ID: 1170446591

View in Genome Browser
Species Human (GRCh38)
Location 20:16434293-16434315
Sequence GGTCTTCTTCCCACGAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170446591_1170446594 -9 Left 1170446591 20:16434293-16434315 CCAGATCTCGTGGGAAGAAGACC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1170446594 20:16434307-16434329 AAGAAGACCACAGGAGGACTCGG 0: 1
1: 0
2: 1
3: 28
4: 254
1170446591_1170446597 26 Left 1170446591 20:16434293-16434315 CCAGATCTCGTGGGAAGAAGACC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1170446597 20:16434342-16434364 GGCCCGTGTAACCACCGTAATGG 0: 1
1: 0
2: 0
3: 2
4: 14
1170446591_1170446596 5 Left 1170446591 20:16434293-16434315 CCAGATCTCGTGGGAAGAAGACC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1170446596 20:16434321-16434343 AGGACTCGGCTCAATGCGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170446591 Original CRISPR GGTCTTCTTCCCACGAGATC TGG (reversed) Intronic
901361563 1:8705382-8705404 AGGCTTCTTCCCACCAGAGCAGG + Intronic
903268052 1:22170299-22170321 GGTCTGCTCCCCACAAGATTGGG - Intergenic
906075516 1:43049215-43049237 GGCTTTCTTCCCAAGAGACCCGG + Intergenic
914745268 1:150496919-150496941 GGTCTTCTTTCCTCTAGACCTGG - Intronic
916851256 1:168706539-168706561 AGGCTTCTTCCCACAAGAGCTGG + Intronic
1071273839 10:84034712-84034734 GGTCTTCTTTCCAGGGGACCTGG - Intergenic
1082825133 11:57571920-57571942 GGTATTCTTGCCACAAGAGCAGG + Intergenic
1089630185 11:119779579-119779601 GCTCTGCTTCCCACCAGAACAGG + Intergenic
1093562136 12:20553637-20553659 AGTCCTCTGCCCACGAGAGCAGG + Intronic
1094524326 12:31221696-31221718 GGTCTTCTTCCCGGGACCTCAGG - Intergenic
1102657139 12:114491532-114491554 GGTCTTCTTCCCTCAAGACCTGG + Intergenic
1104095860 12:125557363-125557385 GGTCTGCCTCCCCTGAGATCAGG + Intronic
1104433309 12:128734398-128734420 TCTCTTCTTGCCACGACATCAGG - Intergenic
1108642704 13:52397395-52397417 GGTCCTCTTCCCAGGGTATCTGG + Exonic
1109341372 13:61064767-61064789 TGTCTCGTTCTCACGAGATCTGG - Intergenic
1113868557 13:113544429-113544451 GGTGGTCTTCCCACTAGATGAGG + Intronic
1115741197 14:36390734-36390756 GGCCTTCTTCCCTGGAGACCAGG - Intergenic
1131559613 15:93427890-93427912 GGTCTTCCTTCCACAAGATGTGG - Intergenic
1137347224 16:47675383-47675405 GGTCTTCTCCCCATGACATTTGG + Intronic
1138304679 16:55963600-55963622 GGTCTTCTTCCCACTGCATGGGG - Intergenic
1140333857 16:74084703-74084725 GCTCTTCTTCTCAAGATATCGGG + Intergenic
1141184579 16:81778558-81778580 TAGCTTCTTCCCATGAGATCAGG + Intronic
1148355413 17:46972351-46972373 GGACTTCTTCCCACTATAGCTGG - Intronic
1150318021 17:64186325-64186347 GGTCTGCTTCCCACTAAAGCTGG + Intronic
1158021311 18:52845493-52845515 GGTCTTTTTCCTAAGAGATCTGG - Intronic
1158238437 18:55347630-55347652 GGTCTTCCTCCCAGGCAATCAGG - Intronic
1160380796 18:78453840-78453862 GGTCTTCCTCCCATGAGCTGAGG - Intergenic
