ID: 1170446590

View in Genome Browser
Species Human (GRCh38)
Location 20:16434292-16434314
Sequence GTCTTCTTCCCACGAGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170446590_1170446597 27 Left 1170446590 20:16434292-16434314 CCCAGATCTCGTGGGAAGAAGAC 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1170446597 20:16434342-16434364 GGCCCGTGTAACCACCGTAATGG 0: 1
1: 0
2: 0
3: 2
4: 14
1170446590_1170446594 -8 Left 1170446590 20:16434292-16434314 CCCAGATCTCGTGGGAAGAAGAC 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1170446594 20:16434307-16434329 AAGAAGACCACAGGAGGACTCGG 0: 1
1: 0
2: 1
3: 28
4: 254
1170446590_1170446596 6 Left 1170446590 20:16434292-16434314 CCCAGATCTCGTGGGAAGAAGAC 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1170446596 20:16434321-16434343 AGGACTCGGCTCAATGCGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170446590 Original CRISPR GTCTTCTTCCCACGAGATCT GGG (reversed) Intronic
905018805 1:34794617-34794639 ATCTTCTGCCACCGAGATCTTGG - Exonic
908730836 1:67225076-67225098 GTCTCCTTCCTAAGAGACCTAGG + Intronic
909071763 1:71002848-71002870 GTCTTCTTCTTAGGAGATCCAGG - Intronic
914745267 1:150496918-150496940 GTCTTCTTTCCTCTAGACCTGGG - Intronic
914783515 1:150807335-150807357 GTCCTCTTCTGACAAGATCTGGG - Intronic
915535862 1:156534924-156534946 GGCTTCTTGTCAGGAGATCTGGG - Intronic
916851257 1:168706540-168706562 GGCTTCTTCCCACAAGAGCTGGG + Intronic
921426462 1:215007343-215007365 GTCTTCATCCCATGAGGACTTGG - Intronic
922823055 1:228497501-228497523 CTCTTCTGCCCAGGAGACCTGGG + Intergenic
924444902 1:244120138-244120160 CTCCACTACCCACGAGATCTTGG + Intergenic
924825654 1:247535229-247535251 GGCTTCAACCCACGAGATCAAGG + Intronic
924939422 1:248802475-248802497 GTTGTCTTCCCAGGAAATCTTGG - Intergenic
1063952020 10:11232410-11232432 GTCTCCTTCACCCGTGATCTTGG + Intronic
1065403852 10:25340147-25340169 GTATTCTTCCCTCAGGATCTTGG + Intronic
1066498051 10:35961607-35961629 ACCTCCTTCCCAGGAGATCTGGG - Intergenic
1076103639 10:127802960-127802982 CTCTTCCTCCCAGGAGCTCTTGG - Intergenic
1078630046 11:12994162-12994184 GTCTTCTCAACACGAGATCCAGG + Intergenic
1079531854 11:21463802-21463824 GTCTCTTTTCCATGAGATCTAGG + Intronic
1080279356 11:30538988-30539010 GTCTTCTTCCTATGAGCTCCAGG - Intronic
1087833682 11:102847709-102847731 GGGTTCTTCCCACGACATGTGGG - Intergenic
1087916953 11:103822134-103822156 ATCTTCTTCCCACCACATATAGG - Intergenic
1088887655 11:114020513-114020535 ATCTTCTTTCCCTGAGATCTGGG - Intergenic
1091745986 12:2993263-2993285 GTCTTTCTCCCACGAGCTCCTGG + Intronic
1093562137 12:20553638-20553660 GTCCTCTGCCCACGAGAGCAGGG + Intronic
1093684379 12:22039771-22039793 GTCTTCTGCTCAAGACATCTGGG + Intergenic
1095338204 12:41055551-41055573 TTCTTCTTCTCAAGAGATCTTGG - Intronic
1099982633 12:89624586-89624608 GTCTTGTCCCCAGGAGAACTGGG + Intronic
1100348174 12:93753044-93753066 GGGTTCTTCCCACGACATGTGGG + Intronic
1104156927 12:126142387-126142409 GGCTTATTCCCACGGGCTCTGGG + Intergenic
