ID: 1170446594

View in Genome Browser
Species Human (GRCh38)
Location 20:16434307-16434329
Sequence AAGAAGACCACAGGAGGACT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 254}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170446582_1170446594 28 Left 1170446582 20:16434256-16434278 CCCTTCCGGTGGCTCTGGTGATT 0: 1
1: 0
2: 1
3: 11
4: 96
Right 1170446594 20:16434307-16434329 AAGAAGACCACAGGAGGACTCGG 0: 1
1: 0
2: 1
3: 28
4: 254
1170446583_1170446594 27 Left 1170446583 20:16434257-16434279 CCTTCCGGTGGCTCTGGTGATTG 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1170446594 20:16434307-16434329 AAGAAGACCACAGGAGGACTCGG 0: 1
1: 0
2: 1
3: 28
4: 254
1170446590_1170446594 -8 Left 1170446590 20:16434292-16434314 CCCAGATCTCGTGGGAAGAAGAC 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1170446594 20:16434307-16434329 AAGAAGACCACAGGAGGACTCGG 0: 1
1: 0
2: 1
3: 28
4: 254
1170446584_1170446594 23 Left 1170446584 20:16434261-16434283 CCGGTGGCTCTGGTGATTGCAGG 0: 1
1: 0
2: 2
3: 12
4: 199
Right 1170446594 20:16434307-16434329 AAGAAGACCACAGGAGGACTCGG 0: 1
1: 0
2: 1
3: 28
4: 254
1170446581_1170446594 29 Left 1170446581 20:16434255-16434277 CCCCTTCCGGTGGCTCTGGTGAT 0: 1
1: 0
2: 0
3: 7
4: 154
Right 1170446594 20:16434307-16434329 AAGAAGACCACAGGAGGACTCGG 0: 1
1: 0
2: 1
3: 28
4: 254
1170446591_1170446594 -9 Left 1170446591 20:16434293-16434315 CCAGATCTCGTGGGAAGAAGACC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1170446594 20:16434307-16434329 AAGAAGACCACAGGAGGACTCGG 0: 1
1: 0
2: 1
3: 28
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170446594 Original CRISPR AAGAAGACCACAGGAGGACT CGG Intronic
904147635 1:28406705-28406727 ATAAAAACCACAGGAGGAGTAGG + Intronic
904694914 1:32324055-32324077 AAGAAGACTGCATGAGGCCTAGG + Intronic
905836210 1:41123991-41124013 AAGAAGTCCAGAGAAGGCCTGGG + Intronic
906095686 1:43222538-43222560 AACAAGACCAAAGGAGAACAGGG + Intronic
906144561 1:43552208-43552230 AAGAAGGCCAAAGAATGACTGGG - Intronic
906480665 1:46197307-46197329 TAGAAGAATACAGGAGCACTGGG - Intronic
906814842 1:48868077-48868099 AAGAGGTCAGCAGGAGGACTGGG - Intronic
906860061 1:49349888-49349910 GAAAAGACCACATGAAGACTGGG + Intronic
907220787 1:52905588-52905610 AAGCAGAACTCAGGAGGACATGG - Intronic
907900433 1:58736157-58736179 GAGAAGACCACATGAAGACATGG + Intergenic
909060244 1:70870909-70870931 AAGAAGACGACAGGAAGATGAGG - Intronic
910303616 1:85736258-85736280 AGGAAGACCAGAGAAGTACTGGG - Intronic
911604751 1:99891242-99891264 AATAAGACCAAAGAATGACTTGG + Exonic
912230111 1:107783465-107783487 AAGAAGAACCCAGGATGACCTGG + Intronic
913074574 1:115331014-115331036 AGGAAAAGCACAGGAGGTCTGGG - Intronic
