ID: 1170458348

View in Genome Browser
Species Human (GRCh38)
Location 20:16554093-16554115
Sequence CTGGGTAGAAAGAAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 491}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170458339_1170458348 8 Left 1170458339 20:16554062-16554084 CCATGAACAGCAGCAGGAGACAG 0: 2
1: 21
2: 64
3: 163
4: 486
Right 1170458348 20:16554093-16554115 CTGGGTAGAAAGAAGGAGGTGGG 0: 1
1: 0
2: 1
3: 43
4: 491
1170458337_1170458348 16 Left 1170458337 20:16554054-16554076 CCTGGGCACCATGAACAGCAGCA 0: 14
1: 26
2: 56
3: 102
4: 365
Right 1170458348 20:16554093-16554115 CTGGGTAGAAAGAAGGAGGTGGG 0: 1
1: 0
2: 1
3: 43
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170458348 Original CRISPR CTGGGTAGAAAGAAGGAGGT GGG Intronic
901059422 1:6465294-6465316 CTGGAGAGAAAGAGGGAGGGAGG - Intronic
901317568 1:8318977-8318999 ATGGGTAGAAAGAAGCATGAGGG + Intronic
901666313 1:10828208-10828230 CTGGGATGAAAGACGGCGGTGGG - Intergenic
902659245 1:17889980-17890002 CTGGGCAGAAAGAAGTGGGCTGG + Intergenic
902706516 1:18209023-18209045 CTGGGGAGGAAGGAGAAGGTGGG + Intronic
903172020 1:21560289-21560311 CTGGGTAGAAGGAATGAGCATGG + Intronic
903284057 1:22266300-22266322 CTGGATAGTAAGTGGGAGGTGGG + Intergenic
903896227 1:26607054-26607076 CTGTGTAGAAAATAGAAGGTAGG + Intergenic
904254183 1:29244092-29244114 CTGGGGAGAAAGATTGAGATGGG + Intronic
904490289 1:30854484-30854506 GGAGGTAGAAAGAGGGAGGTGGG - Intergenic
905819009 1:40975238-40975260 CTAGGAAGAAAGCCGGAGGTAGG + Intergenic
905885485 1:41489599-41489621 ATGGATAGAAAGAAGGTGGTTGG - Intergenic
905885505 1:41489686-41489708 ATGGATAGAAAGAAGGTGGATGG - Intergenic
905885551 1:41489884-41489906 ATGGATAGAAAGAAGGTGGATGG - Intergenic
906277103 1:44524446-44524468 TTGGGTGGAAGGAGGGAGGTGGG - Intronic
906588360 1:47000824-47000846 GTGGATAGAAAGAAGGATATAGG + Intergenic
906615062 1:47228368-47228390 TTGGGGAGAATGAAGGAGGAGGG + Intronic
906711546 1:47934022-47934044 GAGGGTAGAAAGAAGGGGTTGGG + Intronic
907663352 1:56413755-56413777 CTGGGTTGAAGGAAGGCTGTGGG - Intergenic
907814340 1:57903503-57903525 TTGGGGAGAAAGAAGGTGGAAGG - Intronic
908306149 1:62819281-62819303 CTGGGAAAAAAGCAGGAGATTGG + Exonic
908316886 1:62941498-62941520 ATGGGGAGAAAGAAGCAGGCAGG - Intergenic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
909419232 1:75444937-75444959 TTGAGGAGAAAGAAGAAGGTGGG + Intronic
910698155 1:90043834-90043856 ATGGGAAGAAAGAAAGGGGTTGG + Intergenic
911002372 1:93180013-93180035 CTGGGTTAAAGGAAGGAGGCTGG + Intronic
912154251 1:106897767-106897789 CTGAGTAGAAAGAGAGTGGTAGG + Intergenic
912469222 1:109895192-109895214 CTGGGGAGTGAGTAGGAGGTAGG - Intergenic
912494038 1:110079863-110079885 CTGGGAAGCAAGCAGGATGTTGG + Intergenic
915734689 1:158077400-158077422 CTGGGAAGCAAGAAGCGGGTGGG + Intronic
915976668 1:160395496-160395518 CCAGGCAGAAAGAAGGAGGAAGG + Intergenic
916046185 1:161001354-161001376 CTAAGGAGAAAGAAAGAGGTGGG + Intronic
916086591 1:161274807-161274829 CTGGCTAGAAAGAGGGAAGAGGG + Intronic
916172879 1:162014383-162014405 TTGGGTATATAGGAGGAGGTAGG - Intronic
916355659 1:163904044-163904066 CTGAGCAGAAAGAACGAAGTTGG - Intergenic
917013992 1:170508753-170508775 GTGGGAAGATAGAAAGAGGTTGG - Intergenic
917148560 1:171919866-171919888 CTGGGTAGACACCAGGAGTTCGG - Intronic
917249221 1:173038978-173039000 CAGGGTGGAGAAAAGGAGGTAGG + Intergenic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917639389 1:176968475-176968497 CTGGGTGGGAAGTGGGAGGTGGG - Intronic
917982578 1:180280393-180280415 TTAGGTACAAAGCAGGAGGTTGG + Intronic
918095044 1:181327534-181327556 CTGGGGGGAAAGATGGGGGTTGG - Intergenic
919677718 1:200401967-200401989 CTAGGTAAAAAGATGTAGGTTGG + Intergenic
919861265 1:201740567-201740589 CTGGGGTGAAAGGAGGTGGTGGG + Intronic
920100767 1:203515720-203515742 CAGGGGAGAAAGGTGGAGGTGGG + Intergenic
920104486 1:203542026-203542048 ATGGGTAGAAAGTAGTAAGTTGG + Intergenic
920646703 1:207809065-207809087 CTGGGAAGAAGGTAGGAGGTGGG - Intergenic
920963136 1:210681588-210681610 CTGGGCAGGACTAAGGAGGTGGG + Exonic
922226503 1:223650274-223650296 CTGGGCAGAAAGAATAAGGCAGG - Intronic
922718974 1:227890705-227890727 CAGGGCAGAAAGAAGAGGGTGGG + Intergenic
923122793 1:231009112-231009134 CTGGGAAGTTAGAAGGTGGTGGG + Intergenic
923304441 1:232675203-232675225 TTGGGTACAAAGCAGGAGCTAGG + Intergenic
923925481 1:238622072-238622094 GTGGGAGGAAAGGAGGAGGTGGG + Intergenic
1062999845 10:1906133-1906155 AAAGGAAGAAAGAAGGAGGTGGG + Intergenic
1063912505 10:10846259-10846281 CTGGGAAGCAAGAAGGAGCTTGG - Intergenic
1064325802 10:14350117-14350139 CCGGGGAGAAAGACGGAGGCTGG + Intronic
1064518735 10:16178011-16178033 CAGGGGAGAAAGATCGAGGTTGG + Intergenic