1108642705 13:52397396-52397418 GTCCTCTTCCCAGGGTATCTGGG + Exonic
1116134212 14:40900249-40900271 GGCTTCTTCCCACTAGATGCTGG + Intergenic
1118418984 14:65577980-65578002 GTGTTCTTCCCTAGAGGTCTGGG - Intronic
1121818218 14:96944286-96944308 CTCTTCCTGCCATGAGATCTTGG + Intergenic
1122074943 14:99229987-99230009 GACTCCTTCCCAGGAGATTTTGG + Intronic
1128669368 15:69563050-69563072 TCCTTCCTCCCATGAGATCTTGG + Intergenic
1131559612 15:93427889-93427911 GTCTTCCTTCCACAAGATGTGGG - Intergenic
1132710357 16:1263578-1263600 GGCCTCTTCCCACTAGATGTGGG - Intergenic
1138412571 16:56851690-56851712 GTCTTCTTCCCTTGCCATCTGGG - Intergenic
1140911640 16:79458987-79459009 ATTTTCTTCCCAGGAAATCTGGG - Intergenic
1145395091 17:22488217-22488239 ATCTTCTTTCCACGAGGTCCAGG - Intergenic
1150318022 17:64186326-64186348 GTCTGCTTCCCACTAAAGCTGGG + Intronic
1154395551 18:13984629-13984651 GTCTTCTTCCTAAGACTTCTTGG + Intergenic
1161559137 19:4961428-4961450 GTCCTCTGCCCACGAGAGCAGGG + Exonic
1163849161 19:19653835-19653857 GGCTCCTTCCCGGGAGATCTCGG + Exonic
1164626960 19:29735923-29735945 GTCTTCTTCCTAGGACATCCGGG + Intergenic
1164749346 19:30640489-30640511 ATCTTCTTCCCCAGAGATTTTGG - Intronic
926163016 2:10501526-10501548 GTCTTCTTCCCACCACCTCCTGG - Intergenic
927264754 2:21132948-21132970 GGCTTCTACCCACTAGATATTGG + Intronic
932302637 2:70677937-70677959 GTGGTCCACCCACGAGATCTGGG + Intronic
940104794 2:150086505-150086527 GTTTTCTTCCAAATAGATCTGGG - Intergenic
940328980 2:152454402-152454424 GTAGACTTCCCACTAGATCTTGG + Intronic
947201543 2:227618804-227618826 GTCTTCCTCCCTGGAGATCCAGG + Intronic
948879216 2:240847690-240847712 GGGTTCTTCCCATGACATCTGGG - Intergenic
1170063778 20:12288428-12288450 TTCTTCTTCCAACGAGACCCAGG - Intergenic
1170446590 20:16434292-16434314 GTCTTCTTCCCACGAGATCTGGG - Intronic
1171946001 20:31378135-31378157 GCCTTCTTCCCACCAGATAGGGG - Intronic
1175125698 20:56750017-56750039 GTCTTCTTCTCAAGAGATTCAGG + Intergenic
1183882903 22:40850699-40850721 GTCTTATTTCCAAGTGATCTTGG + Intronic
952050016 3:29373510-29373532 GTTTCCTTCCCACAAGGTCTAGG - Intronic
952101102 3:30013991-30014013 ATCTTTTTCCCAAGTGATCTGGG + Intergenic
953113337 3:39966086-39966108 GTGTACTTACCTCGAGATCTTGG - Intronic
956685658 3:71825134-71825156 GTGTTCTTCCCCTGATATCTGGG - Intergenic
957079593 3:75624962-75624984 GTGTTCTTCCGAGGATATCTGGG + Intergenic
957557809 3:81782858-81782880 GGGTTCTTCCCACGACATGTGGG + Intergenic
960409759 3:117308535-117308557 GTGCTCTTCCTAGGAGATCTGGG - Intergenic
964446446 3:156764241-156764263 TTCTTCTCCCCACCAAATCTGGG - Intergenic
968769743 4:2497077-2497099 TTCTGCTTCCAAGGAGATCTCGG - Exonic
969696582 4:8738464-8738486 CTCCTCTTGCCAGGAGATCTTGG - Intergenic
971473993 4:27055579-27055601 GTCTTCTTCCTTTGAGACCTGGG + Intergenic
981697784 4:147575952-147575974 GACCTCTCCCCACAAGATCTTGG + Intergenic
982060766 4:151602087-151602109 GTGTCCTTCCCACGACATGTGGG + Intronic
985484406 5:140531-140553 GGACTCTTCCCAGGAGATCTCGG + Exonic
990535352 5:56716212-56716234 GTCTTCTTTCCAAGAGAGATAGG + Intergenic