915778982 1:158524241-158524263 AGGAAGACCAAATGAGTACTTGG + Intergenic
916170689 1:161999576-161999598 AAGAAGACAAGAGGAGGAGGAGG + Intronic
916642997 1:166751522-166751544 AAGAAGACCAGAGGAGATATTGG + Intergenic
916674496 1:167054364-167054386 AAGAAGAGCAGAGGAGCACTGGG - Exonic
916972100 1:170032541-170032563 AAGAAGTCCAGAGGACGATTTGG - Intronic
917793949 1:178519166-178519188 AAGAACACCACAGCTGGACCAGG + Intronic
917978467 1:180254901-180254923 AAGAAGACAGCAGGAGGGCCTGG + Intronic
919852927 1:201685805-201685827 ACGAAGAGCACAGGAAGATTAGG - Intronic
921159577 1:212463616-212463638 AGGAAGATCAAAGGAGGACGAGG + Intergenic
921330732 1:214033099-214033121 AAGAACTGCACAGGAGGTCTGGG - Intronic
921410632 1:214832687-214832709 AAGAAGACCACATGATGATGGGG - Intergenic
922323065 1:224504478-224504500 CAGAAGACCGCAGGAGGAAAGGG - Intronic
923148112 1:231211630-231211652 AGGAAGTCCCGAGGAGGACTTGG - Intronic
924154944 1:241166222-241166244 AAGAAGAAAACAGGATGAGTGGG + Intronic
1063620242 10:7640664-7640686 AGGAAGACGACAAGAGGAGTAGG + Intronic
1063818358 10:9804619-9804641 ATAAAGACCACAGGAAGATTAGG + Intergenic
1063883370 10:10553249-10553271 AAGAACAGCACAGGAAGACCTGG + Intergenic
1064076120 10:12270122-12270144 AAGATGTGCACAGGAGAACTTGG - Intergenic
1067977863 10:51046321-51046343 AGAAGTACCACAGGAGGACTGGG - Intronic
1069393820 10:67966271-67966293 AAGACTACCAAAAGAGGACTGGG - Intronic
1070770254 10:79078247-79078269 AAGGAGGCCACAGAGGGACTGGG + Intronic
1071154189 10:82670805-82670827 AAGAACACAAAAGGAGGACCTGG - Intronic
1073676315 10:105650724-105650746 AAGAATAGCAAAGGAGGACTTGG + Intergenic
1074976246 10:118584182-118584204 AAGAAGACCATAGGAGGGCATGG - Intergenic
1075299575 10:121309910-121309932 AAGAAGAACACAGGAAGAAATGG - Intergenic
1076052970 10:127349818-127349840 AAGAAGGCCACAGGAAGATGGGG - Intronic
1076781176 10:132725455-132725477 AACAAGACCACATAAGAACTGGG + Intronic
1077408733 11:2393856-2393878 AAGGAGGCCACATGGGGACTGGG - Intronic
1077459568 11:2702054-2702076 AGGAAGGCCAGAGGAGGCCTGGG - Intronic
1078400586 11:11022911-11022933 AAGAAGACCACAGGAGGTGATGG + Intergenic
1080003328 11:27376413-27376435 AAGAAGAGAACAGGAGGAGGAGG + Intronic
1081923087 11:46797635-46797657 AAGAGGAACACAGGAGAATTTGG + Intronic
1084044013 11:66558702-66558724 CAGAAGACCAGAGCAGGGCTGGG - Intronic
1084890455 11:72234223-72234245 GAGAGGATCACAGGAGGAATGGG - Intronic
1085384164 11:76147193-76147215 AAGGAGAGGACAGGAGCACTTGG + Intergenic
1085688461 11:78646996-78647018 AAGAAAACCAGAGGAGGAGGAGG + Intergenic
1087105305 11:94401722-94401744 AGGAAGCCCACAGGGGCACTTGG + Intergenic
1088087393 11:105997258-105997280 AAGAAGACAACAAGAGGAAGAGG + Intronic
