ID: 1170463524 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:16601420-16601442 |
| Sequence | GATTTCTGGGACAGAAAAGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1170463524_1170463530 | -3 | Left | 1170463524 | 20:16601420-16601442 | CCTACTTTTCTGTCCCAGAAATC | No data | ||
| Right | 1170463530 | 20:16601440-16601462 | ATCCCTTGGGGTCTTCAGCTTGG | No data | ||||
| 1170463524_1170463535 | 30 | Left | 1170463524 | 20:16601420-16601442 | CCTACTTTTCTGTCCCAGAAATC | No data | ||
| Right | 1170463535 | 20:16601473-16601495 | TCACATTTTAAGCACAGTAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1170463524 | Original CRISPR | GATTTCTGGGACAGAAAAGT AGG (reversed) | Intergenic | ||