ID: 1170460249

View in Genome Browser
Species Human (GRCh38)
Location 20:16571142-16571164
Sequence GAGGTGAACAGGTTTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 293}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170460249 Original CRISPR GAGGTGAACAGGTTTGAGGA AGG (reversed) Intronic
900479230 1:2890060-2890082 GAGGTGGAGAGGGTAGAGGAGGG + Intergenic
900743802 1:4346507-4346529 GGGGTGGACAGGGCTGAGGAAGG + Intergenic
901143952 1:7052889-7052911 GAGGGGAGCAGGGTGGAGGAGGG - Intronic
901715386 1:11149484-11149506 GAGGTGAACAGGTACAATGAGGG - Intronic
902538401 1:17135214-17135236 GAGCTCAACAGGCTTGAGGCAGG - Intergenic
902867360 1:19288358-19288380 GAGGTGAACAGGGGTGGGGGCGG + Intronic
903425540 1:23251564-23251586 GAGCTGATTAGGTTTGGGGATGG - Intergenic
904069817 1:27785876-27785898 GAAGGGAGCAGGTTAGAGGAAGG + Intronic
905014359 1:34767085-34767107 GAGGAGACAATGTTTGAGGAGGG - Intronic
905256565 1:36688818-36688840 GAGGTGAAGAGGTGTGTGAAGGG + Intergenic
905473733 1:38211490-38211512 GTGGGGAACAGGTTTGCAGAGGG - Intergenic
905764806 1:40591487-40591509 CAGGGGTACAGGGTTGAGGAAGG - Intergenic
906712099 1:47938370-47938392 CAGGTGAAAAGGTTTGTAGATGG - Intronic
908025147 1:59942681-59942703 GCAGTGAACAGGTTGGTGGATGG + Intergenic
908843559 1:68302200-68302222 CAGGGGAACATGTTTAAGGAAGG + Intergenic
911102767 1:94107167-94107189 GAGGTTAACAGGGATGAGAAAGG - Intronic
913584618 1:120261995-120262017 AAGTTGAACAGTTTTAAGGAGGG + Intergenic
913623565 1:120636364-120636386 AAGTTGAACAGTTTTAAGGAGGG - Intergenic
914258958 1:145982849-145982871 GAGGAGGAGAGGTTTGAGAATGG - Intergenic
914926678 1:151894721-151894743 GAGGTGATGAGGTTGTAGGAGGG + Intronic
915318460 1:155042958-155042980 GAGGTGACCAGGGGTGAGGGAGG + Intronic
915632421 1:157162783-157162805 GAAGTAAACAGGATTGAGGAGGG - Intergenic
915667784 1:157460563-157460585 GAGTTGAACAGGGTTGTGGTGGG + Intergenic
915735496 1:158082074-158082096 GATGGGGACAGGTTTGAGGATGG - Intronic
917707084 1:177645676-177645698 GAGATGAACAGGTCTGCGGGAGG - Intergenic
918070816 1:181132189-181132211 GAGGTGAACAGGTGGGTGGAGGG - Intergenic
920369620 1:205469969-205469991 GAGGAGACAAGGTTTGAGCAGGG + Intergenic
921159342 1:212462368-212462390 GAGTTGACCAGGCATGAGGATGG + Intergenic
921856194 1:219987534-219987556 GTGGTGATAAGGTTTGAGGGAGG + Intronic
921914838 1:220595732-220595754 GTGGATAACAGGTTGGAGGATGG + Intronic
922534127 1:226367443-226367465 GAGGTTAAGATGCTTGAGGAAGG + Intronic
922618749 1:226978189-226978211 GAGGTGTGCAGGTATGAGGTGGG - Intronic
922618855 1:226978650-226978672 GAGGTGGGCAGGTGTGTGGAGGG - Intronic
922618863 1:226978681-226978703 GAGGTGTGCAGGTGTGTGGAGGG - Intronic
922618870 1:226978721-226978743 GAGGTGTGCAGGTATGAGGTGGG - Intronic
923032713 1:230262821-230262843 GAGGAGAACAGGGTTGGGGCAGG - Intronic
923119290 1:230976130-230976152 GATATGAACAGGTTTGTGGCTGG + Intronic