1089080391 11:115771807-115771829 AAGAAGATCAGAGGAGGCCCTGG + Intergenic
1089099894 11:115953774-115953796 AAGAAGACTAGAGGAGAAGTGGG + Intergenic
1089731972 11:120524930-120524952 AAGAAGACGGAAGGTGGACTAGG - Intronic
1090090645 11:123694442-123694464 AAGATGTCCAGAGGAGAACTGGG + Intergenic
1090449021 11:126789785-126789807 AAGAAGCTAACAGGAAGACTGGG - Intronic
1091409386 12:229125-229147 AAGAAGCACAGAGGAGGATTTGG + Intronic
1092260892 12:6952812-6952834 TGGGAGACCACAGGAGGAGTCGG - Intronic
1092812445 12:12284391-12284413 AAGAAGACCTCAGGAGGAGGGGG + Intergenic
1094825112 12:34263979-34264001 AAGAGGACCACTGGGGGCCTGGG - Intergenic
1095772623 12:45978551-45978573 AAGAAGACTACAGGAGCACTTGG + Intronic
1096332522 12:50726575-50726597 AGGTAGACCACTTGAGGACTGGG - Intronic
1098849524 12:75578541-75578563 TAGAACAAGACAGGAGGACTGGG - Intergenic
1098908956 12:76189855-76189877 AAGAAGACCACGGGAAGACAAGG - Intergenic
1099509322 12:83513957-83513979 AAAAATAACACAGGAGCACTTGG + Intergenic
1100944703 12:99768530-99768552 AAGAAAACATCAGGAGGGCTGGG + Intronic
1104374745 12:128254612-128254634 AAGCAGTCCATAGGAGGGCTAGG - Intergenic
1104648878 12:130516863-130516885 GAAAAGACCACAGGATGACAAGG + Intronic
1104884791 12:132100458-132100480 AAGTGGACCACAGAAGGTCTGGG - Intronic
1105989475 13:25603790-25603812 AGGAAGACCATAGGAGGAGCAGG + Intronic
1106116769 13:26824479-26824501 AAGAAGGCCACAGGTGGGCAGGG - Intergenic
1106967687 13:35091078-35091100 GATAAGACCACATGAGGGCTGGG - Intronic
1107748143 13:43534622-43534644 AAGATGACCACAGTAGGAATGGG + Intronic
1108789098 13:53944825-53944847 ATGAAGAGCAGAGGAGTACTGGG - Intergenic
1110847420 13:80206183-80206205 AAAAAGACCACAGGAAGCCCTGG + Intergenic
1111447170 13:88361836-88361858 GAGAAGAGCACAGGAGCACACGG + Intergenic
1111645906 13:91031647-91031669 GAGAAGCCCTCAGCAGGACTGGG + Intergenic
1113770624 13:112906046-112906068 GAGAAGGTCACAGGAGGCCTGGG + Intronic
1114599204 14:23940776-23940798 TAGAAGACCCCAGGAGGAGTGGG + Intergenic
1116774480 14:49164589-49164611 AAGAAGTCCACAGGAGGCTCTGG - Intergenic
1117580468 14:57146183-57146205 GAGAAGACACTAGGAGGACTAGG - Intergenic
1119982676 14:79099843-79099865 AGGAAGACAATAGGAAGACTTGG - Intronic
1124076621 15:26452081-26452103 AGGAAGCACACAGCAGGACTGGG - Intergenic
1124111952 15:26798716-26798738 AACAAGAACACTGGAGGAATTGG - Intronic
1128185223 15:65639040-65639062 CAGAAGACCACAGAAGACCTGGG + Intronic
1128566458 15:68703581-68703603 TAGAAGTTCACAGGAGGAGTTGG - Intronic
1128608926 15:69058513-69058535 AAGAATACGAGAGGAGGAGTGGG + Intronic
1128938050 15:71764884-71764906 AGGAAGAACCCAGGAGAACTTGG - Intronic
1130028575 15:80291803-80291825 AAGAAAACCACAGAAGCACTAGG + Intergenic