1065204064 10:23341733-23341755 CTGGGTAGAAAGATGGTGCCTGG - Intronic
1067522541 10:47019223-47019245 CTGGGGAAAAAGAAGGAGATTGG + Intergenic
1067786529 10:49253500-49253522 CTGGGTGGGAGGAAGGAGGAGGG + Intergenic
1068014896 10:51503709-51503731 CTGGGTAAAAATAAAAAGGTAGG + Intronic
1069841554 10:71342661-71342683 CTGAGTAGAATGAAGGAGAGAGG - Intronic
1069903770 10:71720457-71720479 CTGGGGAGAAAGAAGGCTGGGGG - Intronic
1070408894 10:76121221-76121243 GTGAGTAGAAAGAAAGAGGAAGG + Intronic
1070598700 10:77850838-77850860 CTTGCTAGAAAGCACGAGGTTGG - Intronic
1071354532 10:84780607-84780629 CTGGGTAGAAAGATTTAGGGAGG + Intergenic
1071458579 10:85870226-85870248 CACGGGAGAAAGATGGAGGTTGG - Intronic
1071998275 10:91168291-91168313 CTGAGAAGAAAGAAGCAGGAGGG + Intronic
1072271038 10:93776856-93776878 CTGTGTGCAAAGGAGGAGGTTGG + Intronic
1073131222 10:101190296-101190318 GTGGGTAGGGAGGAGGAGGTTGG + Intergenic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1074565838 10:114576974-114576996 CTGGGGAAGAAGAAGCAGGTGGG - Intronic
1076164146 10:128268476-128268498 CAGGGAAGAAGGAAGCAGGTGGG + Intergenic
1076273167 10:129174488-129174510 CAGAGCAGAAAGAAGGAGGCAGG - Intergenic
1076980847 11:203943-203965 CTGTGTGGAAGGAAGGAGGAGGG + Exonic
1077279541 11:1736230-1736252 CTGGGCTGAAAGAAGGAAGGTGG + Intronic
1077906870 11:6541098-6541120 CTGTGTGGAGAGAGGGAGGTGGG + Intronic
1078580900 11:12539026-12539048 CTGGGTAGAAAGCTAGAGGCAGG + Intergenic
1078699825 11:13669213-13669235 CTGGGGAGGAAGAAAGTGGTGGG + Intronic
1078758969 11:14236383-14236405 ATGGGAAGAATGAAGGAGGCTGG + Intronic
1079523276 11:21354346-21354368 GAGAGTAGAAAGAAGGAGGGAGG - Intronic
1079602871 11:22331029-22331051 TTGGGTAGAGAGATGGAGGCAGG - Intergenic
1080515566 11:33016258-33016280 CTGGGTAGAAAGAAAAAAGCTGG - Intronic
1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG + Intergenic
1081884578 11:46483902-46483924 AAAGGTAAAAAGAAGGAGGTAGG + Intronic
1081905885 11:46669605-46669627 CAGGGAAGATAGAAGGTGGTAGG - Intronic
1082059851 11:47850478-47850500 CTGGAAAGAAGGAAGGAGGAAGG + Intergenic
1083042385 11:59700150-59700172 CTGTGTAGAAAGAAGTAGACAGG + Intergenic
1084955672 11:72690051-72690073 CTGGGTATGAGGAAGGATGTGGG + Intronic
1084958971 11:72706269-72706291 CTGGGTAGAAAGATGAAGGAGGG - Intronic
1085445405 11:76597823-76597845 GTGGGTACAGAGGAGGAGGTGGG - Intergenic
1088314480 11:108493904-108493926 CTATGTAGACAAAAGGAGGTTGG + Intronic
1088649147 11:111942109-111942131 CAGGATAGAAAAAAGAAGGTTGG - Intronic
1088707361 11:112475885-112475907 GAGGGTAGACAGAAGAAGGTGGG - Intergenic
1088899484 11:114104454-114104476 CTGCCATGAAAGAAGGAGGTAGG - Intronic
1089129171 11:116198948-116198970 CTGGGTAGAAAGAAGTTGGAGGG + Intergenic
1089330239 11:117684273-117684295 GTGGGGAGAAAGAAGGAGAAGGG - Intronic
1089560723 11:119341829-119341851 CTGGGTGGAGGGAAGGAGGGCGG - Intronic
1089668359 11:120034510-120034532 ATGGGGAGAGAGAAGGAGGCAGG - Intergenic
1089920677 11:122206749-122206771 CTGAGGAGGAAGAAGGAGGCCGG + Intergenic
1090355945 11:126140437-126140459 CTGGGTGGAAAGGAGGAGTAAGG + Intergenic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1090917545 11:131178917-131178939 GTGGGTGGAAAGTAGGAAGTTGG + Intergenic
1091058075 11:132437360-132437382 CTGGGAAGAAAGAAGCAGACAGG + Intronic
1091346423 11:134857212-134857234 CTGGCCAGAAAGCAGGAGGAGGG + Intergenic
1091670316 12:2447721-2447743 CTGGCTAGGCAGGAGGAGGTGGG + Intronic
1092079731 12:5705846-5705868 ATGGGTAGAAAGAAGGGAGTTGG - Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092846426 12:12589454-12589476 CTGGGTAGAAGGAAGGACAAAGG + Intergenic
1094210576 12:27885756-27885778 CTGGGAACAAAGAAGAAGGGTGG - Intergenic
1094649791 12:32364412-32364434 CTTTGTAAAATGAAGGAGGTAGG - Intronic
1095160187 12:38906056-38906078 CTGAGTTGAAAGCTGGAGGTGGG + Intronic
1095538889 12:43285318-43285340 CTGAGAAACAAGAAGGAGGTTGG - Intergenic
1095954087 12:47796718-47796740 ATGGGAAGAAAGCAGGAGGCCGG - Intronic
1098099830 12:67003188-67003210 TTGGGTAGAAAGAAGGGCGTTGG - Intergenic
1098584012 12:72134784-72134806 CTGGGTGCAGAGGAGGAGGTGGG + Intronic
1098675029 12:73279273-73279295 CTGGGAAAAAAGAAAGATGTTGG + Intergenic
1098971531 12:76862224-76862246 CTGGGTTAAAAGTAGGAGTTAGG + Intronic
1099833251 12:87873112-87873134 CTGGGTTGGAAGACGGAGGAAGG - Intergenic
1101000736 12:100355206-100355228 GTGGGGAGAAAGAGGGAGGGAGG + Intergenic
1101577716 12:106013550-106013572 CTGGGTAAAAAGGAGGGGCTGGG - Intergenic
1102781265 12:115567086-115567108 TTGGGGAGAAAGAGTGAGGTGGG - Intergenic
1103111011 12:118278285-118278307 GAGGGTGGAAAGAAGGAGGAGGG - Intronic
1104092055 12:125525731-125525753 CTGGGAAGGAAGCAGGAGGCAGG - Intronic
