCACTGG + Intergenic
924351130 1:243115649-243115671 CAGGGACCCCTAGGACTCACGGG - Intergenic
1068607424 10:59021243-59021265 CAGTCACCCCTTGGACTGAATGG + Intergenic
1069130015 10:64687797-64687819 CAGTCACTCCTTAGACTCACTGG - Intergenic
1069546965 10:69335509-69335531 CTGGCTCTCCCTGGACTGAGAGG + Intronic
1069592922 10:69652949-69652971 CAGGCACCCCTTGGTATGAATGG + Intergenic
1070986760 10:80696184-80696206 CAGGCACTCCTGGGAGTTCCAGG + Intergenic
1073466016 10:103694867-103694889 AAGGCCTTCCCTGGACTGACTGG - Intronic
1073666515 10:105540262-105540284 CAGGCACTCCATTGTCTGAATGG - Intergenic
1075070830 10:119319052-119319074 CAGGCACTCCTTTCCCTGATAGG + Intronic
1075678786 10:124317733-124317755 CAGCCACTCCCAGAACTGACAGG + Intergenic
1075678895 10:124318375-124318397 CAGCCACTCCCAGAACTGACAGG + Intergenic
1078080902 11:8204187-8204209 CAGGCACTTCTAGAACTGCCAGG - Intergenic
1078689531 11:13565193-13565215 TTAGGACTCCTTGGACTGACAGG + Intergenic
1081743138 11:45454906-45454928 CAGGCCCACCCTGGCCTGACAGG - Intergenic
1081797043 11:45827768-45827790 CATCCACTCCTTGGACTTTCTGG + Intergenic
1083883994 11:65562073-65562095 CATGGTCTCCTTGGACTTACAGG - Intergenic
1086264075 11:84977125-84977147 CATACACCCCTTGGAGTGACTGG - Intronic
1087656702 11:100932452-100932474 CAGGCTCTCCATGGAATTACAGG - Intronic
1090881920 11:130840657-130840679 CAGGCACTGATTAGACAGACTGG + Intergenic
1093692642 12:22125268-22125290 CAGGCACTCCTGTGGCTGAAAGG + Intronic
1098217767 12:68238162-68238184 AGGGCACTCCTGGGACTGAGGGG + Intergenic
1101828073 12:108236274-108236296 CAGACCCTCCTAGGCCTGACAGG + Intronic
1102430312 12:112878010-112878032 CAGCCCCTCCTTGAACTGACTGG - Intronic
1102516533 12:113452353-113452375 TAGGCACTCCCTGGACTCCCTGG - Intergenic
1108123984 13:47220661-47220683 CAGCGCCTCCTTGGACTGAGAGG - Intergenic
1108257624 13:48625961-48625983 CAGGCTCTCCTTGGAGAGATAGG + Intergenic
1114671439 14:24413445-24413467 CAGGCCCTCCTGGGGCTGATCGG + Intronic
1120038900 14:79729886-79729908 GAGGCACTAATTGGGCTGACTGG + Intronic
1123114500 14:105888487-105888509 CACCCACTCCTGGGACTGAGGGG - Intergenic
1202833545 14_GL000009v2_random:60544-60566 CAGGTCCTTCCTGGACTGACTGG - Intergenic
1202837405 14_GL000009v2_random:88358-88380 CAGGTCCTTCCTGGACTGACCGG - Intergenic
1125364585 15:38900429-38900451 CAGGCAGTCCTGGGAGTGAAAGG + Intergenic
1126219086 15:46191552-46191574 CAGGCATACCTTGGACTTGCAGG + Intergenic
1127559972 15:60126609-60126631 GAGGCAAACCTGGGACTGACAGG - Intergenic
1127758178 15:62113121-62113143 CAGGCACTGCTTGTACTCCCTGG + Intergenic
1128328112 15:66738242-66738264 CAGGCAATCCCAGGACAGACAGG + Intronic
1130760035 15:86809635-86809657 CAGGCAGTCCTTGGAATTAAGGG + Intronic
1130795209 15:87200543-87200565 CAGGAAATCCTTAGATTGACAGG + Intergenic
1133013955 16:2930413-2930435 CAGGAACTCCAGGGACTGAGGGG - Exonic
1137261392 16:46832618-46832640 CAGGCATACCTTGGAGGGACTGG + Intergenic
1139879902 16:70174239-70174261 CAGGCACTCCGTGCACAGCCTGG - Exonic
1142625144 17:1187095-1187117 CAGCCACTCCTGGGCCTGATGGG - Intronic
1143327789 17:6110768-6110790 CAGACACTCGTTGTACAGACAGG + Exonic
1143504683 17:7357034-7357056 CAGGCCCTCCTATGACTGATGGG + Exonic
1144660007 17:17061790-17061812 CCAGCAGCCCTTGGACTGACCGG + Intronic