1131256892 15:90869006-90869028 AAGGAGACAACAGGAGTGCTTGG + Intronic
1133318115 16:4896568-4896590 AAGAAGACCAAAGGTGACCTGGG + Intronic
1135511364 16:23086886-23086908 AAGAAAAGCCCTGGAGGACTTGG - Intronic
1135741035 16:24975443-24975465 AAGAAGGCAACAGAAGGACAAGG + Intronic
1136217239 16:28802688-28802710 AGGAACACCACAGGAGGAAGGGG + Intergenic
1137350742 16:47712313-47712335 CAGAAGACAACAATAGGACTTGG - Intergenic
1137502776 16:49024236-49024258 AGGAAGACCATATGAGGACATGG - Intergenic
1138472413 16:57248346-57248368 AAAAAGAAAACAGGAGGATTGGG + Intronic
1140236502 16:73164080-73164102 AGGGAGCCCACAGGAGAACTTGG + Intergenic
1140357475 16:74318796-74318818 AAAGAGAACATAGGAGGACTCGG - Intergenic
1141868795 16:86770090-86770112 AAGGAGCCCTCAGTAGGACTCGG + Intergenic
1141900158 16:86985744-86985766 AAGAAGACAACAGTGGGCCTGGG + Intergenic
1143125516 17:4639134-4639156 TAGAAGGACAGAGGAGGACTTGG + Intronic
1143402956 17:6657678-6657700 TAGAAGGCCAGAGGAGGGCTTGG - Intergenic
1143588285 17:7863303-7863325 GAGATTACCACAAGAGGACTTGG - Intronic
1146432540 17:32811284-32811306 AGGAAGACAACAGGATGAGTAGG - Intronic
1146957030 17:36941981-36942003 AGGAATCCCACAGGAGGACCTGG - Intronic
1147603416 17:41759721-41759743 AACAAGACGCCAGGAGGACAGGG + Intronic
1148139128 17:45316385-45316407 AAGAATTACAGAGGAGGACTGGG + Intronic
1149307826 17:55366039-55366061 AAGAAAAGTACAGGAGGACTAGG + Intergenic
1150493853 17:65592622-65592644 AAGAAGCCGCCAGGAGGCCTTGG + Intronic
1150665121 17:67127222-67127244 AACATGGCCACAGGCGGACTCGG + Intronic
1150726018 17:67652262-67652284 GAGAAGCCCACAGGAGAGCTTGG - Intronic
1152162594 17:78678127-78678149 AGCAAGCCCACAGGAGAACTTGG + Intronic
1152800863 17:82330087-82330109 AAGGAGACCCCAGGGGGCCTGGG + Intronic
1153263563 18:3246949-3246971 AAGCAGACCTCAGGAGAAATAGG + Intergenic
1155684703 18:28534394-28534416 TAGAAGACCACTGGGGGACATGG + Intergenic
1156510791 18:37634896-37634918 CAGAAGCCCAAAGGAGGGCTAGG - Intergenic
1157567813 18:48691616-48691638 AGGAAGACCAGACAAGGACTGGG - Intronic
1161168196 19:2799869-2799891 CAGAAGCCCACAGGAGGAAGCGG - Intronic
1161232969 19:3184403-3184425 GAGAAGCCCAGAGGAGGCCTAGG - Intergenic
1162481025 19:10927297-10927319 CAGAAGACCAAAGATGGACTGGG - Intronic
1164294918 19:23901397-23901419 AAGATGGCCACAGGCAGACTGGG - Intergenic
1164439587 19:28263173-28263195 AAGAAGACTACATGAGCAGTAGG - Intergenic
1165092701 19:33395165-33395187 CAGAGGCCCACAGGAGGAATGGG - Intronic
1167784899 19:51628495-51628517 AACCAGACCACAGGAGGGATGGG + Intronic
925285693 2:2714293-2714315 ATCAACACCACAGGAGGACTGGG - Intergenic
926478751 2:13360200-13360222 AAGAAGAAGACAGGAGGACGTGG - Intergenic
927021519 2:19021893-19021915 AAGCAGAGCACAGGATGGCTAGG - Intergenic
