ID: 1170446597

View in Genome Browser
Species Human (GRCh38)
Location 20:16434342-16434364
Sequence GGCCCGTGTAACCACCGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170446591_1170446597 26 Left 1170446591 20:16434293-16434315 CCAGATCTCGTGGGAAGAAGACC No data
Right 1170446597 20:16434342-16434364 GGCCCGTGTAACCACCGTAATGG No data
1170446590_1170446597 27 Left 1170446590 20:16434292-16434314 CCCAGATCTCGTGGGAAGAAGAC No data
Right 1170446597 20:16434342-16434364 GGCCCGTGTAACCACCGTAATGG No data
1170446595_1170446597 5 Left 1170446595 20:16434314-16434336 CCACAGGAGGACTCGGCTCAATG No data
Right 1170446597 20:16434342-16434364 GGCCCGTGTAACCACCGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170446597 Original CRISPR GGCCCGTGTAACCACCGTAA TGG Intronic