1161559136 19:4961427-4961449 AGTCCTCTGCCCACGAGAGCAGG + Exonic
1164626959 19:29735922-29735944 TGTCTTCTTCCTAGGACATCCGG + Intergenic
925452843 2:3985370-3985392 GGTCATCTTCCCACACCATCAGG + Intergenic
925498669 2:4480659-4480681 GTTATTGTTCCCACAAGATCTGG - Intergenic
925672391 2:6325398-6325420 GGTCTTCTACGCAGGAGCTCCGG + Intergenic
926205568 2:10832716-10832738 GGTCTTCCTTCCAGGAGGTCGGG + Intronic
929010271 2:37435119-37435141 GGTCTCCTTCCCAAGAGAAAGGG - Intergenic
929969701 2:46563505-46563527 TATCTTCTTCCCACCAGCTCTGG - Intronic
937771284 2:125723340-125723362 GGTCTTCTTCCCTCAAAACCAGG + Intergenic
939649693 2:144745583-144745605 GCTCTTCCTCCCACAAGCTCTGG - Intergenic
940343414 2:152604496-152604518 GGTCTGCTTCTCAGGAGAGCTGG + Intronic
947934347 2:233990691-233990713 GGTGTTCTAACCACGAGCTCAGG + Intronic
1170446591 20:16434293-16434315 GGTCTTCTTCCCACGAGATCTGG - Intronic
1171946002 20:31378136-31378158 TGCCTTCTTCCCACCAGATAGGG - Intronic
957079592 3:75624961-75624983 GGTGTTCTTCCGAGGATATCTGG + Intergenic
957758702 3:84526195-84526217 TGTGCTCTTCCCAAGAGATCAGG - Intergenic
965067123 3:163864303-163864325 GGTCATCTTCCCCTGAGGTCTGG - Intergenic
969664231 4:8547940-8547962 AGTCTCATTCCCATGAGATCAGG + Intergenic
969898233 4:10324550-10324572 GGACTTCTTCCTAGGAGATGTGG + Intergenic
971355513 4:25891329-25891351 GGTCTTAATCCCCCGAGACCTGG + Intronic
971984311 4:33800973-33800995 GGTTTTCTTCCCAAGAGACTGGG + Intergenic
984467132 4:180114339-180114361 GTTCTTCTTCCCACTGCATCAGG - Intergenic
1001501741 5:172242025-172242047 GGTGCCCTTCCCATGAGATCTGG + Intronic
1005054765 6:21719230-21719252 GGACTTCTTCCCTCCAGAACTGG - Intergenic
1015156720 6:130104554-130104576 GCTCTTCTTCCCCTGAAATCAGG + Exonic
1028699664 7:93762566-93762588 GGGTTTCTTCCCACTAGATCTGG + Intronic
1029841408 7:103367604-103367626 GGTTTTCTTACCTCTAGATCGGG - Exonic
1037724106 8:21468837-21468859 GGTCTTCTTCCAAAGACACCAGG - Intergenic
1038285999 8:26206984-26207006 GGTCATCTTCCCCCGAAGTCGGG - Intergenic
1039203212 8:35119712-35119734 GATCTTCTTTACACAAGATCAGG - Intergenic
1044208788 8:89524018-89524040 GGTACTCTTCCCACTGGATCTGG - Intergenic
1047214415 8:122864894-122864916 GGTCTTCTTCCCCTGGGGTCTGG + Intronic
1055152334 9:73017192-73017214 GGTCATCTTCCCCCGAAGTCAGG - Intronic
1056676145 9:88678646-88678668 CGTCTTCTTCCCAGGAAACCTGG + Intergenic
1056744003 9:89284135-89284157 GTTTTTTTTCCCACGAGATGAGG - Intergenic
1058763750 9:108161660-108161682 TGTCTCCTTCCCACGAGTCCTGG - Intergenic
1060980423 9:127788530-127788552 GCTCTTCTTCCCAGGGGAGCGGG + Exonic
1062719848 9:138034299-138034321 GGTCTTGTTACCACTAGATAGGG + Intronic
1189868241 X:45353764-45353786 GGACTTCTTCCAACCAGAACTGG + Intergenic
1200210549 X:154345045-154345067 GCTGTTCTTCCCGCGGGATCGGG - Intergenic
1200220303 X:154387047-154387069 GCTGTTCTTCCCGCGGGATCGGG + Intergenic