927045684 2:19275939-19275961 AAGAAGGTCAGAGGATGACTGGG - Intergenic
931099049 2:58974672-58974694 AAGATGACCAGAGAAGGAATGGG + Intergenic
932454727 2:71842081-71842103 AAGGAGACCACATGAACACTGGG - Intergenic
932808261 2:74801398-74801420 GAGAAGGCCACATGAGGACATGG + Intergenic
933068737 2:77832477-77832499 AAGAGGACCTCTGGAGGACTTGG - Intergenic
934121866 2:88847935-88847957 GAGAGGTCCACAGGAGGGCTGGG - Intergenic
934813828 2:97307028-97307050 CAGATGCCCACAGGAGAACTTGG - Intergenic
934823867 2:97401454-97401476 CAGATGCCCACAGGAGAACTTGG + Intergenic
936795083 2:116195015-116195037 CAGAAGAACACAGGAAGACGTGG - Intergenic
937129431 2:119496574-119496596 AAGAAGAAGACAGATGGACTAGG + Intronic
937338047 2:121074224-121074246 AAGAAGGCCACAGGAGGCTCTGG + Intergenic
937759666 2:125585866-125585888 CAGAAGAACACGGAAGGACTTGG - Intergenic
937980880 2:127614671-127614693 AAGGGGACCCCAGGAGAACTGGG - Intronic
938158167 2:128959021-128959043 GGGAAGACCACATGAGGACACGG + Intergenic
939273275 2:139967369-139967391 AAAACAACCACAGTAGGACTTGG + Intergenic
939617859 2:144380541-144380563 AAGAATAACTCAGGAGGCCTCGG + Intergenic
944636221 2:201678456-201678478 AAGCAGACCACAGGGAGAGTTGG - Intronic
945900574 2:215533362-215533384 AAGAAGACGACAGGAAGATGAGG + Intergenic
946182061 2:217954802-217954824 AGGAAGCCCACAGGGGGCCTGGG - Intronic
946616595 2:221516919-221516941 AAAAAGAGCACAGGAGTGCTTGG - Intronic
947295521 2:228626436-228626458 AAGAAGAGTGCAGGAGGATTAGG + Intergenic
947336669 2:229093002-229093024 AAGAGGACCACAGTCTGACTTGG - Intronic
947615421 2:231553930-231553952 AAGAAGACAAGATCAGGACTAGG + Intergenic
947817992 2:233050883-233050905 GGGAAGGCCACAGGAGGACAAGG + Intergenic
1170446594 20:16434307-16434329 AAGAAGACCACAGGAGGACTCGG + Intronic
1172363343 20:34330473-34330495 AAGATAACCACAGGATGACGGGG + Intergenic
1172945854 20:38688668-38688690 AACAAGACCACAAGAGATCTGGG - Intergenic
1173264864 20:41469947-41469969 AAGAGGAGGACAGGAGGATTTGG + Intronic
1173569561 20:44067598-44067620 AGGAGGCCCACAGGAGGACTAGG - Intronic
1174493619 20:50922564-50922586 AAAAAAAACGCAGGAGGACTGGG - Intronic
1174533995 20:51236960-51236982 AAGGTGAGGACAGGAGGACTGGG + Intergenic
1175829247 20:61953069-61953091 AGGTGGACAACAGGAGGACTGGG + Intergenic
1175972887 20:62695892-62695914 AAGAGGACAACAGGAACACTTGG + Intergenic
1179010963 21:37555868-37555890 AAGATAACCACAGGTGGACATGG + Intergenic
1181473765 22:23156419-23156441 AGGGGGACCACGGGAGGACTGGG + Intronic
1183746271 22:39693879-39693901 CAGAAGCCCAAAGGAGAACTTGG + Intergenic
1184272553 22:43393088-43393110 AAGGATCCCACAGGAAGACTGGG - Intergenic
1185232225 22:49689833-49689855 AAGGAGACCACAGGAGCCCTGGG + Intergenic