1107743464 13:43479736-43479758 ATGGGCAGAAAGATGGAGCTGGG - Intronic
1108141337 13:47425309-47425331 CTGTGGAGAAAGAAAGAGGTGGG + Intergenic
1108149311 13:47515578-47515600 CTGGGTAGAAGGTAGGGTGTGGG - Intergenic
1108224806 13:48277554-48277576 CTGGAAAGAAAGAAGGAGGGAGG + Intergenic
1109158862 13:58947340-58947362 CTGGGCAGAGATAAGGAGGGTGG - Intergenic
1109512392 13:63396600-63396622 ATGTCTAGGAAGAAGGAGGTAGG - Intergenic
1109595204 13:64543934-64543956 CTGGGTAAAAAAAATGAGTTAGG - Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1111689017 13:91538174-91538196 CTGGTTAGATAGAATGAAGTGGG - Intronic
1112588461 13:100741202-100741224 ATGGGCAAAAAAAAGGAGGTTGG - Intergenic
1112938457 13:104830156-104830178 CTGGGTTTAAAGAAGAAGGAAGG - Intergenic
1113525513 13:110971764-110971786 CTGGGTAGGAGGGAGGAGGTTGG + Intergenic
1113905389 13:113817202-113817224 CTGGAGAGGAGGAAGGAGGTTGG - Intergenic
1113972450 13:114200302-114200324 CTGGGGACAGAGAAGGAGGCTGG - Intergenic
1114505953 14:23213582-23213604 CTCGGCAGCAAGAAGGTGGTGGG + Intronic
1114531471 14:23399217-23399239 CTGGGCAGAAAGGAGGAGGAAGG - Intronic
1114558940 14:23577625-23577647 CTGCGGAGAAAGAGGGAGGGGGG + Intronic
1115113039 14:29847171-29847193 ATGGTTAGAATGAAGGAGGGTGG - Intronic
1116823685 14:49650381-49650403 CTGGGCAGACATAAAGAGGTAGG + Exonic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118893581 14:69928205-69928227 CAGGCTGGAAAGCAGGAGGTTGG + Intronic
1119553925 14:75539165-75539187 CTGCTTAGAGAGAAGGAGCTTGG - Intronic
1119632977 14:76250129-76250151 TTGCGGAGAAAGAAGGAGGGAGG - Intronic
1120038712 14:79728270-79728292 CTGGGCTGGAAGAAGGAGTTGGG - Intronic
1121047834 14:90800880-90800902 CTGGCTTTAAAGAAGGAGGAAGG + Intronic
1121144716 14:91574003-91574025 CTGGGCAGGGAGGAGGAGGTTGG + Intergenic
1123069852 14:105637401-105637423 CCAGGTAGAAAGTGGGAGGTGGG + Intergenic
1123089086 14:105734189-105734211 CCAGGTAGAAAGTGGGAGGTGGG + Intergenic
1123184591 14:106504781-106504803 ATGGCTAGAATGAAGCAGGTAGG + Intergenic
1123999069 15:25739838-25739860 CTAGGTGGAAAGAAAGAGGCAGG + Intronic
1124075718 15:26442759-26442781 ATGGGAAGAAGGAAGTAGGTAGG - Intergenic
1124205239 15:27712932-27712954 CTGGCTATAAAGATGGAGGAGGG + Intergenic
1124642441 15:31404271-31404293 AAGGGTAGAAGGGAGGAGGTTGG + Intronic
1124840059 15:33233244-33233266 CTGGCTAGAAAGCAGCAGCTTGG - Intergenic
1125256710 15:37772347-37772369 CTGGGAAGAAAGTAGGAGTTGGG + Intergenic
1126522443 15:49611825-49611847 CTGGGCAGAAGGAAGAATGTAGG - Intronic
1128315385 15:66656337-66656359 GTGGTTAAAAAGAAGAAGGTAGG + Intronic
1128542117 15:68543502-68543524 CAGGGTAGAAAGATGGGGATTGG - Intergenic
1128793451 15:70449279-70449301 ATGGATAGAAGGAAGGAGGGAGG + Intergenic
1129144026 15:73632261-73632283 CTGGGTATAGAGATGGGGGTGGG - Intronic
1129272848 15:74428582-74428604 CTGGGCAGAAAGGAGGAGGAGGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129739521 15:77983511-77983533 CTGGGCAGGAAGAAGGAGAGGGG + Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1131133307 15:89913529-89913551 CTGTGCAGGAAGAAGGAGGGAGG - Intergenic
1131692129 15:94838586-94838608 CAGGGTAGAGAGAGAGAGGTGGG + Intergenic
1131837824 15:96408600-96408622 GTGGGTAGGAATAAGGAGGCAGG - Intergenic
1131948790 15:97657374-97657396 GTGGTAAGAAAGGAGGAGGTAGG + Intergenic
1132934358 16:2473406-2473428 CTGGGTAGAAGGTGGGAGGCTGG - Intronic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1135973473 16:27089324-27089346 AAGGGTAGAGAGAAGAAGGTAGG + Intergenic
1136079373 16:27841474-27841496 CTGGGCAGGAAGACAGAGGTGGG + Intronic
1136155661 16:28380380-28380402 CTGGGAAGAAAGAAGGCAGAGGG + Intronic
1136207423 16:28734909-28734931 CTGGGAAGAAAGAAGGCAGAGGG - Intronic
1136398005 16:30003509-30003531 CTGTGAAGACAGAAGCAGGTTGG + Intronic
1136949161 16:34694057-34694079 ATGGGAACAAAGAAGGAGTTAGG + Intergenic
1137385912 16:48042470-48042492 CTGGGTGGAAAGAAGGAAGGAGG - Intergenic
1138639763 16:58375508-58375530 CTGGGGCCAAAGAAGGAGGGAGG - Intronic
1139280680 16:65767745-65767767 CTAGGTAGGAAGTAGGAAGTAGG - Intergenic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG + Intergenic
1140557962 16:75943365-75943387 CTTGGTGAAAAGAAGGAAGTGGG + Intergenic
1140710385 16:77672107-77672129 CAGGGTAGAAAGATGAAGGCTGG - Intergenic
1140735697 16:77895982-77896004 TTGGAGAGAAAGATGGAGGTTGG + Intronic
1140861303 16:79020611-79020633 CTGGGTAGAAAGATGGCGATGGG + Intronic
1140937242 16:79684706-79684728 CTGAGTAGAAAGTCGGAGGAAGG + Intergenic
1142779645 17:2171437-2171459 CTGGGTAGAAAGAAGGATTACGG + Intronic
1142979315 17:3662589-3662611 CTAGGTTGCAAAAAGGAGGTTGG + Intergenic
1143873489 17:9974715-9974737 TTGGGTAGAAAAGAGGAGGGAGG + Intronic
1143874316 17:9980346-9980368 CTGGATCGGAAGAGGGAGGTGGG - Intronic