923163151 1:231335659-231335681 GTGGAGAAAAGGTTTGAAGAAGG - Exonic
923638271 1:235723385-235723407 GAAGAGAAGAGGTCTGAGGAAGG + Intronic
1063055169 10:2496425-2496447 GACCTTAACAGTTTTGAGGAGGG - Intergenic
1064026668 10:11854090-11854112 GAGGAGAACAGGTCTAAGGCTGG - Intronic
1066067896 10:31775497-31775519 GAGGAGAACAGGGGAGAGGAAGG + Intergenic
1067483111 10:46618750-46618772 GAAGTGGACAGATTTGAGAATGG - Intergenic
1067611643 10:47722894-47722916 GAAGTGGACAGATTTGAGAATGG + Intergenic
1067665354 10:48273372-48273394 GAGGTGAACAGGGGAGAGCAAGG - Intronic
1067741629 10:48899906-48899928 GAAGTGAAAAAGTCTGAGGATGG + Intronic
1070365491 10:75732887-75732909 GAGCTGAAAAAGATTGAGGAGGG + Intronic
1070484007 10:76912476-76912498 GAGGTGAAATGGTCTGAGGAGGG + Intronic
1070564243 10:77591352-77591374 GAGGTGGTCAGGCTTGAGTAGGG - Intronic
1071627064 10:87183134-87183156 GAAGTGGACAGATTTGAGAATGG + Intronic
1071808875 10:89156199-89156221 GAAGTGAAGAGATTTAAGGATGG + Intergenic
1075825634 10:125355266-125355288 GAGGTGCACAGGTGTGTGGCTGG + Intergenic
1075837496 10:125467550-125467572 TAGGTTAACTGTTTTGAGGAAGG + Intergenic
1076694056 10:132238500-132238522 CAGGTGAGCAGGTTTGAGACTGG + Intronic
1077839399 11:5958784-5958806 GAGGTGATCAGGGAGGAGGAGGG - Intergenic
1080255857 11:30289601-30289623 GATGTGGACAGGTCTGAGGTGGG - Intergenic
1080836919 11:35947877-35947899 AAAGTGAACAGATTTGGGGAGGG - Intronic
1082348680 11:51473053-51473075 GAGGTGAACAATTCTGATGATGG + Intergenic
1083297241 11:61721562-61721584 GAGATGCACATGGTTGAGGATGG - Intronic
1084413697 11:69018219-69018241 GAGGTGGACAGGGCAGAGGAGGG - Intergenic
1085140923 11:74140809-74140831 GAGATGAAGAGGGGTGAGGAGGG + Intronic
1085178163 11:74508729-74508751 GTGGAGAACAGGCTTGAGGAAGG + Intronic
1085249187 11:75130945-75130967 GTGGAGAACAGGTGTGAGAATGG + Intronic
1085318644 11:75561445-75561467 GGGGTGACAAGGATTGAGGAAGG + Intergenic
1085793043 11:79512562-79512584 GAGGTGAAGAGCTTGGAAGAGGG - Intergenic
1088547130 11:110970413-110970435 GAGCAGAACAAGTTTGTGGAAGG - Intergenic
1089150816 11:116362833-116362855 GAAGAGAACAGGTTTGAGCTCGG - Intergenic
1089511073 11:118997708-118997730 GAGGTAAGGAGCTTTGAGGAGGG - Intergenic
1090373990 11:126276322-126276344 GGGGTGGACAGGGTTGGGGAGGG + Intronic
1090806134 11:130203460-130203482 GGGGTGATCAGATTTGGGGAAGG - Intronic
1092580753 12:9838352-9838374 GGGGTGAATAGCTTTGAGGAAGG + Intronic
1095334162 12:41006749-41006771 AATGTTAACAGATTTGAGGATGG + Intronic
1095515249 12:42998551-42998573 TTTGTGAATAGGTTTGAGGAAGG + Intergenic
1097108043 12:56636587-56636609 GACGTGAACATGTTGGGGGAAGG + Intronic
1097707513 12:62883154-62883176 GAAGTGAGCAGGATGGAGGAGGG - Intronic
1099311583 12:81032878-81032900 GAGGTGAATAGGATTGGGAAAGG + Intronic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1101910780 12:108858720-108858742 GAGGTGACCAGTTATGGGGATGG + Intergenic