949522952 3:4873408-4873430 CAGCAGACCACCGGAGAACTTGG + Intronic
950112223 3:10426584-10426606 ATGAAGGCCACAGAAGGACTTGG + Intronic
950159716 3:10750949-10750971 AATAAGTCCAGAGGAGGAGTGGG - Intergenic
950233721 3:11299494-11299516 AGGTGGACCACAGGAGGACTAGG + Intronic
950749982 3:15120732-15120754 AAGAAGACCCTAGATGGACTGGG + Intergenic
952841741 3:37652319-37652341 AAGAAGAAAACAGGAGGAAGTGG - Intronic
952937604 3:38412487-38412509 AAGAAGACCCTTGGTGGACTTGG + Intronic
953577983 3:44128506-44128528 AAACAAACCACAGGAAGACTTGG - Intergenic
954996333 3:54885216-54885238 TTGAAGCACACAGGAGGACTGGG + Intronic
956200385 3:66699470-66699492 AAGAAGCCCATGGGAGGAATGGG - Intergenic
956622454 3:71234960-71234982 GAGATGACCATAGGAAGACTGGG - Intronic
959303558 3:104631713-104631735 CAGAAGGCCAAAGGGGGACTAGG + Intergenic
959776509 3:110170934-110170956 AAGAAGAAGAAAGGAGGATTGGG - Intergenic
962248364 3:133818070-133818092 ATCAAGAGCACAGGAGGACAGGG - Intronic
964647850 3:158977672-158977694 AAGCAGCCCACAGCACGACTGGG - Intronic
964883970 3:161459003-161459025 AATAGGACCAAAGGAGGAGTGGG - Intergenic
965712030 3:171564998-171565020 AAGATGACCTCAGGAAGTCTTGG - Intergenic
965898716 3:173612587-173612609 AAGAAGACCGCATGAAGACATGG - Intronic
965948350 3:174270685-174270707 AAGAAGAAAAGAGGAGGACCTGG + Intronic
967421564 3:189278796-189278818 AAGAAGATCACAGGCAGACCTGG - Intronic
967586180 3:191216858-191216880 CAGAAGAAGACAGGAGGACGTGG - Intronic
969051295 4:4375070-4375092 AAGAAGCCCATGGGAGGACCTGG - Intronic
970017646 4:11530743-11530765 AAGAAGGCCACGTGAGGACCTGG - Intergenic
970973980 4:22021718-22021740 TAGAGGGCCACAGCAGGACTGGG + Intergenic
971317060 4:25576403-25576425 AGCAAAACCACAGGAAGACTAGG - Intergenic
972388731 4:38592684-38592706 AAGAAGACAACATGGGGACTTGG - Intergenic
972668303 4:41189368-41189390 AGGAAGGCCACAGGAGGGATAGG + Intronic
973032290 4:45359894-45359916 CAGAAGAAGACAGGAAGACTTGG + Intergenic
976940373 4:90694133-90694155 AAGAAGACTAGAGTAGGAGTTGG + Intronic
978283255 4:107042500-107042522 GGGATGACCACAGGAGGACACGG - Intronic
980160368 4:129154546-129154568 AAGAAGATCAGAGGTGAACTAGG + Intergenic
981144603 4:141309835-141309857 GAGCAGACAGCAGGAGGACTGGG + Intergenic
983952281 4:173656053-173656075 AGGAAGATCAAAGGTGGACTAGG + Intergenic
984289846 4:177781579-177781601 AATCGGACCACAGGTGGACTTGG + Intronic
984995000 4:185421973-185421995 AAGAACATCAGAGGAGGAATGGG - Intronic
985535337 5:461986-462008 AAGAAGAGCACCTGAGGAATCGG + Exonic
986281318 5:6325222-6325244 AAGAAGACAAGAGGAGATCTGGG + Intergenic
986350539 5:6875131-6875153 AAGATGTTCACAGGAGGAATTGG - Intergenic
986550324 5:8946903-8946925 AAGAAGACCAAAGGACAATTTGG - Intergenic