1144082451 17:11776486-11776508 CTGCCTAAAGAGAAGGAGGTTGG + Intronic
1144155216 17:12493821-12493843 CACGGGAGAAAGAAGGAGGCCGG - Intergenic
1144890317 17:18490596-18490618 CTTGGGAGCAAGAGGGAGGTGGG + Intronic
1145141899 17:20453722-20453744 CTTGGGAGCAAGAGGGAGGTGGG - Intronic
1145794004 17:27645177-27645199 CTTGGGAGCAAGAGGGAGGTGGG + Intronic
1145808806 17:27752712-27752734 CTTGGGAGCAAGAGGGAGGTGGG + Intergenic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1146289632 17:31598250-31598272 ATGGGAGGGAAGAAGGAGGTGGG + Intergenic
1146379056 17:32315008-32315030 ATGGGGAGAAGGGAGGAGGTGGG + Intronic
1146482187 17:33213705-33213727 CTGGGTGGAAAGAAGGGGAAAGG - Intronic
1148166563 17:45488197-45488219 CTGGATGGAAGGAAGGAGGGAGG - Intronic
1148737099 17:49871016-49871038 CTGGGTACAGAGGAGGAGTTGGG + Intergenic
1149009179 17:51836987-51837009 CTGGGGAGAAAGAAGGATGTGGG + Intronic
1149215335 17:54347418-54347440 GGAGGTAGAATGAAGGAGGTAGG + Intergenic
1149485188 17:57037013-57037035 CTGGGTGGAGAAAAGGAGGCTGG + Intergenic
1150265047 17:63826929-63826951 CTGGGGAGAAAGTAGAAGTTGGG + Intronic
1150397735 17:64834598-64834620 CTGGATGGAAGGAAGGAGGGAGG - Intergenic
1151198796 17:72452607-72452629 CTGTTTAGAGAGCAGGAGGTGGG + Intergenic
1151350067 17:73526408-73526430 TTGAGGAGAAAGAAGGGGGTGGG + Intronic
1151886749 17:76927093-76927115 CTGGGTAGAAAGGAGCAGGCAGG + Intronic
1153166020 18:2263023-2263045 CTGGGTACAGAGACTGAGGTGGG + Intergenic
1153185117 18:2477907-2477929 GTGGGGGGAAAGAAGGAGTTGGG - Intergenic
1153530142 18:6037943-6037965 CTGGGAAGAAAGAAGTTGATAGG + Intronic
1153734707 18:8053598-8053620 CTCCGTAGGAAGAATGAGGTAGG - Intronic
1153952977 18:10072433-10072455 CTGGGCATCAAGTAGGAGGTTGG + Intergenic
1153957437 18:10109957-10109979 CAGGCTAGAAAGAAAGATGTCGG - Intergenic
1155112476 18:22729673-22729695 CTAGGCAGAAAGAAGGAGGAAGG - Intergenic
1155304736 18:24467879-24467901 TTGGGAAGAAAGAATGATGTTGG + Intronic
1155444548 18:25897415-25897437 GGGGGGAGAAAGATGGAGGTGGG - Intergenic
1155970805 18:32081884-32081906 GTGAGTAGAAAAAAGGAAGTTGG + Intergenic
1156491987 18:37501714-37501736 GTAGGTAGGAAGAAGGAGGAGGG + Intronic
1157282789 18:46357213-46357235 CTGGGTAGCAAGGGTGAGGTGGG - Intronic
1157592117 18:48842261-48842283 CTGAGTAGAACGAGGGTGGTGGG + Intronic
1158318415 18:56237379-56237401 CTGGGTTTGAAGAAGGAGGAAGG + Intergenic
1158366879 18:56746365-56746387 ATGGGTAGAAAGGACGGGGTAGG + Intronic
1159123496 18:64196761-64196783 CTGGGTGGAGAGGAGGCGGTAGG + Intergenic
1159736039 18:72099060-72099082 CTGGCTAGAATAAAGGAGGCAGG - Intergenic
1160955634 19:1690474-1690496 CCTGGTAGGAAGGAGGAGGTTGG + Intergenic
1161012613 19:1967850-1967872 CTGGGGAGAAGGGAGGAGGGAGG - Intronic
1161012634 19:1967911-1967933 CTGGGGAGAAGGGAGGAGGGAGG - Intronic
1161407356 19:4097995-4098017 CTGGCTGGAGAGGAGGAGGTGGG + Intronic
1162834188 19:13305441-13305463 ATGGATAGAAGGAAGGAAGTTGG - Intronic
1163049483 19:14671387-14671409 CTGGATTTAAAGAAGGAGGAAGG - Intronic
1164554637 19:29241801-29241823 GGGGGAAGAAAGAAGGAGGCTGG - Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165585714 19:36914028-36914050 CTGGGTATTAATAAGGAGGGGGG + Intronic
1166552526 19:43675777-43675799 CTGGGGATAGAGATGGAGGTGGG + Intergenic
1166799373 19:45446697-45446719 CGGTGTAGAAAGTAGGAGCTGGG + Intronic
1166863145 19:45821172-45821194 CTGGGAGGAAGGAAGGAGGAGGG + Intronic
1167152337 19:47717437-47717459 CTGGGTAGAGAGAAGGGAATTGG - Intronic
1167474543 19:49692144-49692166 CTGGGTATGAAGGAGGAGGAGGG + Intronic
1167762568 19:51458663-51458685 CCGGGAAGCAAGAAAGAGGTTGG - Intergenic
1168104907 19:54160714-54160736 CTGGGTCCGAAGGAGGAGGTGGG - Intronic
1168539860 19:57201299-57201321 CTGGGTAGTAAAAAGAAGCTGGG + Intronic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925749494 2:7074821-7074843 AAGGGAAGAAAGAAGGAGGGGGG + Intergenic
925979963 2:9168711-9168733 CTGGATAGAAATCAGGAGTTTGG + Intergenic
926069216 2:9871823-9871845 CTGGGTAGGAAGAAGAAGACCGG + Intronic
926392201 2:12404848-12404870 CTGGGTGGAGTGAAGGATGTAGG - Intergenic
927448185 2:23184250-23184272 TTGGGTGGAAAGAAAGAGGCCGG - Intergenic
928589923 2:32803519-32803541 CTGGGGAGACAGAAGTGGGTTGG - Intronic
928613731 2:33016181-33016203 CTGTGCAGAGACAAGGAGGTGGG + Intronic
929521385 2:42654910-42654932 ATTAGTAGAAAGAAGGAGGCTGG - Intronic
931455762 2:62408735-62408757 CTGGGAAGAGAGAAGGAGCGAGG - Intergenic
931655053 2:64503144-64503166 CTTGGAAGAAAGAATGAGGAAGG + Intergenic
931784861 2:65609469-65609491 CTAGAAACAAAGAAGGAGGTGGG - Intergenic
931864011 2:66390485-66390507 CAGGGTAGAAAGAGGGGGGCTGG - Intergenic
933507144 2:83191868-83191890 CTGACTAGAGAGAAGGAGTTAGG - Intergenic
