ID: 1170446596

View in Genome Browser
Species Human (GRCh38)
Location 20:16434321-16434343
Sequence AGGACTCGGCTCAATGCGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 41}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170446590_1170446596 6 Left 1170446590 20:16434292-16434314 CCCAGATCTCGTGGGAAGAAGAC 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1170446596 20:16434321-16434343 AGGACTCGGCTCAATGCGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 41
1170446591_1170446596 5 Left 1170446591 20:16434293-16434315 CCAGATCTCGTGGGAAGAAGACC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1170446596 20:16434321-16434343 AGGACTCGGCTCAATGCGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170446596 Original CRISPR AGGACTCGGCTCAATGCGCA AGG Intronic
900368779 1:2322368-2322390 AGGAGTCGGCTCACACCGCAAGG + Intronic
900951013 1:5858351-5858373 AGGACTGGGCTCCATGCTGACGG + Intergenic
912562666 1:110561704-110561726 AGAACTCTGCTTAATGCCCATGG + Intergenic
913567578 1:120088193-120088215 TGGACTCGTGTCAATGAGCAGGG - Intergenic
914479841 1:148055762-148055784 AGGACACTGCTGAATGCCCAAGG - Intergenic
914604659 1:149240688-149240710 AGGACTGGGCTCACTGCTCTGGG + Intergenic
915540598 1:156563506-156563528 AGGAGTAGGCTCAATGCGTATGG - Intronic
1075663968 10:124217781-124217803 AGGACTCAGCCCAAAGCTCAAGG + Intergenic
1076049385 10:127320562-127320584 AGGAATGGGCTCAAGGCGGATGG + Intronic
1076652516 10:131999567-131999589 AGGGCTCGGCTAGAAGCGCAGGG - Intergenic
1077000470 11:319742-319764 AGGACTCGGCTCCGGGGGCAGGG + Exonic
1077509558 11:2949913-2949935 AGGACTGGGGTCAATTGGCAGGG - Intronic
1078944823 11:16052986-16053008 AGTACTCAGCTAAATGCTCAGGG + Intronic
1081851464 11:46277856-46277878 TGGAGTCGGCTGAATGCCCACGG + Exonic
1083156845 11:60828611-60828633 AGGACTCAGCCCAAAGCACAAGG + Intergenic
1096782657 12:54000010-54000032 ACGGCGCGGATCAATGCGCAGGG - Intronic
1111219599 13:85187092-85187114 AGTTCTAGGCTCAATGCGAATGG - Intergenic
1130880794 15:88054073-88054095 TGAACTGGGCTCAATGCTCATGG - Intronic
1142069586 16:88083819-88083841 AGGATTCGGCCCAATGGGAAGGG - Intronic
1158281347 18:55831777-55831799 AGGGCTCTGCTCAATGCATAGGG - Intergenic
1161301877 19:3546688-3546710 CGGACTCGGCTCAGTCCCCACGG + Intronic
934880514 2:97972801-97972823 AGGACTCGGCCCAATGCTGCTGG + Intronic
937153818 2:119703987-119704009 AGGACTCTGACCAATGCACATGG + Intergenic
943189147 2:184653815-184653837 AGGACTGGGGCCAATGGGCATGG - Intronic
1170446596 20:16434321-16434343 AGGACTCGGCTCAATGCGCAAGG + Intronic
1179799251 21:43803229-43803251 AGGACTGGGCTCAAGGCAGAAGG - Intronic
949976839 3:9468542-9468564 GGGACTCGGGCCTATGCGCAGGG - Intronic
962853204 3:139323280-139323302 AGGACTCACCTCACTGGGCAGGG + Intronic
974747536 4:66094598-66094620 AGGACTCGGCTCCGGGGGCAGGG - Intergenic
978416169 4:108478498-108478520 AGAACTGGGCTCAATGAGGATGG + Intergenic
985763657 5:1765078-1765100 AGGCAGGGGCTCAATGCGCATGG + Intergenic
1001518009 5:172370345-172370367 AGGACTCTGATGAATGCGCTGGG + Intronic
1011635541 6:89369397-89369419 AGAACTTGGCTCAATGAGAAGGG + Intronic
1023247972 7:38226883-38226905 AGTACCCAGCTCAATGGGCATGG - Intronic
1024601604 7:50986485-50986507 AGGATTCAGCTGAATGCTCAAGG - Intergenic
1029553624 7:101252384-101252406 AGGACTCGGAGCAACGCTCAAGG + Intergenic
1037525760 8:19722658-19722680 ATGACTCTGGTCAATGCGCCAGG - Intronic
1038414603 8:27385169-27385191 TGGACTGGGCTCATTGTGCATGG + Intronic
1038710047 8:29934965-29934987 AGTACTCGGCTAAATGCTCAAGG - Intergenic
1041917285 8:63150215-63150237 AGGACTAGGCTCAAAGAGTAAGG + Intergenic
1045388540 8:101692995-101693017 AGGACTAGGTCCAATGCGGATGG - Intronic
1048080282 8:131119325-131119347 AGAACTCTGCTCAAAGCCCAAGG - Intergenic
1186389968 X:9149067-9149089 AGGACTCAGCTCCTTGGGCAGGG - Intronic
1188130862 X:26430940-26430962 AGGACTCGACTCAATTCATAAGG + Intergenic