ID: 1170446595

View in Genome Browser
Species Human (GRCh38)
Location 20:16434314-16434336
Sequence CATTGAGCCGAGTCCTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170446595_1170446602 23 Left 1170446595 20:16434314-16434336 CCACAGGAGGACTCGGCTCAATG 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1170446602 20:16434360-16434382 AATGGTTTATGAGAGTAAGCAGG 0: 1
1: 0
2: 2
3: 12
4: 124
1170446595_1170446597 5 Left 1170446595 20:16434314-16434336 CCACAGGAGGACTCGGCTCAATG 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1170446597 20:16434342-16434364 GGCCCGTGTAACCACCGTAATGG 0: 1
1: 0
2: 0
3: 2
4: 14
1170446595_1170446603 24 Left 1170446595 20:16434314-16434336 CCACAGGAGGACTCGGCTCAATG 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1170446603 20:16434361-16434383 ATGGTTTATGAGAGTAAGCAGGG 0: 1
1: 0
2: 1
3: 17
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170446595 Original CRISPR CATTGAGCCGAGTCCTCCTG TGG (reversed) Intronic
900951010 1:5858344-5858366 CATGGAGCCCAGTCCTCGTGGGG - Intergenic
901068701 1:6506731-6506753 CACTGAGCCGAGGCCCCCAGAGG + Intronic
902707139 1:18213378-18213400 TATGGAGCCAAGTCCTCCTATGG - Intronic
906528264 1:46508929-46508951 CCCTGAGCTGAGTCATCCTGGGG - Intronic
909609448 1:77537197-77537219 GACTCAGCCGAGTCCTCCTCAGG - Intronic
916952473 1:169794904-169794926 CAGTGAGTCGAGTCCTCCAGGGG + Exonic
917329990 1:173870777-173870799 CAGAGAGCTAAGTCCTCCTGAGG + Exonic
920279135 1:204829727-204829749 GACTGAGCAGACTCCTCCTGGGG + Intronic
923109025 1:230876371-230876393 CATTGAGCCCACTGCTCCTGTGG + Intergenic
923358070 1:233180763-233180785 CAGGGAGCTGAGTCTTCCTGAGG + Intronic
924510652 1:244726888-244726910 GTTGGAGCTGAGTCCTCCTGTGG - Intergenic
1065377290 10:25056302-25056324 CATTGAGCTGAGAACTTCTGGGG - Intronic
1067715008 10:48684387-48684409 CAATGAGGGGAGTCCTCCTGCGG - Intergenic
1078028904 11:7728416-7728438 CAGTGAGCCTATTCCTTCTGTGG + Intergenic
1078526218 11:12103573-12103595 CCTGGAGCCCAGTCCTGCTGGGG + Intronic
1089582739 11:119491651-119491673 CCCTGTGCCGAGTCCTCCTTCGG - Intergenic
1096494634 12:52032977-52032999 CATTGAGCCGAAGCTTCCTTCGG - Intronic
1097961968 12:65541094-65541116 CATTGAACAGAGTGCTCTTGGGG + Intergenic
1106780602 13:33055711-33055733 CATTAGGCAGAGTCCTCCAGAGG + Intronic
1111981592 13:95021858-95021880 CATTCAGCCCAGCCCTGCTGAGG - Intronic
1113488008 13:110669312-110669334 AATGGAGCAGAGTCCTCGTGTGG + Intronic
1120415653 14:84215466-84215488 CACTGAGGCGAGTTCTGCTGGGG - Intergenic
1122239456 14:100352605-100352627 CAATGAACCCACTCCTCCTGGGG + Intronic
1127417568 15:58771878-58771900 CAGCGACCCGAGCCCTCCTGGGG + Exonic
1128690989 15:69724850-69724872 CAAGGAACAGAGTCCTCCTGGGG + Intergenic
1132995057 16:2818421-2818443 CATTGAGCCAAGGCCTCCAGGGG - Intronic
1139494400 16:67305859-67305881 CATTGAGACTAGTCCTCTGGTGG + Intronic
1142150751 16:88511568-88511590 CCTTGAGCCAAGTCCTCAGGAGG + Intronic
1142506960 17:370601-370623 AAGTCAGCCAAGTCCTCCTGCGG + Intronic
1142892960 17:2957164-2957186 CATTGAACCGAGGCCTCCAGGGG - Intronic
1151887146 17:76929800-76929822 CATTAAGCCAAGAGCTCCTGGGG - Intronic
1152757427 17:82092812-82092834 CACTGAGCCGAGCCCTCCGCAGG - Exonic
1160299649 18:77668420-77668442 CATGGAGCTGATTCCACCTGAGG + Intergenic
1160844543 19:1160585-1160607 CAGTGAGCCGAGACCCCCAGTGG - Intronic
1161978331 19:7618191-7618213 CTTTGAGTCCAGTCCTGCTGTGG + Exonic