1103254607 12:119530291-119530313 GATGTGATCAGGTTTAAGGCTGG - Intronic
1103300998 12:119926616-119926638 GAGGTGACTAGGTCAGAGGATGG + Intergenic
1103733572 12:123044220-123044242 GAGGTGACCAGGAGTGAGAAAGG - Intronic
1105639099 13:22244128-22244150 GTTGTGAACAGGTTTAAAGAGGG + Intergenic
1110557991 13:76882520-76882542 GAGTTGAGCAGATTTGAGAAGGG + Exonic
1111176998 13:84607886-84607908 GAGGTGAAAGAGTATGAGGAAGG + Intergenic
1111825381 13:93261209-93261231 GAGGGGCACAGGTTTTAAGAGGG + Intronic
1113762449 13:112859063-112859085 CAGGTGGAAATGTTTGAGGAAGG + Intronic
1115771406 14:36666548-36666570 GCGGTGAACGGGTTGGAGAAGGG + Exonic
1115778666 14:36745014-36745036 GAGGGGAACATGTTGGAGGGTGG - Intronic
1115954537 14:38763593-38763615 GAGCTGAAGATGTTTGAAGATGG - Intergenic
1120949304 14:90026407-90026429 GATGTGGACAGGTGAGAGGAAGG - Intronic
1122278126 14:100605576-100605598 GGTGGGAGCAGGTTTGAGGAGGG + Intergenic
1122503967 14:102219850-102219872 GAGGAGGACAGGTTTGAGGGCGG + Intronic
1123134258 14:106012492-106012514 GAGGTGAAAAGGGATGAGGGAGG + Intergenic
1123165942 14:106324823-106324845 GAGGTGAAAAGGGATGAGGGAGG + Intergenic
1123584286 15:21742935-21742957 GAGGTGAAAAGGGATGAGGGAGG + Intergenic
1123620937 15:22185538-22185560 GAGGTGAAAAGGGATGAGGGAGG + Intergenic
1125706686 15:41743621-41743643 GGGGTGCACATCTTTGAGGAGGG + Intronic
1127968610 15:63942188-63942210 GAGGTGAGCCTGTGTGAGGAAGG - Intronic
1128319612 15:66683829-66683851 GTATTGATCAGGTTTGAGGAAGG + Intronic
1128971858 15:72115220-72115242 GAGGAGAAAAGGTTTTAGGATGG - Intronic
1130205086 15:81868384-81868406 GAGGAGAGAAGGTTGGAGGAAGG - Intergenic
1132152428 15:99472296-99472318 GAGGTGATCAGGTTTAGGCAAGG - Intergenic
1135410618 16:22231686-22231708 GAAGTGATGAGTTTTGAGGAGGG - Intronic
1137259471 16:46812514-46812536 GAGGTAGACAGGATTGTGGATGG + Intronic
1138238073 16:55402383-55402405 GAGGTGAGCAAATATGAGGAAGG - Intronic
1141180323 16:81748530-81748552 GAGGAGAACTGGTTTGGGGGAGG + Intronic
1141448706 16:84081810-84081832 GGGGTCAACATGTTTGAGCAAGG - Exonic
1141596891 16:85102717-85102739 GAAGGGAACAGGATGGAGGATGG - Intronic
1141819610 16:86436047-86436069 GAGGTGGACATGTTTCATGATGG - Intergenic
1142900415 17:3008092-3008114 GAGGAGGACAAGTTTGAGAATGG + Exonic
1143530556 17:7500745-7500767 GATGTGACCAGGTATGATGAGGG - Exonic
1144956867 17:19023073-19023095 GTGGTGAACAGGGAGGAGGATGG + Intronic
1146514910 17:33481624-33481646 GAGGTGTAGAGGTTGAAGGAAGG - Intronic
1147692378 17:42324498-42324520 GAGGTGATCATTTTTGAGGTGGG - Intronic
1150843195 17:68628477-68628499 AAGATAAACAGTTTTGAGGAAGG - Intergenic
1153169598 18:2300904-2300926 GATGTGAGCATCTTTGAGGAGGG - Intergenic
1153448190 18:5196980-5197002 GAGGGGAGCAGGGTAGAGGACGG - Intronic
1157733496 18:50025358-50025380 GTTGTGAACTGGTTGGAGGAAGG - Intronic