933656515 2:84891666-84891688 CTGGCAAGAAAGAAGGAAGAAGG - Intronic
933717012 2:85369058-85369080 CTGGGTAGGAGGATGGAGATGGG + Intronic
934232034 2:90192790-90192812 TTGGGTAGAAAGAGAGAGATGGG - Intergenic
935635239 2:105244835-105244857 CTGGGTATAAACAGGGAGGGAGG - Intergenic
935787238 2:106560333-106560355 CTGGGAAAAAAGAGGGAGGGAGG - Intergenic
936371000 2:111902316-111902338 CTGGGTAGAAAAACTGAGCTGGG + Intronic
936462592 2:112723737-112723759 CTGGGGAAGATGAAGGAGGTTGG + Exonic
940227048 2:151410572-151410594 GTGGGGAGAAAGAAGGTGGTTGG + Intronic
940640007 2:156334690-156334712 CTGGGGAGAAGGAAGGGGGTGGG + Intronic
940909726 2:159199970-159199992 GTGGGTCCAAAGAAGGAGCTGGG + Intronic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941268956 2:163401266-163401288 GAGGGTAGAAGGAAGGAGGAGGG - Intergenic
941492524 2:166159919-166159941 TTGGATAGAAAAATGGAGGTGGG + Intergenic
941641389 2:167992438-167992460 CAGAGCAGAAAGAAGGATGTGGG + Intronic
941925679 2:170892051-170892073 CTGGGTGGAGGGAAGGAGGAGGG + Intergenic
942044105 2:172089179-172089201 TTGGGTAGAAAGAGGGAGCGAGG + Exonic
942196571 2:173526656-173526678 CTGAGCAAAAAGAAGGAGGCTGG - Intergenic
942520153 2:176795433-176795455 CTGGGGAGAAAGAAAGACTTTGG - Intergenic
944663319 2:201939091-201939113 CTTGGTAGAAAGTAGGGGGCTGG + Intergenic
946159247 2:217826064-217826086 CTGGGAAGGAGAAAGGAGGTGGG - Intronic
947228614 2:227863426-227863448 CTGGGTAGAAGGGAGAAGGAGGG + Intergenic
947282407 2:228469976-228469998 CAGGGCAGAAAGCAAGAGGTGGG - Intergenic
947728113 2:232412871-232412893 CTGGATTGTAAGAAGGAGGGAGG + Intergenic
1169431825 20:5543058-5543080 TTTGGTAGAAGGAAGGAGGAAGG + Intergenic
1169900691 20:10549259-10549281 CACTGTAGAAAGAACGAGGTGGG - Intronic
1169912016 20:10654755-10654777 CTGGGCAGGGAGAGGGAGGTGGG + Intronic
1169992825 20:11522653-11522675 CTGACTAGAGAAAAGGAGGTGGG - Intergenic
1170458348 20:16554093-16554115 CTGGGTAGAAAGAAGGAGGTGGG + Intronic
1170555749 20:17513491-17513513 TAGGGTAGAAGCAAGGAGGTGGG + Intronic
1170630391 20:18059538-18059560 TTTGCTAGAAAGAAGGAGCTTGG + Intergenic
1170771855 20:19339829-19339851 TTGGGTAGAGAGAAGAAGGGAGG + Intronic
1170995685 20:21355219-21355241 CTGGGGAGAAAGGAGGAGTAGGG - Intronic
1172031372 20:31984422-31984444 CAGGGTAGAGAGAAGGACTTGGG + Intronic
1172268735 20:33640153-33640175 CTGGGTACGGAGATGGAGGTGGG - Intronic
1172917212 20:38452083-38452105 TTGGGTAGGAATAAGGAGGGGGG - Intergenic
1173144213 20:40510854-40510876 CAGGGAGGAAAGAAGGAGGAAGG + Intergenic
1173300052 20:41794474-41794496 TTGGGGAGAAGGAAGGAGGGAGG - Intergenic
1173377663 20:42503085-42503107 CTGGAGAGAAAAAAGGAGTTTGG + Intronic
1173502976 20:43566889-43566911 GTGGGTAGAAGGAGGGAGGGAGG + Intronic
1174037450 20:47677023-47677045 CTGGGCAGAGGGAGGGAGGTGGG + Intronic
1174664560 20:52245844-52245866 CTGGGTAGGAAAAATGAGGATGG + Intergenic
1174812387 20:53658066-53658088 ATGGGAAGAAAGAAGGGGGAAGG + Intergenic
1175369998 20:58481764-58481786 CTGGGTGGAACGAGGGAGGCTGG - Intronic
1179328717 21:40377515-40377537 CTTGGTAGAACAAAGGAGTTGGG + Intronic
1179931673 21:44574905-44574927 CTGGGTTGGCAGGAGGAGGTGGG - Exonic
1181049611 22:20232340-20232362 CTGGGTATAAGGAAGGAACTGGG - Intergenic
1183006881 22:34910963-34910985 TTGGGTATAAAGGAAGAGGTGGG + Intergenic
1183291956 22:37008147-37008169 CTGTGTAGGAAAAAGGAGGAAGG + Intergenic
1183434819 22:37787205-37787227 CTGTGTAGAAAGAAGTAGACAGG + Intergenic
1183582502 22:38734301-38734323 CTGGGAAGGGACAAGGAGGTAGG - Intronic
1185066280 22:48633143-48633165 CTGGGCAGCAAGGAGGAGGCTGG + Intronic
949399622 3:3652224-3652246 CTGAGTTGAGAGTAGGAGGTAGG - Intergenic
949789334 3:7775811-7775833 ATGGGTAGTCAGAAGTAGGTAGG + Intergenic
950549596 3:13658120-13658142 CTGGGTACAAAGAAGCAGCAAGG - Intergenic
951529689 3:23686812-23686834 CTGAGGGGAAAGCAGGAGGTGGG - Intergenic
951926255 3:27911933-27911955 CTGGGTGGAAGGAAAGAGGGAGG - Intergenic
954179124 3:48867758-48867780 CTTGGTAGAAACAAGCAGGGTGG + Intronic
954713334 3:52515534-52515556 CTGTCCAGAGAGAAGGAGGTGGG + Intronic
955522271 3:59786354-59786376 CCAGGTAGAAAGAAAGAGGAGGG - Intronic
955775018 3:62423571-62423593 GTGGTCAGAAAGAAAGAGGTTGG + Intronic
955909356 3:63844197-63844219 GTGGCTAGGGAGAAGGAGGTTGG + Intronic
955943353 3:64167650-64167672 CTGGGCAGAAAGATGGAGGCTGG + Intronic
956621017 3:71221599-71221621 TGCGGTAGAGAGAAGGAGGTTGG - Intronic
956890081 3:73604732-73604754 CTGGAGAGAAAGAGGGAGATAGG + Intronic
958466598 3:94467528-94467550 CAGGATAGAAAGAAGGATGAAGG + Intergenic
959681912 3:109105883-109105905 CTAGGTAGAGAGAAGGAACTGGG - Intronic
959991978 3:112640039-112640061 TTGGTTAGAGAGAAGGAGGGAGG + Intronic
960892045 3:122459434-122459456 CTTTGTAGGAAGAGGGAGGTAGG - Intronic