1148177064 17:45575815-45575837 CAGGCACTCCAGAGACTGAATGG + Intergenic
1151573595 17:74939717-74939739 CAGGCACTCGTGGGACTTCCGGG + Intronic
1152661346 17:81543736-81543758 CGGGCAGTCCTTGGACTCACAGG + Intronic
1155390352 18:25329212-25329234 CAGGCACAGCTTGGGGTGACTGG + Intronic
1155436312 18:25816411-25816433 AAGGCACTCCCTGGAATGACGGG + Intergenic
1155583653 18:27340369-27340391 TAGGCACTCTCTGGACTGGCAGG - Intergenic
1158652285 18:59298977-59298999 CAGGCCCTCCTTGGAGAGCCTGG + Intronic
1158950093 18:62486407-62486429 GAAGGACTCCTTGCACTGACTGG + Intergenic
1160386528 18:78500336-78500358 CAGGCCCTGCTTGGAGGGACGGG + Intergenic
1160387813 18:78507361-78507383 CAGGCTCTCCTTGGCCGGCCGGG - Intergenic
1165068335 19:33241486-33241508 CAGGCACTCCTGGGGGTGAGGGG + Intergenic
1166664792 19:44672690-44672712 CTGGGACACCCTGGACTGACAGG - Exonic
1167306561 19:48713386-48713408 CACGGACTCCCTGGACTGGCTGG - Exonic
1168303368 19:55419636-55419658 CAGGCACCCCTGAGACTGAAGGG - Intergenic
1168564756 19:57413739-57413761 CAGGCTCTCCTTGGACCCAAGGG - Intronic
1202635239 1_KI270706v1_random:38993-39015 CAGGTCCTTCCTGGACTGACTGG + Intergenic
1202639125 1_KI270706v1_random:67148-67170 CAGGTCCTTCCTGGACTGACTGG + Intergenic
925511097 2:4626190-4626212 CAGGCCCTCCGTGGGCTGAGAGG + Intergenic
927574471 2:24189934-24189956 CAGGCGCTCGGGGGACTGACTGG + Intronic
928626408 2:33144009-33144031 TATGGACTCCTTGGATTGACTGG + Intronic
929627497 2:43424541-43424563 CAAGCACTGCCTGGAATGACAGG + Intronic
931674092 2:64676434-64676456 CAGACAGTCCTGGGACAGACAGG + Intronic
932054911 2:68433638-68433660 CAGGCACAGCTGGGACTCACAGG - Intergenic
932340967 2:70962492-70962514 CAGGCACTCCTGGCCCTGCCTGG + Intronic
933600016 2:84319518-84319540 CAGGCACTGCTTGGAGTGTGAGG - Intergenic
934906756 2:98211716-98211738 CTAGCAGTCCTTGGACTGCCCGG + Intronic
938370156 2:130763532-130763554 CAGGCACTCCTTGCCCTTCCAGG - Exonic
942222992 2:173789718-173789740 CAGCCACCCCTAGGACTGCCTGG + Intergenic
943079066 2:183235336-183235358 CAGACACTCTTTAGACTTACAGG - Intergenic
948284537 2:236773510-236773532 CAGGCTCTCTCTGGACAGACTGG + Intergenic
948701462 2:239763215-239763237 GAGGCACTCCTTCCACTCACGGG - Intronic
948893518 2:240917999-240918021 CAGGCACTCCTGGGGCAGAAGGG + Intergenic
1170443328 20:16400054-16400076 CAGGCACTCCTTGGACTGACTGG + Intronic
1172025146 20:31943350-31943372 CAGGCCCTACTTGGAGTCACTGG + Exonic
1173522823 20:43712041-43712063 CAGGCACTGCCTGGCCTGGCTGG - Intronic
1176203572 20:63875864-63875886 CAGGCACTCACAGGTCTGACTGG - Exonic
1176647448 21:9364757-9364779 CAGGTCCTTCCTGGACTGACTGG + Intergenic
1180148811 21:45937224-45937246 CAGGGACTCCTGAGACTCACAGG + Intronic
1180362824 22:11914715-11914737 CAGGTCCTTCCTGGACTGACTGG - Intergenic
1180365467 22:11934234-11934256 CAGGTCCTTCCTGGACTGACTGG - Intergenic
1182325508 22:29509631-29509653 AAGGCACTGTTTAGACTGACAGG + Intronic
1182325515 22:29509681-29509703 AAGGCACTGCTTAGACTGACAGG + Intronic
1182325522 22:29509731-29509753 AAGGCACTGCTTAGACTGACAGG + Intronic
1182325529 22:29509781-29509803 AAGGCACTGCTTAGACTGACAGG + Intronic
1182325536 22:29509831-29509853 AAGGCACTGCTTAGACTGACAGG + Intronic