1158275366 18:55760981-55761003 GAGGAGCACAGGTTTGTAGAAGG + Intergenic
1160347871 18:78149719-78149741 GAGATGAATAAGCTTGAGGAAGG - Intergenic
1160696333 19:486378-486400 GAGGTGGAGAGATTTGAGCAAGG - Intergenic
1162526760 19:11210740-11210762 GAGGTGAACAGGTGAGGGGGTGG - Intronic
1162801371 19:13112605-13112627 AAGCTGAGCAGGTCTGAGGAGGG + Intronic
1163565181 19:18046838-18046860 GAGGTGACCAGGGTCCAGGAGGG + Intergenic
1166089288 19:40497807-40497829 GAGAGGAAGAGGTGTGAGGATGG - Intronic
1166333163 19:42090339-42090361 GAGGGTGACAGGGTTGAGGAGGG + Exonic
1166667425 19:44689477-44689499 GAGGTGTCCAGGTTTGGGGTTGG - Intergenic
1167105289 19:47426855-47426877 GATGAGAACAGGTTTGTGGAAGG - Intergenic
1167622177 19:50566526-50566548 GAGGTGAGGAGGTCTGGGGAAGG + Intronic
926084229 2:10010829-10010851 TAGGTGGACAGGCTTGAGTATGG + Intergenic
926084423 2:10011815-10011837 CAGGTGGACAGGATTGAGTACGG + Intergenic
929810358 2:45184492-45184514 AAGGTCAGCAGGTTCGAGGAGGG + Intergenic
931710646 2:64987347-64987369 GGGATGAGCAGGTTTGAGGAAGG + Intergenic
937055277 2:118929394-118929416 GGCAGGAACAGGTTTGAGGATGG + Intergenic
937541280 2:122957142-122957164 GAGTTGAAGAGGTGTGAAGATGG - Intergenic
938025084 2:127940673-127940695 GAGTTGAACAGATTTGAGATGGG - Intergenic
938650889 2:133382336-133382358 GTGGTGAACAGATTCGAGGGAGG - Intronic
941166725 2:162090805-162090827 GTGGTGACCAGGTTTGGGGATGG + Intergenic
941934079 2:170969802-170969824 AAAGTGCACAGGTTAGAGGAGGG + Intergenic
942417413 2:175773447-175773469 GAAGAGAGCAGGTTTGAGCAAGG + Intergenic
942708333 2:178802305-178802327 GAGGTGAGCTGGTTTAGGGATGG - Exonic
945501878 2:210585923-210585945 CAGATGAACAGGTGTCAGGAAGG - Intronic
945544760 2:211137240-211137262 GAGTTGAACAGGGTTGTGGTTGG - Intergenic
945709277 2:213276180-213276202 GAAGTGAACAAGATAGAGGAGGG + Intergenic
947648170 2:231760445-231760467 AATCTGTACAGGTTTGAGGATGG + Intronic
947818356 2:233053408-233053430 GAGGTGAACAGGGTTGAGTTAGG - Intergenic
1168774093 20:433942-433964 GAGATGAACAGGGTTAGGGATGG + Intergenic
1168970930 20:1930166-1930188 GAGGTGAGCAGGTGACAGGAGGG - Intronic
1169900459 20:10547425-10547447 GAGGTGAAAAGGACTCAGGAGGG - Intronic
1170128440 20:12991328-12991350 CATGTGAACAGGGTTAAGGATGG + Intergenic
1170460249 20:16571142-16571164 GAGGTGAACAGGTTTGAGGAAGG - Intronic
1172470450 20:35189887-35189909 GAATTGAAGAGTTTTGAGGAAGG + Intergenic
1173352181 20:42255238-42255260 GCGGTTAACAGGTTTGATCAAGG - Intronic
1173885765 20:46457655-46457677 GAGGTGAGCTGGGCTGAGGATGG - Intergenic
1174324899 20:49771373-49771395 TAGGGGAACAGGTTTGAGGAGGG - Intergenic
1174443725 20:50576470-50576492 GAGGTGAGCAGGTGTGAGGGAGG + Intronic
1177177070 21:17711786-17711808 GATGAGAACTGGTTGGAGGAAGG + Intergenic
1179028125 21:37697254-37697276 GAGCTAAACTGGTTTGAGGAGGG + Intronic
1180626870 22:17199425-17199447 GAGGGGAAGAGGATAGAGGAGGG - Intronic