960940876 3:122933092-122933114 CTAGGCAGGAAGATGGAGGTTGG - Intronic
961311909 3:126007681-126007703 TTGGGGAGAAGGAAGGAGCTGGG - Intronic
962929014 3:140020464-140020486 AGGGGTAGAAAGAGAGAGGTAGG - Intronic
962935050 3:140073253-140073275 GTGGGAAGAAAGAAGGAGAGAGG + Intronic
962992241 3:140588827-140588849 CCAGGTAGAAATAAGGAGGAAGG - Intergenic
963863405 3:150333935-150333957 CTGGGTGGAAAGAGGTTGGTAGG + Intergenic
963982069 3:151549451-151549473 CTGGATATAAAGAAGAAGATAGG - Intergenic
964563963 3:158029403-158029425 CTGGGAAGGAAGAGGGAGGGAGG + Intergenic
964973902 3:162597217-162597239 CAGGGCAGAAAGTAGGAGATGGG - Intergenic
967182172 3:186915428-186915450 CATGCTAGAAAGCAGGAGGTGGG - Intergenic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075884 3:195815992-195816014 CTGCGTAGGGAGAAGGAGGCCGG - Intergenic
968566575 4:1316619-1316641 CTGGTTAGACAGAAGCAGGGAGG - Intronic
969220600 4:5756152-5756174 CAGGTTAGAAAGAAGGATGTTGG - Intronic
969257684 4:6013710-6013732 CTGGGTCCAAAGATGGAGGCGGG + Intergenic
969500414 4:7549266-7549288 CTGAGTTGAAAGAAGCAGGAAGG - Intronic
970007031 4:11421345-11421367 CTGGGTAGGAAGGAGGGGGAGGG - Intronic
971638729 4:29100636-29100658 TTGGTTAGAAAGATGGAGGCAGG - Intergenic
972369950 4:38413746-38413768 CTGGGGAGGAAGGAGGAAGTTGG - Intergenic
972492330 4:39599621-39599643 GTGGGTTGAAAGAAGAGGGTAGG + Intronic
973941406 4:55914706-55914728 CTGGGTGGAATGAAGGTAGTTGG + Intergenic
975143385 4:70940297-70940319 CTGGGTAGACAGAGGAAGGTGGG - Intronic
975218011 4:71779582-71779604 ATGGGTAGAATGAAGAAGTTAGG + Intronic
977303332 4:95293686-95293708 CTGGGTACAAAGAAGGGAGGAGG - Intronic
977459797 4:97310765-97310787 ATGGGAAGAAAGAGGGATGTGGG - Intronic
977814547 4:101399258-101399280 CTGTGTAGAAAGAAACAAGTTGG - Intergenic
977924736 4:102687150-102687172 GTGGGAAAAAAGAAGGAGTTAGG - Intronic
978134467 4:105240553-105240575 CTGTGTAGAAGGATGGAGGGAGG + Intronic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
979615140 4:122733654-122733676 CAGGGGAGAAAGACTGAGGTAGG + Intronic
979989906 4:127363402-127363424 CTGGTTTGAAAGGAGGAGTTGGG + Intergenic
980114450 4:128665782-128665804 CTTGGGAGAATGAGGGAGGTTGG + Intergenic
980166423 4:129233610-129233632 ATGGGTAGACAGAGGCAGGTGGG + Intergenic
980340621 4:131540514-131540536 CTGGGTAGAAAAAAGCATCTGGG + Intergenic
980343972 4:131587763-131587785 CTAGTTAGAAAGAAGGAGATTGG - Intergenic
981013581 4:139951127-139951149 ATGGGGAGAAAGAAAGAGGGAGG - Intronic
982010631 4:151102629-151102651 GAGGGTAGAAAGGAGGAGGGAGG + Intronic
983115156 4:163806396-163806418 CTGGGTGGAAAGAAAGGGATTGG - Intronic
983192879 4:164773192-164773214 CTTGGTAGGGAGAAGGAGGCTGG + Intergenic
983406934 4:167343098-167343120 ATGAGAGGAAAGAAGGAGGTGGG - Intergenic
984959094 4:185077327-185077349 CAGGGTGGAAAGAGAGAGGTCGG - Intergenic
985182280 4:187278375-187278397 CTGATTACAAAGAAGGAGGTAGG - Intergenic
985827666 5:2204949-2204971 CTGGGTAGAAGGAGGGAGGGAGG + Intergenic
986308317 5:6532063-6532085 CTGGGGATTAAAAAGGAGGTCGG - Intergenic
986705750 5:10453332-10453354 CTGGGTAGACAGGAGGTGCTCGG + Intronic
986729364 5:10623806-10623828 CTGGGTGGACAGGAGGAGGCGGG + Intronic
987063615 5:14266322-14266344 CTGGGTAGAAAGATGGATGAAGG - Intronic
988991845 5:36679294-36679316 CTGGCTAGGAAGACAGAGGTGGG + Intronic
989797217 5:45490496-45490518 CTGGGAAGAAAGAAGCAGTTTGG - Intronic
991125015 5:63060407-63060429 CTAAGTAGAAAGAAGGGGGTAGG - Intergenic
991435274 5:66591894-66591916 CTCTATAGAAAGAAGGTGGTTGG - Intergenic
992223318 5:74593816-74593838 CTGTGTAGAAAGAAGCCAGTAGG + Intergenic
993977145 5:94496502-94496524 CTGGTTAAAAAGCAGGGGGTGGG + Intronic
994912764 5:105933941-105933963 ATGAGTAAAAAGAAGCAGGTGGG + Intergenic
995021748 5:107374384-107374406 CTGTTTGGAAAGGAGGAGGTGGG + Intergenic
995312156 5:110726346-110726368 TTGGGGAGAATAAAGGAGGTGGG - Intronic
995478658 5:112573318-112573340 CTAAGCAGAAAGAAAGAGGTAGG - Intergenic
996413454 5:123183802-123183824 CTGTTTAGTAAGAAGGAGGAAGG - Intronic
996722953 5:126647852-126647874 CTGGGAAGAAAGTAGGAGCTAGG + Intergenic
996786256 5:127239892-127239914 CTGGGTAGAAGTAAGGATGAGGG - Intergenic
997189623 5:131918800-131918822 CCTGGTAGAAAGAATGAGATAGG - Intronic
997233703 5:132260520-132260542 CTGGAGAGAAAGAAGAAGGAAGG - Intronic
998801508 5:145874046-145874068 CTGGGTAGAAAATGGTAGGTTGG + Intergenic
999196049 5:149782481-149782503 CGGGGAAGAAGGAAGGATGTGGG + Intronic
1000998126 5:167979546-167979568 GTGGGAAGAAAGAAGGGGATAGG + Intronic
1001003669 5:168030881-168030903 CTGGGTGGAAAATGGGAGGTTGG + Intronic
1001303775 5:170556594-170556616 AGAGGAAGAAAGAAGGAGGTGGG + Intronic
1001315493 5:170638646-170638668 CCGGGTAGAGAGGAGGAGGGAGG - Intronic