927250810 2:20993484-20993506 CCCTGAGCCAAGTCCTACTGAGG - Intergenic
930162400 2:48171554-48171576 CATGGAGCCTTGTCATCCTGGGG + Intergenic
930682446 2:54271490-54271512 CAGTGTGCTGAGTCCTCCTTTGG - Intronic
932047335 2:68363017-68363039 CATTGAGCATGGTCCTGCTGGGG + Intergenic
932788623 2:74632390-74632412 CCTTGGGCCAAGTCCTCCTCAGG + Intronic
936941545 2:117889420-117889442 TATTGAGCAGGGTCCACCTGTGG - Intergenic
941604224 2:167576985-167577007 CATTAAGCCTAGCACTCCTGGGG - Intergenic
943761547 2:191614924-191614946 CATTGAGCCAAGCCCTGATGAGG - Intergenic
946951404 2:224879257-224879279 CATCTACCCCAGTCCTCCTGGGG - Intronic
947637996 2:231689805-231689827 CTTTGAGCCAAGTTCTGCTGTGG - Intergenic
948528279 2:238586970-238586992 CAGTGAGCAGAGTCCTGGTGTGG + Intergenic
1169343420 20:4812812-4812834 CATGCAGCCCAGTGCTCCTGTGG + Intronic
1169376310 20:5069230-5069252 CCTTGAGCTGAGTCCTCCTTCGG + Intronic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1172313696 20:33937221-33937243 CAGTGAGCCGAGTTCTACAGCGG - Intergenic
1173228230 20:41174470-41174492 CATTGACCCGAGTCCTTCTTGGG - Exonic
1176198758 20:63850205-63850227 GTTTGAGGCGAGTCTTCCTGCGG + Intergenic
1178438476 21:32579932-32579954 CAAAGCGCCGAGTCCTTCTGCGG - Intronic
1181973449 22:26711259-26711281 CAATGAGCTCAGTCCTGCTGGGG + Intergenic
1183164026 22:36133925-36133947 GATGGAGCAGAGTCCTCCAGCGG - Intergenic
1184892825 22:47390012-47390034 CGTGGAGCTGGGTCCTCCTGGGG - Intergenic
951934653 3:28008539-28008561 CATTTTGCTGAGTCCTCATGTGG - Intergenic
952156642 3:30650533-30650555 CATAGAGCACATTCCTCCTGTGG + Intronic
964123210 3:153207784-153207806 CTTTGAGCCTATTCATCCTGAGG + Intergenic
968748705 4:2374954-2374976 GACAGAGCCCAGTCCTCCTGTGG + Intronic
969102945 4:4783939-4783961 CATTAAACCGAGCCCTGCTGTGG + Intergenic
969559899 4:7940034-7940056 CTTTGAGGCGGGTCCTCCCGCGG - Exonic
969584143 4:8082286-8082308 CACTGAGCGTATTCCTCCTGCGG + Intronic
971394720 4:26217352-26217374 CATTCAGCTGTGTGCTCCTGTGG + Intronic
973253548 4:48085723-48085745 CATTGAGAGGAGTTCTGCTGGGG + Intronic
981642159 4:146957204-146957226 GGTAGAGCCTAGTCCTCCTGGGG + Intergenic
1002085446 5:176772226-176772248 CATTGATCAGAGTTCTCCAGAGG + Intergenic
1003017048 6:2476498-2476520 CATTGAGCTGTTTGCTCCTGTGG - Intergenic
1007109361 6:39304144-39304166 CATTGTCCCCAGGCCTCCTGAGG + Intronic
1012475410 6:99611290-99611312 CATTGAGCTGAGTCATTCTGCGG + Intronic
1013777309 6:113692658-113692680 CATTGACCTGTGTCCTTCTGAGG - Intergenic
1017681478 6:156868558-156868580 CATTGGGCTGTGTCCTCCTATGG + Intronic
1020068150 7:5205558-5205580 CAGTGAGCCACCTCCTCCTGTGG - Intronic
1032083281 7:128870462-128870484 AAGAGAGCCGAGGCCTCCTGGGG - Intronic
1035427466 7:158790020-158790042 CAGTGGGGAGAGTCCTCCTGGGG + Intronic
1049213401 8:141396941-141396963 CCTTGAGCCAGGTACTCCTGTGG + Intronic
1053123558 9:35562588-35562610 CACTGAGCCAAGGCATCCTGGGG + Intronic
1060903019 9:127277959-127277981 CACTGAGCCAAGTACTGCTGGGG - Intronic
1191104383 X:56763585-56763607 CTATGATCCTAGTCCTCCTGTGG + Intergenic
1191106025 X:56772848-56772870 CTATGATCCCAGTCCTCCTGTGG + Intergenic
1191107018 X:56778250-56778272 CTATGATCCCAGTCCTCCTGTGG + Intergenic
1191108569 X:56787989-56788011 CTATGATCCCAGTCCTCCTGTGG + Intergenic
1191109394 X:56793252-56793274 CTGTGATCCCAGTCCTCCTGTGG + Intergenic
1195395875 X:104409849-104409871 CTTTGAGCTGAGTCCTCTTTGGG - Intergenic