1182269657 22:29145438-29145460 GCGGGGAACAGGGGTGAGGATGG - Intronic
1182511162 22:30821529-30821551 GAGGTGGGGAGGGTTGAGGAAGG + Intronic
1182584758 22:31338404-31338426 AAGGTGAACAGATTTGTGCAAGG + Intronic
1183034250 22:35129179-35129201 GAGGTGTACAGGCTTGAGCCTGG - Intergenic
1183150822 22:36036058-36036080 GAGGTGATCAATTTTGGGGAAGG - Intergenic
1183383534 22:37502534-37502556 GAGGGGAACAGGAGTGAGGTGGG - Intronic
1183573749 22:38673721-38673743 GAGGAGGCCAGGTGTGAGGAAGG - Exonic
1184532236 22:45063575-45063597 CAGGTGAAGAGGTTTGCCGACGG - Intergenic
949838215 3:8291971-8291993 GTGGGGAGCAGGTTTGAGGAAGG + Intergenic
950296871 3:11839704-11839726 GAGGGGAACAGTTTTAGGGAGGG - Intronic
950358354 3:12430715-12430737 GAGATGAACAGGAGAGAGGAAGG + Intronic
952676918 3:36043677-36043699 GAGGTGAAGATATTTGAGAATGG + Intergenic
954906988 3:54071398-54071420 GAAGACATCAGGTTTGAGGATGG - Intergenic
956881135 3:73511591-73511613 GAGGGGAACAGATCTGGGGATGG + Intronic
957917254 3:86701727-86701749 GAGATGAACAGGGTTGTAGAAGG + Intergenic
961001999 3:123380259-123380281 GTGGTGAACAGGCTTGAGTAGGG + Intronic
961478097 3:127161133-127161155 GAGAGGAGCAGGTTTGGGGAGGG - Intergenic
962564533 3:136644218-136644240 GTGGTGAAAAACTTTGAGGATGG + Intronic
963736092 3:149019392-149019414 GAGGTGAGCAGGACTGTGGAGGG - Intronic
963738398 3:149048535-149048557 ATGGCAAACAGGTTTGAGGATGG + Intronic
964427881 3:156572451-156572473 GAGGTCCAAAGGTTTGAGAAGGG + Intergenic
964448494 3:156786361-156786383 GAGGTGGACAAGGTTGATGAAGG + Intergenic
964838090 3:160962884-160962906 GAGGTGAAGGGGTTAGAGGGTGG - Intronic
966301154 3:178480867-178480889 GAGAAGAACAGCTTTGAGAAAGG - Intronic
966579322 3:181541971-181541993 GAGATGAAAAGGTTACAGGATGG - Intergenic
966835709 3:184048085-184048107 GAGGTGACCAGGTGTGAAGCTGG + Intergenic
966877469 3:184331354-184331376 TCGCTGAACAGGTTTGGGGATGG + Exonic
967831650 3:193925053-193925075 GAGCTGAACAGGTATGTGGTGGG - Intergenic
969495851 4:7525792-7525814 GCAGGGAACAGGTATGAGGAGGG - Intronic
970850589 4:20598166-20598188 GAGGTGAACAGGTTTTACTATGG - Intronic
971677904 4:29657836-29657858 TAGGTAAACAGTTTTGTGGAAGG - Intergenic
972430887 4:38980781-38980803 GAGGGGAGCAGGTTTGTAGAGGG + Intronic
974928207 4:68327500-68327522 GAATTTAACAGGTTTGAGGTGGG + Intronic
976275244 4:83270124-83270146 GAGTTGAAAGGGTTTAAGGAAGG - Intronic
977313167 4:95412243-95412265 GTGGTGAAGAGGATTGAGAAGGG - Intronic
978372806 4:108046124-108046146 GAGGGGACCAAGTTTGTGGAAGG + Intergenic
978542267 4:109830596-109830618 GGGAAGAACAGGTTTGAGGCAGG + Intronic
978759465 4:112340635-112340657 CAGGTGAAAAGGGTTGAGGGGGG - Intronic
979692915 4:123579462-123579484 GAGGTGATAAGGTTTGAATAGGG + Intergenic
981035387 4:140163535-140163557 GAGCTGGAAAGGTTTAAGGATGG + Intergenic
982337795 4:154259127-154259149 AAGGTGAACAGGCATGTGGACGG - Intronic