1182325543 22:29509881-29509903 AAGGCACTGCTTAGACTGACAGG + Intronic
952980158 3:38727777-38727799 CTTGCCCTCCTGGGACTGACTGG - Intronic
953407214 3:42665394-42665416 CAGACCCTCCTTGGGCAGACAGG + Exonic
953413248 3:42701837-42701859 CAGGCAACTCTTGGGCTGACGGG + Intronic
953573626 3:44095001-44095023 CAGCTACGCTTTGGACTGACAGG - Intergenic
953622651 3:44546578-44546600 CAGGGGTTCCTTGGAATGACTGG - Intergenic
958118645 3:89256028-89256050 CTTGAACTCCTTGGACAGACTGG - Intronic
958909405 3:99976888-99976910 CAGGCACTCATTAGAAAGACTGG - Intronic
959450488 3:106493067-106493089 TAGGCAATCCATTGACTGACTGG - Intergenic
961818975 3:129565624-129565646 CAGGCACTCCTGGGATCGATGGG - Intronic
963504538 3:146167025-146167047 CAGACACTCCTAGCACTTACAGG - Intergenic
965616337 3:170596610-170596632 CTGACTCTCATTGGACTGACTGG + Intronic
1202739431 3_GL000221v1_random:40230-40252 CAGGTCCTTCCTGGACTGACTGG - Intergenic
968830406 4:2930733-2930755 CAGGGTCTCCCTGGACTGGCGGG + Exonic
970114550 4:12679680-12679702 CTGGCACTTCTTGAACTGTCAGG + Intergenic
979250808 4:118564889-118564911 CAGGGACCCCTAGGACTCACGGG + Intergenic
983186594 4:164707562-164707584 AAGGCACTCCTTGGATTGTGGGG - Intergenic
1202766475 4_GL000008v2_random:153018-153040 CAGGTCCTTCCTGGACTGACTGG + Intergenic
985697232 5:1347523-1347545 CAGGCACTCCATGTACTAACAGG - Intergenic
993785239 5:92124628-92124650 CAGGCACTCCTTGCAATGCCAGG + Intergenic
994591838 5:101783619-101783641 CAGCCACTCGCTGGACTGAAAGG + Intergenic
995913545 5:117216086-117216108 CAGGCCCGGCCTGGACTGACAGG - Intergenic
999212764 5:149904698-149904720 CAGGCAGTCCTTGGACAGGAAGG - Intronic
1001589040 5:172853041-172853063 CAGGCGCTTCTTGGACAAACAGG - Intronic
1006012427 6:31054116-31054138 CGGCCACTCCTTTGAGTGACAGG + Intergenic
1006878784 6:37321288-37321310 CTGGCAGGCCTGGGACTGACAGG - Intronic
1007854819 6:44845266-44845288 CAGGGTCTCCTGGGACTCACAGG + Intronic
1007972590 6:46067721-46067743 CAGGCACTCATTAGAATGCCTGG - Intronic
1011374782 6:86677024-86677046 CGGGCATTCCTTGGAATCACTGG - Intergenic
1018213158 6:161501813-161501835 CAGACAGGCCTTGGACAGACAGG + Intronic
1024491064 7:49986351-49986373 CAGGCACCCATGGGACTGAAAGG + Intronic
1029441373 7:100588593-100588615 CAGCCACTCCTTGGATTTATTGG + Intronic
1033784530 7:144714964-144714986 CTGGTACTCCTGGGACTGAGAGG + Intronic
1035034069 7:155884009-155884031 CGGTCATTCCTTGGACGGACGGG - Intergenic
1040096720 8:43452289-43452311 CATGCATGCATTGGACTGACTGG - Intergenic
1048482157 8:134808251-134808273 CAGGCCCTCCTTGGACTCCTTGG - Intergenic
1048737682 8:137519705-137519727 CAGGCACTCTTTGGACTCCGGGG + Intergenic
1057552742 9:96063941-96063963 AAGGCCTTCCTTGGACTAACTGG + Intergenic
1057820057 9:98323439-98323461 CAGGCACTCCTAGGCCAGGCAGG - Intronic
1061015590 9:127979539-127979561 CAGGCACTCCCTAGTCTGGCTGG - Intronic
1062318346 9:135978781-135978803 CAGGCCCTCCTGGGTCTGAGAGG - Intergenic
1203708075 Un_KI270742v1:70179-70201 CAGGTCCTTCCTGGACTGACTGG - Intergenic
1187304410 X:18082507-18082529 AAGGCTCTCCATGGACAGACTGG + Intergenic
1188442057 X:30222629-30222651 CAGGAAGTCCTTGGACTAATAGG + Intergenic
1197867309 X:131033117-131033139 CAGGCAAGCCTTGGAGGGACAGG - Intergenic
1201962944 Y:19702060-19702082 CCGGAACCCCTTGCACTGACAGG - Intergenic