ID: 1170463524

View in Genome Browser
Species Human (GRCh38)
Location 20:16601420-16601442
Sequence GATTTCTGGGACAGAAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170463524_1170463530 -3 Left 1170463524 20:16601420-16601442 CCTACTTTTCTGTCCCAGAAATC No data
Right 1170463530 20:16601440-16601462 ATCCCTTGGGGTCTTCAGCTTGG No data
1170463524_1170463535 30 Left 1170463524 20:16601420-16601442 CCTACTTTTCTGTCCCAGAAATC No data
Right 1170463535 20:16601473-16601495 TCACATTTTAAGCACAGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170463524 Original CRISPR GATTTCTGGGACAGAAAAGT AGG (reversed) Intergenic