982353395 4:154441840-154441862 GTGGTTGAAAGGTTTGAGGAGGG + Intronic
983509984 4:168598586-168598608 GAGGTGAACATGATTGAAGATGG - Intronic
984240834 4:177217669-177217691 GACATGAACAGGTTTGAAAATGG + Intergenic
984296407 4:177860383-177860405 GAGGTGTAGAGGAGTGAGGAGGG + Intronic
986177030 5:5361227-5361249 GAGGTCAACAGGGGTAAGGATGG - Intergenic
986517692 5:8581096-8581118 GGAGGGGACAGGTTTGAGGAGGG - Intergenic
991533237 5:67638083-67638105 GAAGTGAGCAGGTTTGGGAAAGG + Intergenic
992679223 5:79136456-79136478 GATGTAAACAATTTTGAGGAAGG - Intronic
992688139 5:79217852-79217874 GAAATGAATAGGATTGAGGAGGG - Intronic
992849904 5:80796846-80796868 GAGGTGGGCAGGGTGGAGGAGGG - Intronic
993208548 5:84918916-84918938 GAGGTTGAAAGGTGTGAGGAGGG + Intergenic
993394333 5:87364706-87364728 GTAGGGAACTGGTTTGAGGAAGG - Intronic
994069323 5:95580921-95580943 GAAGTGAAAAAGTTTGAGAAAGG + Intronic
994446788 5:99885650-99885672 GAAGTTAAAAGGTTTGAGAAGGG - Intergenic
995639298 5:114235624-114235646 TGGGTGAACAGGTTTAAGAAAGG + Intergenic
995682138 5:114731825-114731847 GAGGACAAGACGTTTGAGGAAGG + Intergenic
996898037 5:128509374-128509396 GAGGTGAACATTTTTCTGGATGG - Intronic
997695836 5:135860015-135860037 GAGGTCAACAGGCTAGAGGGAGG - Intronic
998274727 5:140741660-140741682 GAGCTGAAGAGGTTTAAGGTTGG + Intergenic
998798478 5:145843675-145843697 AAGGAGCACAGCTTTGAGGAGGG + Intergenic
999788232 5:154911651-154911673 GAGTTGATCAGGATTGAGCAAGG - Intronic
1001893382 5:175358293-175358315 GAGGTGAGCAGGTCAGAGCATGG - Intergenic
1003026037 6:2556662-2556684 GAAGTGAACAGGGTTGGTGACGG - Intergenic
1003561757 6:7186310-7186332 TATGTGCCCAGGTTTGAGGATGG - Intronic
1003588777 6:7418790-7418812 GACGGGAGCAGGTTTGGGGAGGG + Intergenic
1005176304 6:23048683-23048705 CAGATGAACAGATTTGAGGTAGG + Intergenic
1006593559 6:35176240-35176262 TAGGTGAACAGGTTAGAGAAAGG + Intergenic
1006650893 6:35550649-35550671 GAGATGATCTAGTTTGAGGAAGG + Intergenic
1007653552 6:43438301-43438323 GAGGAGCATAGGTTTGAGGGAGG + Intronic
1012410654 6:98953200-98953222 GAGATGTAAAGGTTGGAGGAAGG - Intergenic
1013067034 6:106694003-106694025 GCTGTAAACAGGTTTGAGAACGG - Intergenic
1013249574 6:108320884-108320906 GAGGAGAACAGGATTGTGGGAGG + Intronic
1015199102 6:130559152-130559174 GAGGTGAACTGATTTGATTAAGG - Intergenic
1015635342 6:135269070-135269092 CAGGTTAACAGGTGTGAGTATGG - Intergenic
1016926627 6:149356635-149356657 GAGGTGATCAGGTTTGAGTGTGG - Intronic
1017381900 6:153840911-153840933 GAGGTGATGAGTTTTCAGGACGG + Intergenic
1018204896 6:161428141-161428163 GAGGCGCACGGCTTTGAGGAAGG - Intronic
1019644597 7:2122237-2122259 GAGGTGGACAGGTCTGACGCGGG - Intronic
1024022693 7:45386237-45386259 GAGGTGATCAGGTTTTATAATGG + Intergenic
1025144372 7:56491942-56491964 GAGTTGAAGAGGTTGGAGGCTGG + Intergenic
1025259977 7:57412421-57412443 GAGTTGAAGAGGTTGGAGGCTGG + Intergenic
