ID: 1170448624

View in Genome Browser
Species Human (GRCh38)
Location 20:16457737-16457759
Sequence AGTAAGGCCTGCCCTAGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170448621_1170448624 26 Left 1170448621 20:16457688-16457710 CCTCATGGAATCTTACAGTTTCC 0: 1
1: 0
2: 1
3: 10
4: 186
Right 1170448624 20:16457737-16457759 AGTAAGGCCTGCCCTAGATAAGG 0: 1
1: 0
2: 0
3: 3
4: 82
1170448622_1170448624 5 Left 1170448622 20:16457709-16457731 CCAGCTCAGTGTGTTTATAAAAA 0: 1
1: 0
2: 2
3: 24
4: 258
Right 1170448624 20:16457737-16457759 AGTAAGGCCTGCCCTAGATAAGG 0: 1
1: 0
2: 0
3: 3
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170448624 Original CRISPR AGTAAGGCCTGCCCTAGATA AGG Intronic
903409936 1:23134006-23134028 AGAAAGGACTGCTCTAGATCAGG + Intronic
903884897 1:26535429-26535451 AGGAAGGCCTGCTCTAGAACAGG - Intronic
907321051 1:53602563-53602585 AGGAAGGCAGGCCCTAGAAAGGG + Intronic
907600788 1:55767339-55767361 AGAATGGCATGTCCTAGATAGGG + Intergenic
916162457 1:161931847-161931869 AATAAGGCTTGCTCAAGATAAGG - Intronic
918578477 1:186095344-186095366 AGTATGGCCTGGCTTAGAGATGG + Exonic
1073371892 10:102997082-102997104 AGTAAGGACTGTCCTAAAGAAGG + Intronic
1073820058 10:107251644-107251666 ATTAAGGCCTCCCCCAGAGATGG + Intergenic
1078828079 11:14950907-14950929 AGTGAGGACTGGCCTAGCTAAGG + Intronic
1080084437 11:28260990-28261012 AGGAAGACCTGCTGTAGATATGG + Intronic
1080784498 11:35462581-35462603 AGTAAGGGATTCCCTGGATAAGG - Intronic
1081858814 11:46320452-46320474 AGTGAGGCCTGGCCTAAAGACGG + Exonic
1088579242 11:111299697-111299719 AGAAACGCCTGCCCCAGAAAGGG + Exonic
1092099976 12:5875025-5875047 AGTAAAGCCTGTCCTAGAGCAGG - Intronic
1095943618 12:47741258-47741280 AGGAGGACCTGCCCTAGTTAGGG - Intronic
1096851731 12:54443386-54443408 AGTAAAGCAAGCCCTAGAAATGG + Intergenic
1098886544 12:75966500-75966522 AGTAATGCCTTCCCTATATTGGG + Intergenic
1106610646 13:31276239-31276261 AGTAAGGCCAGGCCCAGAAAAGG + Intronic
1111265680 13:85809150-85809172 ATCTAGGCCTACCCTAGATAAGG - Intergenic
1112142817 13:96664735-96664757 AGTAAGAACTGCCCAAGAAAAGG - Intronic
1112974050 13:105294955-105294977 AGTGAGGCCTGCCATAAAGACGG + Intergenic
1118700401 14:68427197-68427219 AGTAAGCATTGCCCTAGATGGGG - Intronic
1119186275 14:72644912-72644934 AGTAATGTCTGCCCTGGGTATGG - Intronic
1128735493 15:70051519-70051541 AGCAAGACCTGCCCTAGACATGG + Intronic
1129743689 15:78003157-78003179 AGCACGGCCTGCACTAGATCTGG - Intronic
1134341395 16:13350077-13350099 AGGAAGCCCTGCCCTTGACATGG + Intergenic
1136223326 16:28842921-28842943 TTTAAGGCCTGCCCTAGCCAGGG - Exonic
1143447366 17:7017381-7017403 AGCAAGGCCTGCACGAGAGAGGG + Exonic
1143869574 17:9948711-9948733 TGTAAGGCTGGCCCTAGCTAAGG + Intronic
1158873742 18:61713129-61713151 AGAAAGGCCTTCCATAGAAAAGG - Intergenic
1158885018 18:61818872-61818894 AGAAAGTCCTGGCCTAGAGATGG + Intronic
1161210012 19:3061506-3061528 TTTAAGGCCCGCCCTAGATGGGG + Intronic
1163677310 19:18661588-18661610 AGTGAGGGCTGCCCTATAGATGG - Intronic
1164028148 19:21372371-21372393 AGTGAGGCCAGACCTAAATAAGG - Intronic
1166562313 19:43741226-43741248 AGAAAGGGCTGCCCTGGAGAGGG + Intronic
927975291 2:27333973-27333995 AGTGAAGCCTGCCATATATAAGG - Exonic
928081754 2:28318238-28318260 AGGAAGGGCTGGACTAGATAAGG + Intronic
933480849 2:82855204-82855226 AGTAATGCCTGCTCCTGATAAGG + Intergenic