1001710215 5:173772413-173772435 CGGGGCAGAAGGCAGGAGGTGGG - Intergenic
1002113239 5:176935851-176935873 GTGGGTAGGTAGGAGGAGGTAGG - Intronic
1002669585 5:180855748-180855770 CTTAGCAGTAAGAAGGAGGTGGG - Intronic
1002874163 6:1196631-1196653 CTGGGTAGAATGAAAGTAGTTGG - Intergenic
1004328128 6:14695743-14695765 CTGGGATGCAAGAAGGAGCTGGG - Intergenic
1004930025 6:20453971-20453993 CTAGGGAGAAACAAGCAGGTGGG - Intronic
1005316431 6:24606928-24606950 CTGGGAAGATGGAAGGAGCTGGG + Intronic
1005525757 6:26646341-26646363 CAGGCTAAAAATAAGGAGGTGGG + Intronic
1005891274 6:30140730-30140752 GTGGGTTGAAGGAAGGAGGAAGG + Intronic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1006440639 6:34051639-34051661 CTGGGAGGAAAGGAGGAGGCAGG + Intronic
1006673735 6:35747009-35747031 GTAGGTAGAAAAGAGGAGGTTGG + Intronic
1007037049 6:38684971-38684993 GTGGTAAGAAAGAAGGAGGAAGG + Intronic
1007405611 6:41634543-41634565 GGGGGTAGAAAGAAAGAGCTGGG + Intergenic
1007663188 6:43498952-43498974 CTGAGAAGCAAGAAGGAGGCAGG - Intronic
1007947219 6:45837393-45837415 CTGGGAAGCAAGAAGGAGCATGG + Intergenic
1008493424 6:52109067-52109089 CTGGCTATAAAGAAGGAGTGAGG - Intergenic
1009568347 6:65345139-65345161 CTGGAAAAAAAGAAGGAGCTAGG + Intronic
1010979113 6:82349866-82349888 CTTGTTAGAAAGATGGGGGTGGG + Intergenic
1011242978 6:85291892-85291914 TTGGGTAGGGGGAAGGAGGTGGG - Intergenic
1012013684 6:93827247-93827269 GTGTGTAGAAACAAGGAGCTGGG - Intergenic
1012603668 6:101130889-101130911 CTGGGTGGCAAGAAGGGGGAAGG + Intergenic
1013455009 6:110322698-110322720 CTCTTTTGAAAGAAGGAGGTGGG - Intronic
1013481197 6:110554216-110554238 CTGGGAGAAAAGAAGGAGCTTGG + Intergenic
1013592546 6:111631576-111631598 AGGGTTAGAAAGAAGGAGGCTGG + Intergenic
1013878935 6:114869920-114869942 CTAGGGATTAAGAAGGAGGTGGG - Intergenic
1013941266 6:115666182-115666204 CTGGGTAGAAAGGAGGCAGAGGG - Intergenic
1014545698 6:122733045-122733067 CAGGGAAAAAAGAAGGTGGTGGG - Intergenic
1014698919 6:124658814-124658836 CTAGGAAGGAAGAAGGAGATAGG - Intronic
1014833757 6:126133589-126133611 CTGGGTAGAAGGATGGATCTAGG + Intergenic
1015163960 6:130182612-130182634 GAGGGAAGAAAGAAGGAGGGAGG + Intronic
1019465697 7:1187317-1187339 CTGTTTAGCAAGAAGGAGGAAGG + Intergenic
1019515905 7:1440086-1440108 CTGGGCAGAAGGCATGAGGTCGG + Intronic
1020340216 7:7101893-7101915 CTGAGTAGGCAGAGGGAGGTTGG - Intergenic
1021738761 7:23664328-23664350 CTGGGTATAAAACAGGAAGTAGG - Intergenic
1021950502 7:25769546-25769568 ATGGAAAGAAAGAAGGAGGGAGG + Intergenic
1023022511 7:36022831-36022853 GTGGGGAGAGAGATGGAGGTGGG + Intergenic
1023360970 7:39414690-39414712 CGGGGTAGAAGGATGGAGGGCGG - Intronic
1023506711 7:40907041-40907063 CAGGGTAGGAAGATGGAAGTAGG + Intergenic
1023600811 7:41880274-41880296 CTGGGGAGAAACCAGAAGGTCGG + Intergenic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1024993416 7:55253880-55253902 CTCGGAAGAAAGATGGAGGCGGG - Intronic
1025944029 7:66092745-66092767 CTGGGGAGAGAGGAAGAGGTGGG - Intronic
1026185786 7:68081864-68081886 CTGTGAAGAGAGAAGGTGGTGGG + Intergenic
1026481084 7:70780205-70780227 CTGTCAAGAAACAAGGAGGTGGG + Intronic
1026930762 7:74221810-74221832 TTGGGTGGACAGAAGGAGGCTGG + Intronic
1027048730 7:75008149-75008171 GGGGGCAGAAATAAGGAGGTGGG - Intronic
1027234022 7:76287222-76287244 CTGCGGAGAAAGAGGGAGGGGGG - Exonic
1028382161 7:90211828-90211850 CAGGGGAGAAGGAAGGAGGGAGG - Exonic
1029384280 7:100233497-100233519 GGGGGCAGAAATAAGGAGGTGGG + Intronic
1029521837 7:101067745-101067767 CTGGGTTGAGAAACGGAGGTTGG - Intergenic
1029968346 7:104764037-104764059 CTGAGAAGAAAGAATGAAGTAGG - Intronic
1030266422 7:107626514-107626536 CTAGGTAGAAAGGAGAAGCTAGG - Intronic
1030344334 7:108415563-108415585 ATGGGTAGAAATTAGGATGTAGG - Intronic
1030675919 7:112385166-112385188 CTGGGCATAAAGAAGGGAGTGGG - Intergenic
1032455296 7:132068592-132068614 CTGGTGAGAAGGAAGGGGGTGGG - Intergenic
1032515195 7:132501655-132501677 CTGGCCAAAAAGAGGGAGGTGGG + Intronic
1032667795 7:134054295-134054317 CTGGGTGGCGAGGAGGAGGTGGG - Intronic
1032843046 7:135728894-135728916 CTGGTACGAAAGGAGGAGGTGGG + Intronic
1033501043 7:141950062-141950084 CTGAGGAGAAAGCAGGAGGTGGG - Intronic
1033532771 7:142282060-142282082 CTGGGTAACAAGAATGAGGCAGG - Intergenic
1034383365 7:150718450-150718472 CTGGGAAGAAAGAAGAAAATTGG - Intronic
1035329002 7:158084380-158084402 CTGGTTAGAAAGAAGTTGGTGGG - Intronic
1035382426 7:158448390-158448412 CTGGGGAGGAGGAGGGAGGTTGG + Intronic
1036197729 8:6735262-6735284 AAAGGTAGAAAGAAGGATGTGGG + Intronic
1036493234 8:9247075-9247097 CGAGGTTGTAAGAAGGAGGTGGG - Intergenic
1036783210 8:11664778-11664800 CTCAGAAGAAAGAGGGAGGTAGG - Intergenic
1037585075 8:20270543-20270565 CAGAGTAGAAAGAAGCAGGAAGG + Intronic