1027243219 7:76347021-76347043 GAGGGGGAGAGGTTGGAGGAAGG - Intronic
1027254939 7:76425226-76425248 GATGTGGTCAGGTTTGAGGTTGG + Exonic
1027503392 7:78984017-78984039 AAGAGAAACAGGTTTGAGGAGGG - Intronic
1029403224 7:100358139-100358161 GAGGTGTACTGGTTTGGGGAAGG + Intronic
1029405800 7:100373493-100373515 GAGGTGCACTGGTTTGGGGAAGG + Exonic
1029480339 7:100808557-100808579 GAGCTGAACAGCTTTGTGGTTGG - Intronic
1030525911 7:110654763-110654785 GAGGTGAATATGGTTTAGGAAGG + Intergenic
1031889921 7:127282111-127282133 GAGGAGAACAGGATGGATGAAGG - Intergenic
1031959488 7:127976023-127976045 AAGGAGAACAGGGTGGAGGAGGG - Intronic
1032153227 7:129447888-129447910 GAGTTGAACAGGGTTGTGGTGGG + Intronic
1032473995 7:132199966-132199988 GAGGTGGACAGATGTGGGGAAGG + Intronic
1033348904 7:140546003-140546025 GAGGTGATCTGGTTTGCTGAGGG + Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034926142 7:155123858-155123880 GACCTGGACAGTTTTGAGGAGGG + Intergenic
1036221646 8:6926000-6926022 GAGGAGAACAGCAGTGAGGATGG + Exonic
1036657050 8:10683451-10683473 GAGGGGACAAGGTATGAGGATGG + Intronic
1037632486 8:20671065-20671087 GAGTTGTACAGGTTTGGGGCTGG - Intergenic
1038271880 8:26081964-26081986 GAGGGGAAGAGGGTTGAGGGTGG - Intergenic
1039257330 8:35733801-35733823 GAGGGGTACAGGGGTGAGGATGG + Intronic
1039967906 8:42297100-42297122 GATGTGAACAGGTCTGAGGAAGG - Intronic
1041197840 8:55418771-55418793 GAGCTGGACAGGTGTCAGGAAGG - Intronic
1043503674 8:80881570-80881592 GAGGTGAACAGGCTTCAGGGAGG + Intergenic
1043919603 8:85965879-85965901 GAGATGAACTGGTGTGGGGAAGG + Intergenic
1045265186 8:100612936-100612958 GGGGTGGACAGGTGTGAGCAGGG - Intronic
1045882777 8:107060853-107060875 GAGTTGATAAGGTGTGAGGAAGG + Intergenic
1047290629 8:123526615-123526637 TAGGGGAACTGGTTTGAGGTAGG - Intronic
1047341316 8:123983114-123983136 GAGCTGTTCAGGTGTGAGGAAGG - Intronic
1047681490 8:127258372-127258394 GAGGTGAGGAGGTCTGAGAAGGG + Intergenic
1048117690 8:131543882-131543904 GAGGTGGATAGATTTGAAGATGG + Intergenic
1048146216 8:131846438-131846460 GAGGTGAACTTATTTGAAGAGGG + Intergenic
1048383030 8:133884966-133884988 GACCTTAACAGTTTTGAGGATGG - Intergenic
1049808441 8:144551956-144551978 GAGATGGACAGGTTAGAGAAGGG - Intronic
1050057755 9:1673513-1673535 GAGGAGAAAAGTTTTGATGAGGG - Intergenic
1050081671 9:1922000-1922022 GTGGTGGACAAGTTTGAGTAAGG + Intergenic
1050691114 9:8227311-8227333 GAAATGAAGGGGTTTGAGGAAGG + Intergenic
1050764492 9:9115171-9115193 GAAGGGAAGAGGTTTGAAGAAGG + Intronic
1051359696 9:16270933-16270955 GAGGTGATTAGGTCTGAGCAGGG + Intronic
1053363913 9:37509388-37509410 GATGTGGAGAGGTGTGAGGAGGG - Intergenic
1053604231 9:39640557-39640579 GGGCAGAACAGGTTTGAGGGAGG - Intergenic
1053654675 9:40204694-40204716 GATTTGAACAGCTTTGAAGAAGG + Intergenic
1053862051 9:42396608-42396630 GGGCTGAACAGGTTTGAGGGAGG - Intergenic
