ID: 1170446597

View in Genome Browser
Species Human (GRCh38)
Location 20:16434342-16434364
Sequence GGCCCGTGTAACCACCGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 14}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170446591_1170446597 26 Left 1170446591 20:16434293-16434315 CCAGATCTCGTGGGAAGAAGACC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1170446597 20:16434342-16434364 GGCCCGTGTAACCACCGTAATGG 0: 1
1: 0
2: 0
3: 2
4: 14
1170446595_1170446597 5 Left 1170446595 20:16434314-16434336 CCACAGGAGGACTCGGCTCAATG 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1170446597 20:16434342-16434364 GGCCCGTGTAACCACCGTAATGG 0: 1
1: 0
2: 0
3: 2
4: 14
1170446590_1170446597 27 Left 1170446590 20:16434292-16434314 CCCAGATCTCGTGGGAAGAAGAC 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1170446597 20:16434342-16434364 GGCCCGTGTAACCACCGTAATGG 0: 1
1: 0
2: 0
3: 2
4: 14

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170446597 Original CRISPR GGCCCGTGTAACCACCGTAA TGG Intronic
1074264116 10:111883854-111883876 GGCCAGTGTAAGCACGGTCAAGG + Intergenic
1096811265 12:54171854-54171876 GGCCCGAGTGACCACAGCAATGG - Intronic
1103451560 12:121032843-121032865 GGCCTGGGTAACCACAGAAAGGG - Intronic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1122057851 14:99117052-99117074 GGCCCGTGTTTCCACCTTAAAGG + Intergenic
1148351345 17:46944011-46944033 GGCCAGTGGAACCACACTAATGG - Intronic
1158305572 18:56101602-56101624 GGCCTGTGTAACCACTTTACAGG + Intergenic
1170446597 20:16434342-16434364 GGCCCGTGTAACCACCGTAATGG + Intronic
961703613 3:128766374-128766396 GTCCTGGGTAACCACCGTCATGG + Intronic
966044548 3:175532677-175532699 GGTGGGTGTAGCCACCGTAATGG - Intronic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
969527928 4:7713476-7713498 GGTCCCTGTACCCACCGTGATGG - Intronic
971854594 4:32026932-32026954 GGCCATTTTAACCACCATAATGG + Intergenic
1003758381 6:9148319-9148341 GGTGGGTGTAACTACCGTAATGG + Intergenic
1005276396 6:24223786-24223808 GGCCAGTGTAACCACCAAAATGG + Intronic
1040423082 8:47259238-47259260 GGCACGTTTGACCACCGAAAGGG + Intergenic
1193245228 X:79220636-79220658 GGGCAGTGTAACAACAGTAAGGG + Intergenic