987381844 5:17292781-17292803 AAGAAAAGCCCTGGAGGACTGGG - Intergenic
988743593 5:34108412-34108434 AAGAACACCTAAGGTGGACTTGG - Intronic
990854307 5:60246382-60246404 AAGGAGAGCACAGGAAGATTTGG - Intronic
992625962 5:78636072-78636094 AAGAAGAGCACAGGATGCCTGGG - Intronic
992657910 5:78928870-78928892 CACAAGACCACAGGAGAAATGGG - Intronic
997883796 5:137613251-137613273 AACAAGAAGACAGCAGGACTTGG + Intergenic
998665826 5:144296225-144296247 AAAAGGACCCCAGGAGGTCTGGG + Intronic
998887927 5:146713985-146714007 AACAAGACCAGATGAGGTCTTGG + Intronic
999122277 5:149218670-149218692 AAGAAGGGCACAGGAAGACAAGG - Intronic
1000625238 5:163530730-163530752 AAGAAGTCCACAGGAGTTCAAGG - Intergenic
1001144997 5:169176129-169176151 AAGAAGAGGAGTGGAGGACTTGG - Intronic
1001208312 5:169785781-169785803 AAGAAGCCCACAGGAAGAGGGGG - Intronic
1001235583 5:170026487-170026509 ACCAAGACCAAAAGAGGACTTGG - Intronic
1004583082 6:16973239-16973261 AAGAAGACCACAAGGGGAATCGG + Intergenic
1006073427 6:31513630-31513652 AACAAGACCACAGGAGGTAGAGG + Intergenic
1007937882 6:45750136-45750158 AAAAAGACCACAGCAGGAAAAGG + Intergenic
1011260678 6:85466526-85466548 TAGAGGACCACAGGAGTGCTTGG + Intronic
1013769727 6:113614244-113614266 AAGCAGAGCACATGAGGAATGGG - Intergenic
1014148684 6:118028246-118028268 AAGAAGAACACAGGAGAAAGCGG - Intronic
1014725765 6:124970073-124970095 AAGAAGACAGCAGGAGGAGTGGG + Intronic
1015295126 6:131582380-131582402 AAGAAGGGCCCAGCAGGACTGGG + Intronic
1015683515 6:135834204-135834226 AAGAAAACCTAAGGAGGACGGGG - Intergenic
1017723335 6:157259400-157259422 AAGAGGCCCACAGGAGCCCTGGG + Intergenic
1017848063 6:158276893-158276915 AAGAAGACCAGCAGAGGTCTTGG - Intronic
1017919031 6:158855599-158855621 AAGAAGTCAACAGGAGGGCCGGG - Intergenic
1018791472 6:167151552-167151574 AAGAAGAAAACAAGAGGGCTGGG + Intronic
1019495864 7:1340381-1340403 AAGAAGAAGAAAGGAGGGCTGGG + Intergenic
1019921306 7:4164854-4164876 AAGAAGACCAGAGCAGGAGGTGG + Intronic
1023958459 7:44906861-44906883 ATGAAGACAACAGGTGCACTAGG - Intergenic
1023992761 7:45139238-45139260 AGGAAGACCAGAGGAGGAGCAGG - Intergenic
1027053268 7:75032774-75032796 GATAATACCACAGGAGGGCTGGG + Intronic
1028677666 7:93485631-93485653 TAGAAGACCACATAAGGCCTGGG + Intronic
1029064877 7:97839346-97839368 AAGAAGACCAGAATAGGAGTAGG - Intergenic
1029159420 7:98541105-98541127 AGCAAGACCCCAGGAGGACAGGG - Intergenic
1029349934 7:100005965-100005987 AAGAAAAGCCCAGGAGGACCTGG - Intergenic
1029486762 7:100847702-100847724 GAGAGGACCACAGGAGGAGCAGG + Intronic
1031624453 7:123976040-123976062 GAGATGAGCACAGGGGGACTTGG + Intergenic
1032083464 7:128871269-128871291 AAGACCACCACAGGAGGCCTGGG + Intronic
1032407066 7:131664189-131664211 AAGACTACCAAATGAGGACTGGG + Intergenic