1037588699 8:20295474-20295496 CTGGGTAGAAAGAAGCACTGTGG + Intronic
1037745607 8:21641837-21641859 CTGGGAAGAAAGGTGGAGGCAGG - Intergenic
1037935303 8:22911469-22911491 AGGGGTGGAGAGAAGGAGGTGGG - Intronic
1037959921 8:23089211-23089233 CAGGGTAGAAAGTGGGAGGAGGG + Intronic
1038070595 8:24008532-24008554 CTGAGCAGAAATAGGGAGGTTGG - Intergenic
1038517758 8:28201874-28201896 CTGAGCAGAGAGAGGGAGGTGGG - Intergenic
1039759181 8:40556155-40556177 CTAGGTAGAAAAAAGGATATAGG - Intronic
1041062498 8:54049286-54049308 CTTGATAGAATGAAGGAGGCCGG - Intronic
1041512401 8:58666434-58666456 CTGAGGAGAAATAAGGAGGAAGG + Intergenic
1042108842 8:65357357-65357379 CTTGATAGAAAGAAGGAGAAGGG - Intergenic
1042363405 8:67908266-67908288 CTGGGTAGCATGAATGAGGCTGG - Intergenic
1042676690 8:71329258-71329280 ACGGGTAGAAAGAAGAAGGTAGG - Intronic
1044823380 8:96174071-96174093 CTGTGAAGAAAGAAGGGGGTAGG - Intergenic
1044993051 8:97813389-97813411 CTGGCTAGAATAAAGCAGGTAGG - Intronic
1045516098 8:102862963-102862985 CTAGGCAGAAAGAGGGAGATTGG - Intronic
1045855690 8:106762950-106762972 CTGGGGAGAAAAAGGGAGGGTGG - Intronic
1047312737 8:123706317-123706339 CTGAATGGAAAGAAAGAGGTAGG - Intronic
1047517097 8:125564430-125564452 CCAGGTAGCAAGAAGGAGGTGGG + Intergenic
1048274639 8:133057058-133057080 CGGGGAAGGAAGAAGGAGGTAGG - Intronic
1048350433 8:133611557-133611579 CTGAGTAGAAGAAAGGAGGTGGG + Intergenic
1048360053 8:133689884-133689906 CTGGGAAGAAAGAATGTGCTTGG + Intergenic
1048710233 8:137201626-137201648 ATGGGTGGATAGAAGGATGTTGG + Intergenic
1049083142 8:140457950-140457972 GTGGGGTGAAAGAAGGAGGGAGG + Intronic
1049175590 8:141190609-141190631 CTGGGTAGAAAGGCAGAGGGAGG - Intronic
1049371953 8:142272225-142272247 ATGGGTAGATGGAAGGAGGAAGG - Intronic
1050871555 9:10577534-10577556 CTGGGTGAAAAGAAAGATGTTGG - Intronic
1051518319 9:17955604-17955626 CTGGGTAGGACAAAGGAGGAAGG - Intergenic
1051735884 9:20198690-20198712 TTGGGGAGAGAGAAGGGGGTGGG - Intergenic
1051897214 9:21999984-22000006 TTGGGTAGTAAGAATGAGGGTGG + Intronic
1052081925 9:24216838-24216860 CTGGAAAAAAAGAAGGAAGTTGG - Intergenic
1052949702 9:34198659-34198681 CTAGGAACAAAGAAGGGGGTGGG - Intronic
1053067354 9:35078078-35078100 CTGGAGAGAAAGGAGGAGGAAGG + Intronic
1053145429 9:35708485-35708507 CTGGGAAGAGAAAAGGGGGTGGG + Intronic
1054770903 9:69083004-69083026 TTAGGTAGAAAAGAGGAGGTTGG - Intronic
1055421268 9:76145478-76145500 CTTGGTAGAAAAAATGAGCTGGG - Intronic
1055791660 9:79929067-79929089 CTGGGCATGAAGAAGGAGGTGGG - Intergenic
1055819321 9:80242814-80242836 ATGGAGAGAAGGAAGGAGGTAGG - Intergenic
1056180217 9:84075762-84075784 GTGGGTAGTAGGAAGGATGTAGG - Intergenic
1056459369 9:86794776-86794798 GTGGGGAGAAAGAATGAGGAGGG + Intergenic
1056655174 9:88503076-88503098 CTGGGGAGAAGGATGGAGCTGGG + Intergenic
1056668942 9:88606879-88606901 CTAGGTAGGAGGTAGGAGGTAGG + Intergenic
1058078559 9:100676171-100676193 CAGAGTTGGAAGAAGGAGGTGGG + Intergenic
1059392052 9:114005537-114005559 CTGGGTAGAGACAAGCAAGTGGG + Intronic
1059718678 9:116937294-116937316 CAGGGAATAAGGAAGGAGGTGGG - Intronic
1060967645 9:127720803-127720825 GAGGGAAGAAAGAAGGAGGGAGG - Intronic
1061204137 9:129153241-129153263 GTGGGGAGGAAGAAGGAGGCAGG + Intergenic
1061295311 9:129673861-129673883 CTGTTTAGACAGAGGGAGGTTGG + Intronic
1062075887 9:134589816-134589838 CTGAGGAGACAGCAGGAGGTGGG - Intergenic
1062103550 9:134740584-134740606 CTGGATGGATAGAAGGAGGACGG - Intronic
1062239173 9:135526607-135526629 CTGGGTGGGAAGCAGGAGGAAGG + Intergenic
1185694447 X:2184741-2184763 CTGGATAGATAGAAACAGGTGGG - Intergenic
1185724043 X:2405114-2405136 TAGGGTAGAAAGGAGGAGATAGG + Intronic
1186017818 X:5217994-5218016 AGGGGTAGAGAGAAGGAGGAGGG + Intergenic
1186196693 X:7116425-7116447 CTGGGAAGAAACCAGGAGGCAGG - Intronic
1187274891 X:17808569-17808591 CTGGGAAGTAAGAAGGAAGATGG - Intronic
1188786531 X:34353366-34353388 CACGGGAGAAAGAAGAAGGTTGG - Intergenic
1189767038 X:44382435-44382457 TTGGTTAGAAAAAATGAGGTCGG - Intergenic
1190702822 X:53000820-53000842 CTGGGTGGAAACCAGGAGGACGG + Intergenic
1192430815 X:71110395-71110417 ATGGGCAGAAAAGAGGAGGTAGG - Intronic
1194053111 X:89096896-89096918 CTGGAGAGAAATAAGCAGGTTGG + Intergenic
1194242966 X:91474370-91474392 CTGTGTAGAAAGAATGATGCTGG + Intergenic
1194418899 X:93648675-93648697 CAGGGTAGGATTAAGGAGGTGGG - Intergenic
1196081894 X:111641475-111641497 GTGGGTAGAAATAAGGATGGTGG - Intergenic
1197548352 X:127856202-127856224 CTGGGGAGAAATAAGCAGGGAGG - Intergenic
1197685493 X:129435487-129435509 TTGGGTAGTAAGAAGGTGTTGGG + Intergenic
1198394617 X:136208946-136208968 GAGGGTAGAAAGAAGGGGGTGGG + Intronic
1199269440 X:145865460-145865482 CTGGGAAGAGAGAAAGAGGGAGG + Intergenic