1054249309 9:62701857-62701879 GGGCAGAACAGGTTTGAGGGAGG + Intergenic
1054366790 9:64350911-64350933 GATTTGAACAGCTTTGAAGAAGG + Intergenic
1054563421 9:66736389-66736411 GGGCAGAACAGGTTTGAGGGAGG + Intergenic
1054674419 9:67840653-67840675 GATTTGAACAGCTTTGAAGAAGG + Intergenic
1054765701 9:69040811-69040833 GAGGTGATGAGGTATGAGGGTGG + Intronic
1054997084 9:71404426-71404448 GAGATGAATAAGTTAGAGGAAGG - Intronic
1055155059 9:73052593-73052615 AAGGCAAACAGGTTTCAGGAAGG + Intronic
1058217366 9:102251867-102251889 GAGATGATCAGGTTTGTGGATGG + Intergenic
1058471851 9:105287746-105287768 GAGGTAAACAGGTATGGAGAGGG - Intronic
1061759496 9:132840452-132840474 CAAGTGAACAGGCATGAGGAAGG + Intronic
1186097013 X:6113044-6113066 GACCTTAACAGTTTTGAGGAGGG - Intronic
1186341875 X:8654141-8654163 CAGGGGAACAGGTTTAACGAAGG - Intronic
1187270335 X:17774990-17775012 GAGCAGAAGAGGTGTGAGGATGG - Intergenic
1187320173 X:18230718-18230740 GAGCAGAAGAGGTGTGAGGATGG + Intergenic
1189962830 X:46340696-46340718 GAGGTGATCAGTTTTAGGGAGGG + Intergenic
1190343594 X:49317267-49317289 GAGGTGAAAAGGCCTGAAGAAGG + Exonic
1191047215 X:56151434-56151456 GAAGTGAACAGACTTGAGAAAGG + Intergenic
1191895794 X:65991558-65991580 GAGGGGACCAGGATTGAGGTAGG - Intergenic
1192141670 X:68651665-68651687 CAGCTGAAGAGGTATGAGGAGGG + Intronic
1192976748 X:76294337-76294359 GAGTTGAAAAGGTGTAAGGAAGG + Intergenic
1194599911 X:95907368-95907390 GAGTTGAATAGGGTTGACGAGGG + Intergenic
1195860864 X:109381370-109381392 GAGGTGAAGTAGTTTGAGCAGGG - Intronic
1195989391 X:110667740-110667762 GAGGTAAACAGGTTTATTGAAGG + Intergenic
1197471544 X:126869354-126869376 GAGCTGAATAGTTTTGAGGATGG - Intergenic
1197754587 X:129984549-129984571 GAGGTGAACTGGTCGGTGGAGGG + Intronic
1198272168 X:135065266-135065288 GTGTTGTACAGGTTTGAGTAGGG - Intergenic
1199656432 X:149999616-149999638 GTGCTGAACAGGTCAGAGGAAGG - Intergenic
1199950817 X:152704521-152704543 GAGGTGTTCAGGCTTGTGGAGGG + Intergenic
1199958865 X:152763940-152763962 GAGGTGTTCAGGCTTGTGGAGGG - Intergenic
1199995397 X:153021598-153021620 GTGGTGAACAGGAGGGAGGAGGG - Intergenic
1200047988 X:153412726-153412748 GAGGTGCAGAGGTGGGAGGAGGG + Intergenic
1200987913 Y:9323870-9323892 GAGGTGGACAGGTTTGGGAGTGG - Intergenic
1201948893 Y:19541524-19541546 TAGGTGCACAGGATAGAGGAGGG + Intergenic
1202109164 Y:21403794-21403816 GAGGTGGACAGGTTTGGGAGTGG - Intergenic
1202120110 Y:21512325-21512347 GAGGTGGACAGGTTTGGGAGTGG + Intronic
1202122561 Y:21535866-21535888 GAGGTGGACAGGTTTGGGAGTGG + Intronic
1202156444 Y:21893517-21893539 GAGGTGGACAGGTTTGGGAGTGG - Intronic
1202158892 Y:21917058-21917080 GAGGTGGACAGGTTTGGGAGTGG - Intronic
1202185344 Y:22181973-22181995 GAGGTGGACAGGTTTGGGAGTGG - Intronic
1202197521 Y:22309812-22309834 GAGGTGGACAGGTTTGGGAGTGG + Intronic
1202206016 Y:22404422-22404444 GAGGTGGACAGGTTTGGGAGTGG + Intronic