990988881 5:61665906-61665928 GTCTTCCTTCCACGAGACCCAGG + Intronic
997397901 5:133579272-133579294 ATATTCTTACCAGGAGATCTTGG - Intronic
998140018 5:139694447-139694469 GTCTTCTTTCCACCAGTTCTAGG + Intergenic
999136354 5:149322496-149322518 GTCTTCTTGCTCTGAGATCTTGG - Intronic
1006011868 6:31049059-31049081 GTCTTCATCTAACGAGCTCTAGG + Intergenic
1006839396 6:37018780-37018802 GTCTTGTTCCAACAATATCTAGG + Intronic
1006897956 6:37482759-37482781 GTCTCCTTCCCACTCGAGCTGGG + Intronic
1007121500 6:39385829-39385851 CTCTTCTTCCAACACGATCTAGG - Intronic
1008127439 6:47684749-47684771 GTCTTCCTCCCACATCATCTGGG - Intronic
1009316309 6:62225084-62225106 GGCTTCTACCCACTAGATCCTGG - Intronic
1010443413 6:75925483-75925505 GCCTTCTTCCCATGAGCACTAGG - Intronic
1014458375 6:121665300-121665322 GTCTTCTTCCTTCTAGATCCAGG - Intergenic
1015228894 6:130890852-130890874 GTTTTCTTCCCAGGAGAAATAGG - Intronic
1017513272 6:155132975-155132997 GTCTCCTACCCACGGGAACTGGG + Intronic
1017897158 6:158690517-158690539 GTCTACTTCCAAGGAAATCTGGG - Intronic
1017930893 6:158954061-158954083 GTTTTATTTCCACGACATCTAGG - Intergenic
1017989569 6:159474180-159474202 GGCTCCTTCCCATGTGATCTAGG + Intergenic
1018040894 6:159921252-159921274 GTTTTCTTCCCACAACATGTGGG - Intergenic
1022730139 7:33015140-33015162 GTCTTCTGCCCACTAGATGCTGG - Intronic
1023237816 7:38108918-38108940 GTCTACTTCCCGGAAGATCTTGG - Intergenic
1023302234 7:38785089-38785111 GTCTTATTCCCAAGAGATTCTGG + Intronic
1030081467 7:105782378-105782400 AACTTCTCCCCACGAGATCTAGG - Intronic
1030779633 7:113584264-113584286 GTCTTCTTCACATGAGACTTGGG + Intergenic
1031324422 7:120374991-120375013 GTCTTCTCTCCATGAGAACTTGG + Intronic
1035379591 7:158429264-158429286 GTGTTCTTCCCTGGAGATGTGGG - Intronic
1037569266 8:20144960-20144982 AACTTCTTCCCATGAAATCTTGG + Exonic
1040937993 8:52800881-52800903 GTCATCTCCCCAGGAGTTCTGGG - Intergenic
1041925793 8:63234849-63234871 GTCTTGAGCCCAGGAGATCTGGG - Intergenic
1042264469 8:66893900-66893922 GTCCTCTCCCCACAAGAACTTGG + Intronic
1044208787 8:89524017-89524039 GTACTCTTCCCACTGGATCTGGG - Intergenic
1045785869 8:105919360-105919382 GGGTTCTTCCCACGATATGTGGG - Intergenic
1047214416 8:122864895-122864917 GTCTTCTTCCCCTGGGGTCTGGG + Intronic
1049349361 8:142155930-142155952 GGCTTCTTCCCAGGAGGGCTTGG + Intergenic
1057572418 9:96214756-96214778 GTCTTCTTCCCCAGTGCTCTGGG - Intergenic
1060412845 9:123411393-123411415 GTCTCGTTCCCGCCAGATCTTGG - Intronic
1061186846 9:129059910-129059932 GGCTTCTCCCCACGTGCTCTGGG + Intronic
1061198422 9:129121651-129121673 GGCTTCTACCCACTAGATGTTGG + Intronic
1061312823 9:129775162-129775184 GTCCTGTGCCCACGAGGTCTTGG + Intergenic
1061579780 9:131529940-131529962 GCCTTCTTCCCACAAGTCCTTGG + Intronic
1188321460 X:28743211-28743233 GTTTTCTTCCCACTATACCTGGG + Intronic
1189868242 X:45353765-45353787 GACTTCTTCCAACCAGAACTGGG + Intergenic
1197225227 X:123950430-123950452 GTCTTCTCCCTACCAGATTTTGG - Intergenic
1198155555 X:133956738-133956760 GTCCTATTCCCACCAGCTCTAGG + Intronic