1032437348 7:131910947-131910969 AGGAAGACAACAGGATAACTGGG - Intergenic
1034511955 7:151542893-151542915 AAGAGGAACACAGGTGGCCTGGG + Intergenic
1034761788 7:153679398-153679420 AAGGATGCCACAGGAGGGCTTGG + Intergenic
1037085577 8:14845100-14845122 AAGAAAACCACTGAAGGACAGGG + Intronic
1040111219 8:43567952-43567974 AAGAAGACCCCAGGGGGAGGGGG - Intergenic
1045256949 8:100533877-100533899 AAGAAGACTACAGATAGACTTGG - Intronic
1046990645 8:120449106-120449128 TAGAAGACCAAATGAGGAATGGG + Intronic
1048091506 8:131245863-131245885 AAGAAAACCACAGGAGATATGGG - Intergenic
1048975547 8:139671028-139671050 AGGAAGCCCATAGGAGGAGTAGG - Intronic
1051337985 9:16084409-16084431 AAGAGGACAACAGGAATACTGGG - Intergenic
1051599694 9:18860526-18860548 AAGAAGGCCAGAGCAGGAGTTGG - Intronic
1051909776 9:22139882-22139904 AAGAATACGACAAGAGGAATGGG - Intergenic
1054904161 9:70400233-70400255 GAGAAATCCACAGGAGGACTGGG + Intronic
1058775667 9:108280906-108280928 GACAAGACCACAGGAGGAATGGG + Intergenic
1059154451 9:111977410-111977432 AAAAAGATCACCTGAGGACTGGG + Intergenic
1059393639 9:114017069-114017091 AAGAGGGCCACAGCAGGACTTGG - Intronic
1059699516 9:116761469-116761491 AAGAAGACTCCTGGAGGAGTTGG + Intronic
1061059014 9:128241193-128241215 GAGAAGACCCAAGGAGGCCTGGG - Intronic
1061157953 9:128876392-128876414 AAAAAGAACAAAGGATGACTGGG - Intronic
1061171268 9:128956998-128957020 AAGAGGACTACAGGGGTACTCGG + Exonic
1062342240 9:136098913-136098935 GAGAAGACCCCAGGAGGACCTGG + Intergenic
1185815376 X:3150276-3150298 AAGAAGAGGAGAGGAGGACTGGG - Intergenic
1189393467 X:40598399-40598421 AGGAAAACCACTGGAGAACTTGG + Intronic
1189748560 X:44195212-44195234 AAGAAGACCTCTTGAGGCCTAGG - Intronic
1189922481 X:45915968-45915990 AAGAAGAACAGAGGATGATTAGG - Intergenic
1190959038 X:55227354-55227376 CAGAAGAAGACAGGAGGACAAGG + Intronic
1191104384 X:56763592-56763614 TGGGACACCACAGGAGGACTAGG - Intergenic
1191106026 X:56772855-56772877 TGGGAAACCACAGGAGGACTGGG - Intergenic
1191107019 X:56778257-56778279 TGGGAAACCACAGGAGGACTGGG - Intergenic
1191108570 X:56787996-56788018 TGGGAAACCACAGGAGGACTGGG - Intergenic
1191109395 X:56793259-56793281 TGGGAAACCACAGGAGGACTGGG - Intergenic
1191250998 X:58260163-58260185 AAGAAGACCCCTGGAGGAAGGGG + Intergenic
1191640750 X:63428208-63428230 AATAAGACCACATAGGGACTGGG + Intergenic
1192236838 X:69301530-69301552 CAGAGGACCACAGGTGGGCTTGG - Intergenic
1194663582 X:96653286-96653308 AAGAAGATAAAAGGATGACTAGG - Intergenic
1196626753 X:117885679-117885701 AAATAGACCTCAGGAGGACCAGG - Intergenic
1199421483 X:147649606-147649628 CAGAAGACAACAGGAAGATTAGG + Intergenic
1201265922 Y:12206455-12206477 AAGAAGAGGAGAGGAGGACTGGG + Intergenic