934619677 2:95796588-95796610 AGTAAGGCCCGCCCTCCATTGGG + Intergenic
934641211 2:96027969-96027991 AGTAAGGCCCGCCCTCCATTGGG - Exonic
938996385 2:136683263-136683285 AGCAAGCCCTGCCCAAGAAAAGG + Intergenic
941752158 2:169144677-169144699 AGGAAGCCATGCCCTAGAAAAGG + Intronic
942434214 2:175953664-175953686 ATAAAGGCCTGTACTAGATAAGG - Intronic
946202383 2:218078059-218078081 AGCCAGGCCTGTCCTAGGTATGG + Intronic
948688766 2:239688935-239688957 AGTAAGGGCTGCATTAGACAAGG - Intergenic
1168818056 20:754422-754444 AGTCAGCCCTGCCCTAGATTTGG - Intergenic
1170448624 20:16457737-16457759 AGTAAGGCCTGCCCTAGATAAGG + Intronic
1172108700 20:32532525-32532547 AGGCAGGCCTTCCCTAGCTAAGG + Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
950239025 3:11351315-11351337 AGGTAGGCCTGACCTAGATGAGG + Intronic
951481666 3:23168180-23168202 AGAAAGGCTTGCTCCAGATATGG + Intergenic
955337943 3:58102505-58102527 AGTAATGTCTGCCCTGGATGCGG + Intronic
958626207 3:96627306-96627328 ACTGAGGCCTGTCCTAGATTAGG + Intergenic
959125906 3:102290372-102290394 AGCAAGCCCTGCCCAAGCTAAGG - Intronic
961984125 3:131114509-131114531 AGTAAAGCCTGTCCTGGATAGGG - Intronic
962907048 3:139813470-139813492 ATTAATGCCTCCCCTATATAGGG + Intergenic
962927658 3:140010418-140010440 AGGCAGGCCAGCCCTAGAAATGG - Intronic
966745289 3:183269052-183269074 ATTAAGGCTTGCCCCAGACAAGG - Intronic
967146163 3:186608104-186608126 AGTAAGGCCTGGACTAGAGTAGG - Intergenic
969074544 4:4567619-4567641 AGTGCTGCCTGCCCTAGAGAGGG + Intergenic
969868002 4:10087685-10087707 GGTAAGGCCTGCCCTGGGGAAGG - Exonic
973301137 4:48586022-48586044 AGTTAGGGATTCCCTAGATAAGG - Intronic
973581314 4:52347104-52347126 AGTAAGGCCTGTTCTGCATAGGG - Intergenic
981259067 4:142697823-142697845 AGTAAGTCATGGCCTAGAAAGGG - Intronic
982633181 4:157858428-157858450 AGTTAGGCCTGCCTTTAATATGG + Intergenic
984727135 4:183032204-183032226 AGTATGGCCTGACCGAGAGAAGG - Intergenic
994469878 5:100189776-100189798 AGTTAGGCATGACCTAGACAAGG - Intergenic
996595110 5:125191769-125191791 GGTAGGGCCAGCTCTAGATATGG + Intergenic
997537844 5:134636370-134636392 AGTAAGGCCTGACATCTATATGG - Intronic
999577067 5:152990594-152990616 ATAAAGGCCTGCCCTTGAGAAGG - Intergenic
1001951967 5:175822652-175822674 AGGAAGGCCTGCCCAACATGGGG - Intronic
1007997050 6:46318862-46318884 AGTTAGACCTTCCCTAGAAAAGG - Intronic
1013459799 6:110364163-110364185 ATTAAGGCCTGCCCCATACAAGG - Intergenic
1013764788 6:113562312-113562334 AATAAGGATTGCCCTAGATTGGG + Intergenic
1013833051 6:114297576-114297598 AGAAAGGCCTTCATTAGATATGG - Intronic
1018182085 6:161232810-161232832 AGTCAAGCCTGCCCTGGACAAGG + Intronic
1018907662 6:168084857-168084879 AGCAAGGCCTGCCCCAAATGAGG + Intergenic
1019091160 6:169535587-169535609 AGTAAGCCCTTCCCAGGATAAGG - Intronic
1022102239 7:27175422-27175444 AGCAAGGACTGCCCTAGCTGAGG - Intronic
1027691684 7:81354561-81354583 AGCAAGCCCTGCCCAAGAAAAGG - Intergenic
1030184286 7:106745608-106745630 AGAATGGCCTGGCCTAGAAAGGG + Intergenic
1032079339 7:128850893-128850915 AGAAAGGCCTGCACCAGATGGGG + Exonic
1040784977 8:51154981-51155003 AGTAAGGTCTGCCCTTCAAAAGG + Intergenic
1057612788 9:96561409-96561431 GGTAAGGCATGCCAGAGATAAGG + Intronic
1195680890 X:107545683-107545705 GGTTAGGCTTTCCCTAGATATGG + Intronic
1197778939 X:130140449-130140471 AGTAATGCCTTCCATAGAGAAGG + Intronic